Starting /dee2/code/volunteer_pipeline.sh SRR3166985 current disk space = 1548430585856 free memory = 1601976008 SRR3166985 SRAfilesize 8806b84ca7f1bf5d30a56ca0b7f4ea03 SRR3166985.sra SRR3166985.sra file validated SRR3166985 is paired end SRR3166985 is conventional basespace SRR3166985 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3166985_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.014 33.0 27.0 34.0 2.0 34.0 2 27.18575 34.0 28.0 34.0 2.0 34.0 3 27.1875 34.0 28.0 34.0 2.0 34.0 4 30.00475 37.0 32.0 37.0 2.0 37.0 5 30.1555 37.0 32.0 37.0 2.0 37.0 6 29.49925 37.0 30.0 37.0 2.0 37.0 7 29.791 37.0 32.0 37.0 2.0 37.0 8 30.04475 37.0 32.0 37.0 2.0 37.0 9 31.75975 39.0 34.0 39.0 2.0 39.0 10-11 31.943125 39.0 34.0 39.0 2.0 39.0 12-13 31.837625000000003 39.0 33.5 39.0 2.0 39.0 14-15 32.94125 40.0 34.5 41.0 2.0 41.0 16-17 32.456625 39.5 32.5 41.0 2.0 41.0 18-19 31.964750000000002 39.0 32.5 41.0 2.0 41.0 20-21 31.345125 38.5 30.5 40.5 2.0 41.0 22-23 31.886125 39.5 32.0 41.0 2.0 41.0 24-25 31.678875 39.5 31.5 41.0 2.0 41.0 26-27 30.841375 38.5 30.0 40.5 2.0 41.0 28-29 31.0345 39.0 30.0 40.5 2.0 41.0 30-31 31.121875 38.5 31.0 40.5 2.0 41.0 32-33 30.383125 38.0 28.5 40.0 2.0 41.0 34-35 30.01025 38.0 26.5 40.0 2.0 41.0 36-37 30.221874999999997 38.0 27.5 40.0 2.0 41.0 38-39 30.7705 39.0 30.0 41.0 2.0 41.0 40-41 30.549125 38.5 29.5 40.5 2.0 41.0 42-43 29.981375 38.0 26.0 40.0 2.0 41.0 44-45 28.4665 36.0 21.5 40.0 2.0 41.0 46-47 29.734875000000002 37.5 26.5 40.0 2.0 41.0 48-49 30.266375 38.5 29.5 40.0 2.0 41.0 50-51 29.730625 37.5 26.0 40.0 2.0 41.0 52-53 29.466250000000002 37.5 25.0 40.0 2.0 41.0 54-55 28.806 36.5 22.5 39.5 2.0 41.0 56-57 28.085625 35.0 21.5 39.0 2.0 41.0 58-59 27.897 35.0 21.5 39.0 2.0 41.0 60-61 28.311124999999997 35.5 24.5 39.0 2.0 41.0 62-63 27.634999999999998 35.0 22.0 38.0 2.0 40.0 64-65 28.041375000000002 35.0 24.5 38.5 2.0 40.5 66-67 27.639625 35.0 22.0 37.5 2.0 40.0 68-69 26.939875 35.0 18.0 37.0 2.0 39.5 70-71 26.256 34.0 12.5 35.5 2.0 39.0 72-73 25.47625 33.0 5.0 35.0 2.0 38.5 74-75 24.584875 32.5 2.0 35.0 2.0 37.0 76-77 22.80825 29.5 2.0 34.0 2.0 35.5 78-79 22.510875 30.0 2.0 34.0 2.0 35.5 80-81 22.44525 30.5 2.0 34.5 2.0 35.5 82-83 23.0415 31.5 2.0 35.0 2.0 35.5 84-85 23.182499999999997 32.5 2.0 35.0 2.0 35.5 86-87 22.374499999999998 30.5 2.0 34.5 2.0 35.0 88-89 22.70175 31.5 2.0 35.0 2.0 35.0 90-91 23.25725 33.0 2.0 35.0 2.0 35.0 92-93 23.173000000000002 33.0 2.0 35.0 2.0 35.0 94-95 23.074 33.0 2.0 35.0 2.0 35.0 96-97 22.902 33.0 2.0 35.0 2.0 35.0 98-99 22.855249999999998 33.0 2.0 35.0 2.0 35.0 100 20.999 29.0 2.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 591.0 3 15.0 4 24.0 5 30.0 6 35.0 7 20.0 8 15.0 9 16.0 10 23.0 11 19.0 12 24.0 13 13.0 14 16.0 15 22.0 16 17.0 17 17.0 18 17.0 19 25.0 20 22.0 21 17.0 22 12.0 23 25.0 24 22.0 25 31.0 26 34.0 27 57.0 28 94.0 29 106.0 30 40.0 31 61.0 32 81.0 33 139.0 34 262.0 35 444.0 36 743.0 37 644.0 38 226.0 39 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.675 44.15 13.825000000000001 11.35 2 22.7 33.275 30.475 13.55 3 22.73752820255703 28.67886688393081 35.92379042366508 12.65981448984708 4 22.6 26.75 30.125 20.525 5 28.31038798498123 27.55944931163955 24.330413016270338 19.799749687108886 6 28.293299620733247 26.346396965865992 24.07079646017699 21.289506953223768 7 27.424664472018236 27.931121802988095 25.550772347429728 19.09344137756394 8 20.575 31.374999999999996 26.325 21.725 9 27.450000000000003 24.775 27.224999999999998 20.549999999999997 10-11 25.662499999999998 27.6375 27.650000000000002 19.05 12-13 23.575 26.987499999999997 27.037499999999998 22.400000000000002 14-15 23.5125 26.125 27.474999999999998 22.8875 16-17 25.415676959619955 25.14064258032254 26.303287910988875 23.140392549068633 18-19 24.40305038129766 24.090511313914238 29.603700462557818 21.90273784223028 20-21 27.0625 24.7375 28.499999999999996 19.7 22-23 25.05 30.6875 24.95 19.3125 24-25 23.8625 25.724999999999998 27.075 23.3375 26-27 24.4 24.8625 26.224999999999998 24.5125 28-29 26.4125 27.237499999999997 25.387500000000003 20.962500000000002 30-31 25.2875 25.162499999999998 28.000000000000004 21.55 32-33 24.8125 28.012500000000003 23.925 23.25 34-35 23.625 25.124999999999996 25.412499999999998 25.837500000000002 36-37 27.3875 24.45 26.575 21.587500000000002 38-39 24.0 24.575 25.55 25.874999999999996 40-41 27.394348587146787 24.81870467616904 23.53088272068017 24.256064016004 42-43 23.952994124265533 28.291036379547442 27.740967620952617 20.015001875234404 44-45 25.95 23.875 27.3875 22.787499999999998 46-47 25.775 24.9125 25.837500000000002 23.474999999999998 48-49 26.0125 26.0375 28.462500000000002 19.4875 50-51 26.900000000000002 26.2875 27.775 19.037499999999998 52-53 24.9375 25.662499999999998 24.224999999999998 25.174999999999997 54-55 27.224999999999998 25.7125 26.6625 20.4 56-57 25.4 24.575 27.700000000000003 22.325 58-59 25.025 24.6 28.3875 21.987499999999997 60-61 26.025 25.45 27.025 21.5 62-63 25.087500000000002 25.85 26.3125 22.75 64-65 26.224999999999998 26.200000000000003 27.950000000000003 19.625 66-67 24.725 31.412499999999998 23.599999999999998 20.2625 68-69 24.45 32.425 23.4375 19.6875 70-71 25.174999999999997 32.7125 23.1625 18.95 72-73 23.80297537192149 34.26678334791849 22.477809726215778 19.452431553944244 74-75 23.5375 34.9875 22.525000000000002 18.95 76-77 21.625 36.4375 23.4125 18.525 78-79 22.3 35.3125 22.400000000000002 19.9875 80-81 25.162499999999998 31.7375 22.875 20.225 82-83 25.7625 30.95 23.525 19.7625 84-85 26.3 28.875 23.6875 21.1375 86-87 24.1375 31.474999999999998 24.125 20.2625 88-89 24.325 29.549999999999997 24.5 21.625 90-91 25.374999999999996 28.962500000000002 24.5625 21.099999999999998 92-93 25.2625 29.45 24.025 21.2625 94-95 26.4125 28.4 23.6375 21.55 96-97 26.31578947368421 27.703462932866607 24.05300662582823 21.927740967620952 98-99 27.437499999999996 27.1 23.1 22.3625 100 27.800000000000004 26.875 23.35 21.975 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 1.5 5 3.0 6 2.0 7 0.5 8 1.0 9 0.5 10 1.0 11 2.0 12 2.5 13 3.0 14 2.0 15 3.0 16 3.0 17 1.5 18 2.0 19 3.5 20 4.0 21 4.0 22 5.5 23 6.5 24 7.5 25 10.0 26 10.5 27 12.0 28 19.5 29 23.5 30 27.0 31 36.0 32 40.5 33 37.5 34 42.5 35 54.5 36 73.0 37 96.5 38 91.0 39 106.5 40 148.5 41 151.0 42 168.5 43 199.5 44 194.0 45 195.0 46 191.0 47 173.0 48 165.5 49 153.5 50 145.0 51 143.5 52 128.5 53 129.5 54 142.0 55 140.5 56 118.5 57 100.5 58 102.0 59 81.0 60 54.5 61 38.0 62 31.5 63 29.0 64 20.5 65 14.5 66 16.0 67 16.0 68 13.5 69 10.0 70 7.0 71 6.0 72 6.0 73 7.5 74 4.5 75 2.5 76 3.5 77 2.5 78 1.5 79 0.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.27499999999999997 4 0.0 5 0.125 6 1.125 7 1.275 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0125 18-19 0.0125 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.025 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0125 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.675 #Duplication Level Percentage of deduplicated Percentage of total 1 97.70704073374696 90.55 2 1.8883193957377933 3.5000000000000004 3 0.2697599136768276 0.75 4 0.02697599136768276 0.1 5 0.0 0.0 6 0.02697599136768276 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02697599136768276 0.27499999999999997 >50 0.02697599136768276 1.5 >100 0.02697599136768276 3.175 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTAT 127 3.175 TruSeq Adapter, Index 16 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTA 60 1.5 TruSeq Adapter, Index 16 (97% over 40bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 11 0.27499999999999997 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATATCGTAT 6 0.15 TruSeq Adapter, Index 16 (97% over 40bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 1.95 0.0 0.0 0.0 0.0 2 1.975 0.0 0.0 0.0 0.0 3 2.0 0.0 0.0 0.0 0.0 4 2.05 0.0 0.0 0.0 0.0 5 2.075 0.0 0.0 0.0 0.0 6 2.075 0.0 0.0 0.0 0.0 7 2.075 0.0 0.0 0.0 0.0 8 2.075 0.0 0.0 0.0 0.0 9 2.1 0.0 0.0 0.0 0.0 10-11 2.15 0.0 0.0 0.0 0.0 12-13 2.1875 0.0 0.0 0.0 0.0 14-15 2.275 0.0 0.0 0.0 0.0 16-17 2.275 0.0 0.0 0.0 0.0 18-19 2.275 0.0 0.0 0.0 0.0 20-21 2.275 0.0 0.0 0.0 0.0 22-23 2.325 0.0 0.0 0.0 0.0 24-25 2.3625 0.0 0.0 0.0 0.0 26-27 2.4 0.0 0.0 0.0 0.0 28-29 2.4375 0.0 0.0 0.0 0.0 30-31 2.5 0.0 0.0 0.0 0.0 32-33 2.5125 0.0 0.0 0.0 0.0 34-35 2.55 0.0 0.0 0.0 0.0 36-37 2.575 0.0 0.0 0.0 0.0 38-39 2.6125 0.0 0.0 0.0 0.0 40-41 2.7125 0.0 0.0 0.0 0.0 42-43 2.9000000000000004 0.0 0.0 0.0 0.0 44-45 3.05 0.0 0.0 0.0 0.0 46-47 3.2375 0.0 0.0 0.0 0.0 48-49 3.4 0.0 0.0 0.0 0.0 50-51 3.5375 0.0 0.0 0.0 0.0 52-53 3.7750000000000004 0.0 0.0 0.0 0.0 54-55 4.0 0.0 0.0 0.0 0.0 56-57 4.2 0.0 0.0 0.0 0.0 58-59 4.4375 0.0 0.0 0.0 0.0 60-61 4.8375 0.0 0.0 0.0 0.0 62-63 4.975 0.0 0.0 0.0 0.0 64-65 5.3875 0.0 0.0 0.0 0.0 66-67 5.875 0.0 0.0 0.0 0.0 68-69 6.362500000000001 0.0 0.0 0.0 0.0 70-71 7.1 0.0 0.0 0.0 0.0 72-73 7.800000000000001 0.0 0.0 0.0 0.0 74-75 8.425 0.0 0.0 0.0 0.0 76-77 9.0 0.0 0.0 0.0 0.0 78-79 9.5 0.0 0.0 0.0 0.0 80-81 10.55 0.0 0.0 0.0 0.0 82-83 11.525 0.0 0.0 0.0 0.0 84-85 12.225 0.0 0.0 0.0 0.0 86-87 13.0375 0.0 0.0 0.0 0.0 88 13.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 325 3.3885502E-5 8.660769 68-69 >>END_MODULE SRR3166985 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3166985_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.93825 33.0 31.0 34.0 25.0 34.0 2 30.14275 33.0 31.0 34.0 26.0 34.0 3 30.15925 34.0 31.0 34.0 25.0 34.0 4 33.34225 37.0 35.0 37.0 28.0 37.0 5 33.28375 37.0 35.0 37.0 27.0 37.0 6 33.31825 37.0 35.0 37.0 28.0 37.0 7 33.2595 37.0 35.0 37.0 27.0 37.0 8 33.32375 37.0 35.0 37.0 28.0 37.0 9 34.84075 39.0 37.0 39.0 27.0 39.0 10-11 34.898250000000004 39.0 37.0 39.0 27.0 39.0 12-13 34.69175 39.0 37.0 39.0 26.0 39.0 14-15 35.82725 40.0 38.0 41.0 25.5 41.0 16-17 35.795500000000004 40.0 38.0 41.0 24.0 41.0 18-19 35.534125 40.0 36.5 41.0 24.0 41.0 20-21 35.5775 40.0 38.0 41.0 20.0 41.0 22-23 35.606 40.0 38.0 41.0 18.5 41.0 24-25 35.584875 40.0 38.0 41.0 18.5 41.0 26-27 35.445125000000004 40.0 38.0 41.0 14.0 41.0 28-29 35.177625 40.0 37.0 41.0 9.5 41.0 30-31 34.852625 40.0 36.5 41.0 8.5 41.0 32-33 34.846125 40.0 36.5 41.0 8.5 41.0 34-35 34.724125 40.0 36.5 41.0 4.5 41.0 36-37 34.484 40.0 36.0 41.0 2.0 41.0 38-39 34.086375000000004 39.5 35.0 41.0 2.0 41.0 40-41 34.012625 40.0 35.0 41.0 2.0 41.0 42-43 33.3475 39.0 34.0 40.5 2.0 41.0 44-45 33.212625 39.0 33.0 40.0 2.0 41.0 46-47 33.115375 38.5 33.0 40.0 2.0 41.0 48-49 33.362875 39.0 34.0 40.0 2.0 41.0 50-51 32.488625 38.0 33.0 39.5 2.0 40.5 52-53 32.72175 38.0 33.5 39.5 2.0 40.5 54-55 32.969625 38.0 34.0 40.0 2.0 41.0 56-57 33.01875 38.0 34.0 40.5 2.0 41.0 58-59 32.87125 37.5 34.0 40.0 2.0 41.0 60-61 32.439875 37.0 34.0 40.0 2.0 41.0 62-63 32.11125 36.0 33.0 40.0 2.0 41.0 64-65 31.7085 35.5 33.0 39.0 2.0 41.0 66-67 30.532125 35.0 31.0 38.5 2.0 40.5 68-69 28.762125 34.0 27.0 36.5 2.0 39.0 70-71 28.298625 34.0 26.5 36.0 2.0 39.0 72-73 28.311 34.0 27.0 36.0 2.0 39.0 74-75 28.65175 34.5 29.0 36.0 2.0 39.0 76-77 29.0405 35.0 31.0 36.0 2.0 39.0 78-79 28.912750000000003 35.0 31.0 36.0 2.0 37.5 80-81 28.471375000000002 35.0 30.0 35.0 2.0 37.0 82-83 28.373625 35.0 30.0 35.0 2.0 36.5 84-85 28.1485 35.0 30.0 35.0 2.0 36.0 86-87 28.091124999999998 35.0 30.0 35.0 2.0 36.0 88-89 27.746125 35.0 29.0 35.0 2.0 36.0 90-91 27.723625 35.0 29.5 35.0 2.0 35.0 92-93 27.423875 35.0 29.0 35.0 2.0 35.0 94-95 27.026875 34.0 26.5 35.0 2.0 35.0 96-97 26.93175 34.0 27.0 35.0 2.0 35.0 98-99 26.79675 34.0 27.0 35.0 2.0 35.0 100 24.86625 32.0 19.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 258.0 3 31.0 4 12.0 5 12.0 6 26.0 7 28.0 8 12.0 9 15.0 10 12.0 11 13.0 12 14.0 13 12.0 14 12.0 15 9.0 16 15.0 17 15.0 18 23.0 19 15.0 20 27.0 21 29.0 22 15.0 23 27.0 24 43.0 25 43.0 26 66.0 27 38.0 28 28.0 29 39.0 30 47.0 31 58.0 32 72.0 33 103.0 34 138.0 35 214.0 36 506.0 37 1081.0 38 806.0 39 86.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.115509897268854 45.9784515159108 13.806063643197195 11.099974943623153 2 22.280701754385966 35.16290726817042 28.721804511278194 13.834586466165414 3 21.453634085213032 30.776942355889723 34.335839598997495 13.43358395989975 4 21.297920320721627 25.407166123778502 31.746429466299176 21.548484089200702 5 26.245930378161788 28.274480340596043 25.31930879038317 20.160280490859 6 25.95 26.674999999999997 25.55 21.825 7 25.2 27.05 28.375 19.375 8 19.5 31.825 27.775 20.9 9 24.425 27.175 27.575 20.825 10-11 24.425 29.1375 27.6 18.8375 12-13 24.075 25.362499999999997 28.537499999999998 22.025 14-15 22.55 25.112499999999997 29.562500000000004 22.775000000000002 16-17 24.637500000000003 25.412499999999998 28.712500000000002 21.2375 18-19 24.7 25.0125 30.3 19.9875 20-21 23.025000000000002 27.725 29.299999999999997 19.950000000000003 22-23 28.5625 24.762500000000003 26.3625 20.3125 24-25 23.3 29.9875 26.875 19.8375 26-27 22.05 29.9375 27.9125 20.1 28-29 23.375 28.287499999999998 27.6625 20.674999999999997 30-31 25.825 25.2625 28.6875 20.225 32-33 22.45 26.9625 30.325000000000003 20.2625 34-35 24.1375 27.725 27.625 20.5125 36-37 21.512500000000003 26.974999999999998 30.837500000000002 20.674999999999997 38-39 21.15 24.8 29.425 24.625 40-41 26.0625 25.15 27.650000000000002 21.1375 42-43 25.8 24.4875 29.562500000000004 20.150000000000002 44-45 27.400000000000002 24.325 27.825 20.45 46-47 22.8375 24.9375 28.487499999999997 23.7375 48-49 23.45 24.349999999999998 26.8125 25.387500000000003 50-51 24.6125 24.2875 28.275 22.825 52-53 21.45 27.700000000000003 30.9 19.950000000000003 54-55 21.025 27.025 28.599999999999998 23.35 56-57 21.725 26.275 31.662499999999998 20.3375 58-59 21.6 29.9 28.7375 19.7625 60-61 21.725 31.662499999999998 26.5375 20.075000000000003 62-63 21.725 32.025 26.25 20.0 64-65 21.7375 32.775 25.7 19.787499999999998 66-67 20.75 33.925 25.8 19.525000000000002 68-69 21.625 32.887499999999996 26.0625 19.425 70-71 21.6125 32.2125 25.974999999999998 20.200000000000003 72-73 21.8875 32.1125 25.624999999999996 20.375 74-75 23.125 30.4625 26.3125 20.1 76-77 23.525 30.8125 25.412499999999998 20.25 78-79 24.0 29.325000000000003 26.937499999999996 19.7375 80-81 23.7625 29.2875 25.95 21.0 82-83 25.0 27.8125 27.212500000000002 19.975 84-85 24.575 28.825 26.650000000000002 19.950000000000003 86-87 24.887500000000003 27.5875 27.0875 20.4375 88-89 25.525 28.625 26.075 19.775000000000002 90-91 25.0 28.225 26.437500000000004 20.3375 92-93 26.2625 28.237499999999997 26.3 19.2 94-95 25.912499999999998 27.650000000000002 26.75 19.6875 96-97 25.2125 28.299999999999997 25.75 20.7375 98-99 25.85 29.3875 26.0375 18.725 100 27.500000000000004 28.675 25.974999999999998 17.849999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 4.0 2 2.0 3 0.5 4 0.5 5 1.5 6 2.5 7 3.0 8 3.0 9 3.0 10 2.5 11 3.5 12 4.0 13 3.5 14 2.0 15 3.0 16 5.5 17 4.0 18 3.5 19 5.0 20 5.0 21 7.5 22 8.0 23 7.0 24 11.0 25 13.0 26 16.0 27 24.0 28 29.5 29 32.5 30 35.0 31 40.0 32 52.5 33 60.5 34 70.5 35 78.0 36 97.5 37 128.0 38 138.5 39 145.5 40 175.0 41 188.0 42 176.5 43 184.5 44 195.5 45 189.5 46 172.0 47 164.0 48 149.5 49 135.0 50 127.5 51 113.5 52 111.0 53 128.5 54 131.0 55 122.0 56 114.0 57 94.5 58 74.5 59 52.0 60 33.5 61 23.5 62 18.0 63 11.5 64 6.0 65 5.0 66 7.0 67 7.5 68 6.0 69 4.5 70 6.5 71 6.0 72 1.5 73 0.5 74 0.5 75 1.0 76 1.0 77 1.0 78 1.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.25 3 0.25 4 0.22499999999999998 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.425 #Duplication Level Percentage of deduplicated Percentage of total 1 96.78886807599679 90.425 2 2.6491838373026493 4.95 3 0.29435375970029437 0.8250000000000001 4 0.1337971635001338 0.5 5 0.02675943270002676 0.125 6 0.0 0.0 7 0.02675943270002676 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.05351886540005352 1.3 >50 0.02675943270002676 1.7000000000000002 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCC 68 1.7000000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 41 1.0250000000000001 Illumina Single End PCR Primer 1 (100% over 50bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 11 0.27499999999999997 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGGGTAGATCTCGGTGGTCGCCG 7 0.17500000000000002 Illumina Single End PCR Primer 1 (98% over 50bp) GATCGGAAGAGCGTCGTGTAGGGAAAGAGGGTAGATCTCGGGGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (97% over 41bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 1.85 0.0 0.0 0.0 0.0 2 1.875 0.0 0.0 0.0 0.0 3 1.9 0.0 0.0 0.0 0.0 4 1.95 0.0 0.0 0.0 0.0 5 1.975 0.0 0.0 0.0 0.0 6 1.975 0.0 0.0 0.0 0.0 7 1.975 0.0 0.0 0.0 0.0 8 1.975 0.0 0.0 0.0 0.0 9 2.0 0.0 0.0 0.0 0.0 10-11 2.05 0.0 0.0 0.0 0.0 12-13 2.0875000000000004 0.0 0.0 0.0 0.0 14-15 2.175 0.0 0.0 0.0 0.0 16-17 2.175 0.0 0.0 0.0 0.0 18-19 2.175 0.0 0.0 0.0 0.0 20-21 2.175 0.0 0.0 0.0 0.0 22-23 2.225 0.0 0.0 0.0 0.0 24-25 2.275 0.0 0.0 0.0 0.0 26-27 2.3375000000000004 0.0 0.0 0.0 0.0 28-29 2.3875 0.0 0.0 0.0 0.0 30-31 2.45 0.0 0.0 0.0 0.0 32-33 2.4875 0.0 0.0 0.0 0.0 34-35 2.525 0.0 0.0 0.0 0.0 36-37 2.5875000000000004 0.0 0.0 0.0 0.0 38-39 2.675 0.0 0.0 0.0 0.0 40-41 2.7875 0.0 0.0 0.0 0.0 42-43 2.9749999999999996 0.0 0.0 0.0 0.0 44-45 3.1625 0.0 0.0 0.0 0.0 46-47 3.375 0.0 0.0 0.0 0.0 48-49 3.55 0.0 0.0 0.0 0.0 50-51 3.6875 0.0 0.0 0.0 0.0 52-53 3.925 0.0 0.0 0.0 0.0 54-55 4.15 0.0 0.0 0.0 0.0 56-57 4.35 0.0 0.0 0.0 0.0 58-59 4.6 0.0 0.0 0.0 0.0 60-61 5.025 0.0 0.0 0.0 0.0 62-63 5.175 0.0 0.0 0.0 0.0 64-65 5.5875 0.0 0.0 0.0 0.0 66-67 6.125 0.0 0.0 0.0 0.0 68-69 6.6625 0.0 0.0 0.0 0.0 70-71 7.4625 0.0 0.0 0.0 0.0 72-73 8.2375 0.0 0.0 0.0 0.0 74-75 8.9 0.0 0.0 0.0 0.0 76-77 9.537500000000001 0.0 0.0 0.0 0.0 78-79 10.1625 0.0 0.0 0.0 0.0 80-81 11.275 0.0 0.0 0.0 0.0 82-83 12.287500000000001 0.0 0.0 0.0 0.0 84-85 13.1 0.0 0.0 0.0 0.0 86-87 13.9875 0.0 0.0 0.0 0.0 88 14.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAAAAA 25 0.0016030063 37.600002 56-57 TAAAAAA 35 0.008330873 26.857141 58-59 >>END_MODULE Read 1933817 spots for SRR3166985.sra Written 1933817 spots for SRR3166985.sra Read 1933817 spots for SRR3166985.sra Written 1933817 spots for SRR3166985.sra Read 1933817 spots for SRR3166985.sra Written 1933817 spots for SRR3166985.sra Read 1933817 spots for SRR3166985.sra Written 1933817 spots for SRR3166985.sra Read 1933817 spots for SRR3166985.sra Written 1933817 spots for SRR3166985.sra Read 1933817 spots for SRR3166985.sra Written 1933817 spots for SRR3166985.sra Read 1933817 spots for SRR3166985.sra Written 1933817 spots for SRR3166985.sra Read 1933817 spots for SRR3166985.sra Written 1933817 spots for SRR3166985.sra Read 1933817 spots for SRR3166985.sra Written 1933817 spots for SRR3166985.sra Read 1933817 spots for SRR3166985.sra Written 1933817 spots for SRR3166985.sra Read 1933817 spots for SRR3166985.sra Written 1933817 spots for SRR3166985.sra Read 1933817 spots for SRR3166985.sra Written 1933817 spots for SRR3166985.sra Read 1933817 spots for SRR3166985.sra Written 1933817 spots for SRR3166985.sra Read 1933817 spots for SRR3166985.sra Written 1933817 spots for SRR3166985.sra Read 1933817 spots for SRR3166985.sra Written 1933817 spots for SRR3166985.sra Read 1933817 spots for SRR3166985.sra Written 1933817 spots for SRR3166985.sra Read 1933817 spots for SRR3166985.sra Written 1933817 spots for SRR3166985.sra Read 1933828 spots for SRR3166985.sra Written 1933828 spots for SRR3166985.sra Read 1933817 spots for SRR3166985.sra Written 1933817 spots for SRR3166985.sra Read 1933817 spots for SRR3166985.sra Written 1933817 spots for SRR3166985.sra SRR ids: ['SRR3166985.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hwrrpusw SRR3166985.sra spots: 38676351 blocks: [[1, 1933817], [1933818, 3867634], [3867635, 5801451], [5801452, 7735268], [7735269, 9669085], [9669086, 11602902], [11602903, 13536719], [13536720, 15470536], [15470537, 17404353], [17404354, 19338170], [19338171, 21271987], [21271988, 23205804], [23205805, 25139621], [25139622, 27073438], [27073439, 29007255], [29007256, 30941072], [30941073, 32874889], [32874890, 34808706], [34808707, 36742523], [36742524, 38676351]] SRR3166985 file size 9231918 SRR3166985 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3166985 SRR3166985_1.fastq SRR3166985_2.fastq Input file: SRR3166985_1.fastq Paired file: SRR3166985_2.fastq trimmed: SRR3166985-trimmed-pair1.fastq, SRR3166985-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 01:17:11 2024 >> started Sat Dec 7 01:17:47 2024 >> done (35.969s) 38676351 read pairs processed; of these: 899859 ( 2.33%) short read pairs filtered out after trimming by size control 8400156 (21.72%) empty read pairs filtered out after trimming by size control 29376336 (75.95%) read pairs available; of these: 12066874 (41.08%) trimmed read pairs available after processing 17309462 (58.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10710 0.04% 19 12151 0.04% 20 11258 0.04% 21 14792 0.05% 22 14288 0.05% 23 16068 0.05% 24 16747 0.06% 25 19722 0.07% 26 19124 0.07% 27 20083 0.07% 28 19700 0.07% 29 22070 0.08% 30 21595 0.07% 31 22706 0.08% 32 23081 0.08% 33 24018 0.08% 34 24779 0.08% 35 25655 0.09% 36 29422 0.10% 37 28668 0.10% 38 31322 0.11% 39 32479 0.11% 40 34569 0.12% 41 35890 0.12% 42 39772 0.14% 43 41970 0.14% 44 44067 0.15% 45 48855 0.17% 46 50222 0.17% 47 52325 0.18% 48 55667 0.19% 49 57411 0.20% 50 60844 0.21% 51 64984 0.22% 52 69141 0.24% 53 72551 0.25% 54 76845 0.26% 55 81091 0.28% 56 85770 0.29% 57 92354 0.31% 58 96885 0.33% 59 154286 0.53% 60 155802 0.53% 61 163097 0.56% 62 166530 0.57% 63 165367 0.56% 64 171638 0.58% 65 182387 0.62% 66 175174 0.60% 67 178153 0.61% 68 184831 0.63% 69 191472 0.65% 70 194370 0.66% 71 199264 0.68% 72 198868 0.68% 73 204206 0.70% 74 212017 0.72% 75 217192 0.74% 76 217864 0.74% 77 222450 0.76% 78 223797 0.76% 79 218231 0.74% 80 218517 0.74% 81 221498 0.75% 82 229716 0.78% 83 236148 0.80% 84 233925 0.80% 85 233554 0.80% 86 238420 0.81% 87 241775 0.82% 88 237030 0.81% 89 248532 0.85% 90 259071 0.88% 91 269980 0.92% 92 274354 0.93% 93 292214 0.99% 94 309411 1.05% 95 341366 1.16% 96 387684 1.32% 97 462373 1.57% 98 576934 1.96% 99 935725 3.19% 100 17309462 58.92% 29376336 reads passed initial QC criterion=sequence-density sequence-density=1.33 sequence-density-rank=1 fanout-score=1.00 fanout-score-rank=40 prefix-density=0.45 prefix-fanout=1.0 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.38 sequence-density-rank=8 fanout-score=73.41 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=33.1 sequence=TCAAACACAAAGTTACCTAAACTATAGAAGA criterion=sequence-density sequence-density=2.07 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=42 prefix-density=2.72 prefix-fanout=1.6 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.19 sequence-density-rank=34 fanout-score=44.89 fanout-score-rank=1 prefix-density=5.50 prefix-fanout=1.6 sequence=TGTGTTTGAGCT Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TTTGTGTTTGAG -y TTTGTGTTTGAG -o SRR3166985 SRR3166985_1.fastq SRR3166985_2.fastq Input file: SRR3166985_1.fastq Paired file: SRR3166985_2.fastq trimmed: SRR3166985-trimmed-pair1.fastq, SRR3166985-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TTTGTGTTTGAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 01:19:22 2024 >> started Sat Dec 7 01:19:30 2024 >> done (7.868s) 9792112 read pairs processed; of these: 14089 ( 0.14%) short read pairs filtered out after trimming by size control 4023 ( 0.04%) empty read pairs filtered out after trimming by size control 9774000 (99.82%) read pairs available; of these: 14618 ( 0.15%) trimmed read pairs available after processing 9759382 (99.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3555 0.04% 19 4137 0.04% 20 3880 0.04% 21 5029 0.05% 22 4761 0.05% 23 5454 0.06% 24 5655 0.06% 25 6530 0.07% 26 6384 0.07% 27 6730 0.07% 28 6510 0.07% 29 7355 0.08% 30 7194 0.07% 31 7561 0.08% 32 7767 0.08% 33 8080 0.08% 34 8189 0.08% 35 8536 0.09% 36 9899 0.10% 37 9595 0.10% 38 10538 0.11% 39 10760 0.11% 40 11518 0.12% 41 12052 0.12% 42 13461 0.14% 43 13995 0.14% 44 14693 0.15% 45 16285 0.17% 46 16762 0.17% 47 17455 0.18% 48 18388 0.19% 49 18998 0.19% 50 20182 0.21% 51 21640 0.22% 52 23056 0.24% 53 24163 0.25% 54 25690 0.26% 55 27328 0.28% 56 28720 0.29% 57 30824 0.32% 58 32060 0.33% 59 51559 0.53% 60 51778 0.53% 61 54318 0.56% 62 55169 0.56% 63 55250 0.57% 64 57042 0.58% 65 60529 0.62% 66 58401 0.60% 67 58976 0.60% 68 61283 0.63% 69 63845 0.65% 70 64850 0.66% 71 66389 0.68% 72 66441 0.68% 73 68036 0.70% 74 70705 0.72% 75 72443 0.74% 76 72881 0.75% 77 74092 0.76% 78 74291 0.76% 79 72608 0.74% 80 72644 0.74% 81 73687 0.75% 82 76454 0.78% 83 78317 0.80% 84 77780 0.80% 85 77855 0.80% 86 79465 0.81% 87 80481 0.82% 88 79010 0.81% 89 82482 0.84% 90 86025 0.88% 91 89728 0.92% 92 91059 0.93% 93 97207 0.99% 94 102583 1.05% 95 114097 1.17% 96 130029 1.33% 97 153726 1.57% 98 192561 1.97% 99 309275 3.16% 100 5757280 58.90% criterion=sequence-density sequence-density=1.19 sequence-density-rank=1 fanout-score=1.00 fanout-score-rank=41 prefix-density=0.42 prefix-fanout=1.0 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.37 sequence-density-rank=8 fanout-score=73.76 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=33.1 sequence=TCAAACACAAAGTTACCTAAACTATAGAAGA criterion=sequence-density sequence-density=1.87 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=40 prefix-density=2.61 prefix-fanout=1.6 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.18 sequence-density-rank=33 fanout-score=46.47 fanout-score-rank=1 prefix-density=5.18 prefix-fanout=1.6 sequence=TGTGTTTGAGAG SRR3166985 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 01:20:20 Started mapping on | Dec 07 01:20:20 Finished on | Dec 07 01:23:13 Mapping speed, Million of reads per hour | 610.92 Number of input reads | 29358224 Average input read length | 182 UNIQUE READS: Uniquely mapped reads number | 12873400 Uniquely mapped reads % | 43.85% Average mapped length | 180.28 Number of splices: Total | 4702583 Number of splices: Annotated (sjdb) | 4218450 Number of splices: GT/AG | 4467392 Number of splices: GC/AG | 70316 Number of splices: AT/AC | 7481 Number of splices: Non-canonical | 157394 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.01% Deletion average length | 1.55 Insertion rate per base | 0.01% Insertion average length | 1.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 11944407 % of reads mapped to multiple loci | 40.69% Number of reads mapped to too many loci | 275687 % of reads mapped to too many loci | 0.94% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.70% % of reads unmapped: other | 3.83% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4753155 4753155 4753155 N_multimapping 11944407 11944407 11944407 N_noFeature 2967522 7821752 7731568 N_ambiguous 455892 98874 78260 UnstrandedReadsAssigned:9449986 PositiveStrandReadsAssigned:4952774 NegativeStrandReadsAssigned:5063572 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=82 echo kmer=77 SRR3166985 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3166985-trimmed-pair1.fastq SRR3166985-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,358,224 reads, 19,372,575 reads pseudoaligned [quant] estimated average fragment length: 130.84 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,249 rounds 52973 SRR3166985.ke.tsv 35125 SRR3166985.se.tsv 88098 total ==> SRR3166985.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 806.412 0 0 PNS24247 1044 914.16 8.29758 0.560249 PNS24249 1928 1798.16 3.72711 0.127937 PNS24246 1044 914.16 8.29758 0.560249 PNS24248 1044 914.16 8.29758 0.560249 PNS24244 1471 1341.16 105.38 4.84987 PNS24243 293 168.068 7 2.57078 KQK14069 1603 1473.16 167.542 7.01983 KQK14071 474 345.329 3.50621 0.626697 ==> SRR3166985.se.tsv <== BRADI_1g14170v3 161 BRADI_1g53295v3 23 BRADI_1g59795v3 184 BRADI_1g07683v3 0 BRADI_1g00485v3 25 BRADI_1g20270v3 1152 BRADI_1g74790v3 41 BRADI_1g09890v3 2 BRADI_1g77505v3 114 BRADI_1g48960v3 0 SRR3166985 completed mapping pipeline successfully