Starting /dee2/code/volunteer_pipeline.sh SRR3286348 current disk space = 1523927969792 free memory = 1569054256 SRR3286348 SRAfilesize 1640ba4bf44d98a7507904be6b39e1ea SRR3286348.sra SRR3286348.sra file validated SRR3286348 is single end SRR3286348 is conventional basespace SRR3286348 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3286348_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.35575 33.0 33.0 33.0 33.0 33.0 2 32.49 33.0 33.0 33.0 33.0 33.0 3 32.6975 33.0 33.0 33.0 33.0 33.0 4 36.7725 37.0 37.0 37.0 37.0 37.0 5 36.72125 37.0 37.0 37.0 37.0 37.0 6 36.70325 37.0 37.0 37.0 37.0 37.0 7 36.7045 37.0 37.0 37.0 37.0 37.0 8 36.6955 37.0 37.0 37.0 37.0 37.0 9 36.70425 37.0 37.0 37.0 37.0 37.0 10-11 36.715374999999995 37.0 37.0 37.0 37.0 37.0 12-13 36.641375 37.0 37.0 37.0 37.0 37.0 14-15 39.005624999999995 40.0 40.0 40.0 37.0 40.0 16-17 39.011875 40.0 40.0 40.0 37.0 40.0 18-19 38.901625 40.0 40.0 40.0 37.0 40.0 20-21 38.78375 40.0 38.5 40.0 37.0 40.0 22-23 38.75725 40.0 37.0 40.0 37.0 40.0 24-25 38.766125 40.0 38.5 40.0 37.0 40.0 26-27 38.686375 40.0 37.0 40.0 37.0 40.0 28-29 38.574125 40.0 37.0 40.0 37.0 40.0 30-31 38.38825 40.0 37.0 40.0 37.0 40.0 32-33 38.333625 40.0 37.0 40.0 37.0 40.0 34-35 38.137625 40.0 37.0 40.0 37.0 40.0 36-37 38.02775 40.0 37.0 40.0 35.0 40.0 38-39 37.794 40.0 37.0 40.0 33.0 40.0 40-41 37.701625 40.0 37.0 40.0 33.0 40.0 42-43 37.681 40.0 37.0 40.0 33.0 40.0 44-45 37.503625 40.0 37.0 40.0 33.0 40.0 46-47 37.541875000000005 40.0 37.0 40.0 33.0 40.0 48-49 37.55475 40.0 37.0 40.0 33.0 40.0 50-51 37.3875 40.0 37.0 40.0 33.0 40.0 52-53 37.19375 37.0 37.0 40.0 33.0 40.0 54-55 36.887625 37.0 37.0 40.0 33.0 40.0 56-57 36.726124999999996 37.0 37.0 40.0 33.0 40.0 58-59 36.62225 37.0 37.0 40.0 33.0 40.0 60-61 36.424625000000006 37.0 37.0 40.0 33.0 40.0 62-63 36.162875 37.0 37.0 40.0 33.0 40.0 64-65 35.923375 37.0 37.0 37.0 33.0 40.0 66-67 35.572874999999996 37.0 37.0 37.0 33.0 40.0 68-69 35.459500000000006 37.0 37.0 37.0 33.0 40.0 70-71 35.19525 37.0 33.0 37.0 33.0 40.0 72-73 34.795375 37.0 33.0 37.0 33.0 37.0 74-75 34.52375 37.0 33.0 37.0 30.0 37.0 76-77 33.081625 35.0 33.0 37.0 27.0 37.0 78-79 34.10725 37.0 33.0 37.0 27.0 37.0 80-81 34.315375 37.0 33.0 37.0 27.0 37.0 82-83 34.149 37.0 33.0 37.0 27.0 37.0 84-85 34.1605 37.0 33.0 37.0 27.0 37.0 86-87 33.9935 37.0 33.0 37.0 27.0 37.0 88-89 33.876125 37.0 33.0 37.0 27.0 37.0 90-91 33.713499999999996 37.0 33.0 37.0 27.0 37.0 92-93 33.539500000000004 37.0 33.0 37.0 27.0 37.0 94-95 33.428 37.0 33.0 37.0 27.0 37.0 96-97 33.384 37.0 33.0 37.0 27.0 37.0 98-99 33.10575 37.0 33.0 37.0 27.0 37.0 100-101 32.035375 35.0 33.0 37.0 24.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 2.0 9 4.0 10 5.0 11 3.0 12 4.0 13 4.0 14 1.0 15 4.0 16 2.0 17 2.0 18 2.0 19 6.0 20 4.0 21 6.0 22 10.0 23 14.0 24 9.0 25 15.0 26 28.0 27 38.0 28 35.0 29 32.0 30 53.0 31 68.0 32 100.0 33 130.0 34 145.0 35 254.0 36 536.0 37 1339.0 38 1142.0 39 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 62.05232410464821 9.906019812039624 5.7912115824231645 22.250444500889003 2 25.275 13.350000000000001 31.025000000000002 30.349999999999998 3 23.05 22.125 26.375 28.449999999999996 4 30.025000000000002 26.025 20.075000000000003 23.875 5 28.000000000000004 30.725 20.4 20.875 6 25.1 30.55 21.55 22.8 7 20.275000000000002 21.375 37.2 21.15 8 20.349999999999998 21.85 27.525 30.275000000000002 9 21.775 19.05 30.975 28.199999999999996 10-11 26.325 27.700000000000003 20.625 25.35 12-13 24.775 22.2625 24.8625 28.1 14-15 24.8125 23.8375 24.05 27.3 16-17 24.3 23.925 24.375 27.400000000000002 18-19 25.387500000000003 23.425 24.625 26.5625 20-21 25.637500000000003 24.224999999999998 24.625 25.5125 22-23 24.6875 25.224999999999998 23.6875 26.400000000000002 24-25 25.028128516064506 23.665458182272783 24.52806600825103 26.778347293411674 26-27 24.25 23.75 24.462500000000002 27.537499999999998 28-29 26.0 23.7625 23.6125 26.625 30-31 24.0625 23.8875 25.275 26.775 32-33 25.053131641455185 23.6029503687961 24.57807225903238 26.765845730716343 34-35 26.11902975743936 24.593648412103025 23.568392098024507 25.71892973243311 36-37 25.49387346836709 23.74343585896474 23.69342335583896 27.069267316829208 38-39 24.718679669917478 23.63090772693173 23.968492123030757 27.68192048012003 40-41 25.243810952738183 23.668417104276067 24.781195298824706 26.30657664416104 42-43 24.843710927731934 24.243560890222557 24.356089022255563 26.556639159789945 44-45 24.456114028507127 23.20580145036259 25.64391097774444 26.694173543385848 46-47 25.78144536134033 23.593398349587396 23.680920230057513 26.944236059014752 48-49 24.718679669917478 24.893723430857715 23.280820205051263 27.106776694173547 50-51 24.668667166791696 23.918479619904975 23.85596399099775 27.556889222305575 52-53 25.268817204301076 23.53088272068017 23.55588897224306 27.644411102775695 54-55 25.5375 23.0875 24.725 26.650000000000002 56-57 24.2375 24.712500000000002 23.799999999999997 27.250000000000004 58-59 24.462500000000002 24.25 24.712500000000002 26.575 60-61 26.6125 22.6 23.599999999999998 27.187499999999996 62-63 25.275 23.150000000000002 24.212500000000002 27.3625 64-65 25.7 23.6875 24.587500000000002 26.025 66-67 25.6 24.2875 23.575 26.5375 68-69 24.825 24.0 24.2 26.974999999999998 70-71 25.650000000000002 24.3 23.875 26.174999999999997 72-73 25.575 24.05 23.4375 26.937499999999996 74-75 24.9 24.1625 23.75 27.187499999999996 76-77 25.674999999999997 24.587500000000002 23.425 26.3125 78-79 26.0625 24.0125 22.975 26.950000000000003 80-81 24.6875 25.5625 23.0125 26.737499999999997 82-83 26.650000000000002 24.2375 23.2625 25.85 84-85 26.4125 23.075000000000003 23.2875 27.224999999999998 86-87 25.7 25.15 23.175 25.974999999999998 88-89 26.05 25.275 22.2625 26.4125 90-91 26.525 24.8125 22.15 26.5125 92-93 26.437500000000004 24.337500000000002 22.6875 26.5375 94-95 25.2 25.137500000000003 22.400000000000002 27.2625 96-97 26.200000000000003 24.337500000000002 22.35 27.1125 98-99 25.837500000000002 24.9 22.15 27.1125 100-101 25.5625 24.8 22.3375 27.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 0.0 23 1.5 24 2.0 25 1.0 26 0.5 27 0.0 28 1.5 29 3.5 30 3.5 31 9.0 32 11.5 33 10.5 34 16.5 35 24.5 36 27.5 37 39.5 38 60.0 39 59.5 40 61.5 41 88.5 42 115.5 43 122.5 44 133.5 45 145.5 46 141.5 47 147.5 48 162.0 49 164.0 50 163.0 51 157.5 52 142.5 53 141.5 54 134.0 55 125.0 56 128.0 57 129.0 58 125.5 59 129.5 60 140.0 61 134.0 62 111.5 63 98.0 64 106.5 65 100.5 66 83.0 67 66.5 68 52.5 69 43.0 70 32.0 71 29.0 72 24.5 73 18.0 74 12.5 75 5.5 76 2.0 77 1.0 78 1.0 79 0.5 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0125 34-35 0.025 36-37 0.025 38-39 0.025 40-41 0.025 42-43 0.025 44-45 0.025 46-47 0.025 48-49 0.025 50-51 0.025 52-53 0.025 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.125 #Duplication Level Percentage of deduplicated Percentage of total 1 97.96653796653797 95.15 2 1.8018018018018018 3.5000000000000004 3 0.2059202059202059 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02574002574002574 0.75 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCTTATCTCGTAT 30 0.75 TruSeq Adapter, Index 20 (97% over 44bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.037500000000000006 0.0 0.0 0.0 0.0 38-39 0.0625 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.16249999999999998 0.0 0.0 0.0 0.0 46-47 0.1875 0.0 0.0 0.0 0.0 48-49 0.2625 0.0 0.0 0.0 0.0 50-51 0.30000000000000004 0.0 0.0 0.0 0.0 52-53 0.36250000000000004 0.0 0.0 0.0 0.0 54-55 0.44999999999999996 0.0 0.0 0.0 0.0 56-57 0.5375 0.0 0.0 0.0 0.0 58-59 0.6625 0.0 0.0 0.0 0.0 60-61 0.8375 0.0 0.0 0.0 0.0 62-63 1.075 0.0 0.0 0.0 0.0 64-65 1.275 0.0 0.0 0.0 0.0 66-67 1.5875 0.0 0.0 0.0 0.0 68-69 2.0125 0.0 0.0 0.0 0.0 70-71 2.3125 0.0 0.0 0.0 0.0 72-73 2.7375 0.0 0.0 0.0 0.0 74-75 3.1624999999999996 0.0 0.0 0.0 0.0 76-77 3.8125 0.0 0.0 0.0 0.0 78-79 4.35 0.0 0.0 0.0 0.0 80-81 5.0625 0.0 0.0 0.0 0.0 82-83 5.75 0.0 0.0 0.0 0.0 84-85 6.5375 0.0 0.0 0.0 0.0 86-87 7.3 0.0 0.0 0.0 0.0 88-89 8.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATCAT 25 0.004666605 56.9925 8 >>END_MODULE Read 1297098 spots for SRR3286348.sra Written 1297098 spots for SRR3286348.sra Read 1297098 spots for SRR3286348.sra Written 1297098 spots for SRR3286348.sra Read 1297098 spots for SRR3286348.sra Written 1297098 spots for SRR3286348.sra Read 1297098 spots for SRR3286348.sra Written 1297098 spots for SRR3286348.sra Read 1297098 spots for SRR3286348.sra Written 1297098 spots for SRR3286348.sra Read 1297098 spots for SRR3286348.sra Written 1297098 spots for SRR3286348.sra Read 1297098 spots for SRR3286348.sra Written 1297098 spots for SRR3286348.sra Read 1297112 spots for SRR3286348.sra Written 1297112 spots for SRR3286348.sra Read 1297098 spots for SRR3286348.sra Written 1297098 spots for SRR3286348.sra Read 1297098 spots for SRR3286348.sra Written 1297098 spots for SRR3286348.sra Read 1297098 spots for SRR3286348.sra Written 1297098 spots for SRR3286348.sra Read 1297098 spots for SRR3286348.sra Written 1297098 spots for SRR3286348.sra Read 1297098 spots for SRR3286348.sra Written 1297098 spots for SRR3286348.sra Read 1297098 spots for SRR3286348.sra Written 1297098 spots for SRR3286348.sra Read 1297098 spots for SRR3286348.sra Written 1297098 spots for SRR3286348.sra Read 1297098 spots for SRR3286348.sra Written 1297098 spots for SRR3286348.sra Read 1297098 spots for SRR3286348.sra Written 1297098 spots for SRR3286348.sra Read 1297098 spots for SRR3286348.sra Written 1297098 spots for SRR3286348.sra Read 1297098 spots for SRR3286348.sra Written 1297098 spots for SRR3286348.sra Read 1297098 spots for SRR3286348.sra Written 1297098 spots for SRR3286348.sra SRR ids: ['SRR3286348.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i4k3qgdd SRR3286348.sra spots: 25941974 blocks: [[1, 1297098], [1297099, 2594196], [2594197, 3891294], [3891295, 5188392], [5188393, 6485490], [6485491, 7782588], [7782589, 9079686], [9079687, 10376784], [10376785, 11673882], [11673883, 12970980], [12970981, 14268078], [14268079, 15565176], [15565177, 16862274], [16862275, 18159372], [18159373, 19456470], [19456471, 20753568], [20753569, 22050666], [22050667, 23347764], [23347765, 24644862], [24644863, 25941974]] SRR3286348 file size 7044451 SRR3286348 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3286348 SRR3286348_1.fastq Input file: SRR3286348_1.fastq trimmed: SRR3286348-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 00:59:08 2024 >> started Tue Dec 10 00:59:22 2024 >> done (13.835s) 25941974 reads processed; of these: 17615 ( 0.07%) short reads filtered out after trimming by size control 263588 ( 1.02%) empty reads filtered out after trimming by size control 25660771 (98.92%) reads available; of these: 2335160 ( 9.10%) trimmed reads available after processing 23325611 (90.90%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1696 0.01% 19 2129 0.01% 20 2710 0.01% 21 4517 0.02% 22 4214 0.02% 23 5817 0.02% 24 7089 0.03% 25 8233 0.03% 26 8185 0.03% 27 7987 0.03% 28 8060 0.03% 29 8216 0.03% 30 8811 0.03% 31 8677 0.03% 32 9113 0.04% 33 9366 0.04% 34 9692 0.04% 35 9802 0.04% 36 10170 0.04% 37 10592 0.04% 38 10603 0.04% 39 11221 0.04% 40 11715 0.05% 41 11933 0.05% 42 12875 0.05% 43 13475 0.05% 44 13069 0.05% 45 14170 0.06% 46 14385 0.06% 47 15264 0.06% 48 16967 0.07% 49 18490 0.07% 50 20451 0.08% 51 22208 0.09% 52 23604 0.09% 53 24267 0.09% 54 24916 0.10% 55 26157 0.10% 56 27547 0.11% 57 29978 0.12% 58 32987 0.13% 59 35500 0.14% 60 39527 0.15% 61 43898 0.17% 62 47017 0.18% 63 48929 0.19% 64 50441 0.20% 65 51798 0.20% 66 54538 0.21% 67 58280 0.23% 68 61826 0.24% 69 63518 0.25% 70 16618 0.06% 71 17339 0.07% 72 17194 0.07% 73 18059 0.07% 74 17870 0.07% 75 18922 0.07% 76 8784 0.03% 77 10245 0.04% 78 12908 0.05% 79 15585 0.06% 80 17385 0.07% 81 18624 0.07% 82 19607 0.08% 83 20731 0.08% 84 22032 0.09% 85 24192 0.09% 86 25927 0.10% 87 27975 0.11% 88 30439 0.12% 89 32820 0.13% 90 35893 0.14% 91 40486 0.16% 92 44582 0.17% 93 51426 0.20% 94 60300 0.23% 95 67356 0.26% 96 78807 0.31% 97 91857 0.36% 98 101507 0.40% 99 107602 0.42% 100 165458 0.64% 101 23325611 90.90% 25660771 reads passed initial QC criterion=sequence-density sequence-density=4.08 sequence-density-rank=1 fanout-score=61.23 fanout-score-rank=2 prefix-density=5.04 prefix-fanout=49.6 sequence=CAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCTTATCTCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=0.90 sequence-density-rank=4 fanout-score=63.86 fanout-score-rank=1 prefix-density=1.13 prefix-fanout=50.6 sequence=GAGATCGGAAGA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x CAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCTTATCTCGTATGCCGTCTTCTGCTTGAAAAA -o SRR3286348 - Input file: STDIN trimmed: SRR3286348-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): CAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCTTATCTCGTATGCCGTCTTCTGC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 01:00:17 2024 >> started Tue Dec 10 01:00:38 2024 >> done (21.227s) 15396463 reads processed; of these: 57 ( 0.00%) short reads filtered out after trimming by size control 2675 ( 0.02%) empty reads filtered out after trimming by size control 15393731 (99.98%) reads available; of these: 1811458 (11.77%) trimmed reads available after processing 13582273 (88.23%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1011 0.01% 19 1276 0.01% 20 1626 0.01% 21 2754 0.02% 22 2565 0.02% 23 3569 0.02% 24 4316 0.03% 25 4979 0.03% 26 4891 0.03% 27 4806 0.03% 28 4850 0.03% 29 4968 0.03% 30 5422 0.04% 31 5225 0.03% 32 5464 0.04% 33 5594 0.04% 34 5955 0.04% 35 5771 0.04% 36 6131 0.04% 37 6388 0.04% 38 6399 0.04% 39 6707 0.04% 40 7093 0.05% 41 7077 0.05% 42 7781 0.05% 43 8112 0.05% 44 7858 0.05% 45 8548 0.06% 46 8696 0.06% 47 9215 0.06% 48 10318 0.07% 49 11076 0.07% 50 12339 0.08% 51 13322 0.09% 52 14241 0.09% 53 14475 0.09% 54 15008 0.10% 55 15850 0.10% 56 16722 0.11% 57 17987 0.12% 58 19872 0.13% 59 21446 0.14% 60 24057 0.16% 61 26490 0.17% 62 28267 0.18% 63 29339 0.19% 64 30415 0.20% 65 31050 0.20% 66 32642 0.21% 67 35023 0.23% 68 38290 0.25% 69 70953 0.46% 70 45781 0.30% 71 49760 0.32% 72 50434 0.33% 73 52023 0.34% 74 53473 0.35% 75 53911 0.35% 76 48846 0.32% 77 52672 0.34% 78 58719 0.38% 79 64472 0.42% 80 70963 0.46% 81 73762 0.48% 82 75589 0.49% 83 77051 0.50% 84 75889 0.49% 85 60869 0.40% 86 57773 0.38% 87 60153 0.39% 88 62073 0.40% 89 65965 0.43% 90 69936 0.45% 91 73194 0.48% 92 77426 0.50% 93 82024 0.53% 94 86557 0.56% 95 93017 0.60% 96 106891 0.69% 97 150852 0.98% 98 352844 2.29% 99 57253 0.37% 100 89832 0.58% 101 12249498 79.57% criterion=sequence-density sequence-density=1.32 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=11 prefix-density=1.34 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.60 sequence-density-rank=6 fanout-score=34.17 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=18.9 sequence=GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCTTATCTCGTATGCCGTCTTCTGCTTGAAAAA Started job on | Dec 10 01:01:08 Started mapping on | Dec 10 01:01:08 Finished on | Dec 10 01:01:32 Mapping speed, Million of reads per hour | 3848.71 Number of input reads | 25658039 Average input read length | 97 UNIQUE READS: Uniquely mapped reads number | 23793746 Uniquely mapped reads % | 92.73% Average mapped length | 96.51 Number of splices: Total | 6522299 Number of splices: Annotated (sjdb) | 6187908 Number of splices: GT/AG | 6420906 Number of splices: GC/AG | 83300 Number of splices: AT/AC | 2408 Number of splices: Non-canonical | 15685 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.44 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 878772 % of reads mapped to multiple loci | 3.42% Number of reads mapped to too many loci | 678190 % of reads mapped to too many loci | 2.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.84% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 985521 985521 985521 N_multimapping 878772 878772 878772 N_noFeature 726152 23116950 988702 N_ambiguous 465838 1814 52857 UnstrandedReadsAssigned:22601756 PositiveStrandReadsAssigned:674982 NegativeStrandReadsAssigned:22752187 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR3286348 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR3286348-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,658,039 reads, 22,875,464 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,180 rounds 52973 SRR3286348.ke.tsv 35125 SRR3286348.se.tsv 88098 total ==> SRR3286348.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 7.37028 0.569403 PNS24247 1044 945 19.9752 1.36685 PNS24249 1928 1829 36.607 1.29423 PNS24246 1044 945 19.9752 1.36685 PNS24248 1044 945 19.9752 1.36685 PNS24244 1471 1372 193.097 9.10087 PNS24243 293 194 0 0 KQK14069 1603 1504 1020.46 43.8742 KQK14071 474 375 75.5943 13.0352 ==> SRR3286348.se.tsv <== BRADI_1g14170v3 1151 BRADI_1g53295v3 79 BRADI_1g59795v3 302 BRADI_1g07683v3 0 BRADI_1g00485v3 26 BRADI_1g20270v3 1774 BRADI_1g74790v3 200 BRADI_1g09890v3 6 BRADI_1g77505v3 299 BRADI_1g48960v3 0 SRR3286348 completed mapping pipeline successfully