Starting /dee2/code/volunteer_pipeline.sh SRR3311696 current disk space = 1523874230272 free memory = 1568393300 SRR3311696 SRAfilesize 59dc4c1abe8527dd2b48c00a3e751ee8 SRR3311696.sra SRR3311696.sra file validated SRR3311696 is single end SRR3311696 is conventional basespace SRR3311696 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3311696_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.58775 33.0 31.0 34.0 27.0 34.0 2 30.84175 34.0 31.0 34.0 27.0 34.0 3 30.744 34.0 31.0 34.0 27.0 34.0 4 34.21225 37.0 35.0 37.0 31.0 37.0 5 33.5845 37.0 35.0 37.0 28.0 37.0 6 32.5925 35.0 33.0 37.0 24.0 37.0 7 32.2415 35.0 32.0 37.0 22.0 37.0 8 32.7565 35.0 35.0 37.0 26.0 37.0 9 34.32275 39.0 35.0 39.0 25.0 39.0 10-11 34.52075 39.0 35.0 39.0 26.5 39.0 12-13 34.488 39.0 35.0 39.0 25.0 39.0 14-15 35.60875 40.0 36.0 41.0 25.5 41.0 16-17 35.522999999999996 40.0 36.0 41.0 24.5 41.0 18-19 35.585499999999996 40.0 36.0 41.0 25.0 41.0 20-21 35.446125 40.0 36.0 41.0 24.5 41.0 22-23 35.266000000000005 40.0 36.0 41.0 23.5 41.0 24-25 35.323499999999996 40.0 36.0 41.0 24.0 41.0 26-27 35.03975 40.0 35.0 41.0 21.0 41.0 28-29 34.9185 40.0 35.5 41.0 19.0 41.0 30-31 34.927 40.0 35.0 41.0 20.0 41.0 32-33 34.586375000000004 40.0 35.0 41.0 18.0 41.0 34-35 34.47 39.0 34.5 41.0 16.0 41.0 36-37 34.42675 39.0 34.0 41.0 16.0 41.0 38-39 34.347125000000005 39.0 34.0 41.0 17.0 41.0 40-41 34.115625 39.0 34.0 41.0 15.0 41.0 42-43 33.924375 39.0 33.5 41.0 13.5 41.0 44-45 33.78125 38.5 33.0 41.0 12.5 41.0 46-47 33.685125 38.5 33.5 41.0 9.0 41.0 48-49 33.475375 38.0 33.0 40.0 9.0 41.0 50-51 33.270625 38.0 33.0 40.0 7.5 41.0 52-53 33.12775 38.0 33.0 40.0 6.5 41.0 54-55 32.907125 37.0 33.0 40.0 2.0 41.0 56-57 32.642875000000004 37.0 33.0 40.0 2.0 41.0 58-59 32.456125 36.0 33.0 40.0 2.0 41.0 60-61 32.198375 36.0 32.0 40.0 2.0 41.0 62-63 31.990125 35.0 32.5 39.0 2.0 41.0 64-65 31.731 35.0 32.0 39.0 2.0 41.0 66-67 31.43975 35.0 32.0 39.0 2.0 40.5 68-69 31.103625 35.0 32.0 38.0 2.0 40.0 70-71 30.753500000000003 35.0 31.0 37.0 2.0 39.5 72-73 30.5075 35.0 31.0 36.5 2.0 39.0 74-75 30.229625 35.0 31.0 36.0 2.0 39.0 76-77 28.770875 33.5 28.5 35.0 2.0 37.0 78-79 29.586750000000002 34.5 30.5 35.0 2.0 37.0 80-81 29.54925 35.0 31.0 35.0 2.0 36.5 82-83 29.243499999999997 35.0 30.0 35.0 2.0 36.0 84-85 29.041125 34.5 30.0 35.0 2.0 36.0 86-87 28.9025 34.0 30.5 35.0 2.0 35.5 88-89 28.927500000000002 34.5 30.0 35.0 2.0 35.0 90-91 28.891624999999998 35.0 30.5 35.0 2.0 35.0 92-93 28.70525 34.0 30.0 35.0 2.0 35.0 94-95 28.544 34.0 30.0 35.0 2.0 35.0 96-97 28.4745 34.0 30.0 35.0 2.0 35.0 98-99 28.254375000000003 34.0 30.0 35.0 2.0 35.0 100-101 27.589125000000003 34.0 28.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2312 1 0.0 2312 2 0.0 2312 3 0.0 2312 4 0.0 2312 5 0.0 2312 6 0.0 2312 7 0.0 2312 8 0.0 2312 9 0.0 2312 10-11 0.0 2312 12-13 0.0 2312 14-15 0.0 2312 16-17 0.0 2312 18-19 0.0 2312 20-21 0.0 2312 22-23 0.0 2312 24-25 0.0 2312 26-27 0.0 2312 28-29 0.0 2312 30-31 0.0 2312 32-33 0.0 2312 34-35 0.0 2312 36-37 0.0 2312 38-39 0.0 2312 40-41 0.0 2312 42-43 0.0 2312 44-45 0.0 2312 46-47 0.0 2312 48-49 0.0 2312 50-51 0.0 2312 52-53 0.0 2312 54-55 0.0 2312 56-57 0.0 2312 58-59 0.0 2312 60-61 0.0 2312 62-63 0.0 2312 64-65 0.0 2312 66-67 0.0 2312 68-69 0.0 2312 70-71 0.0 2312 72-73 0.0 2312 74-75 0.0 2312 76-77 0.0 2312 78-79 0.0 2312 80-81 0.0 2312 82-83 0.0 2312 84-85 0.0 2312 86-87 0.0 2312 88-89 0.0 2312 90-91 0.0 2312 92-93 0.0 2312 94-95 0.0 2312 96-97 0.0 2312 98-99 0.0 2312 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 163.0 3 55.0 4 31.0 5 12.0 6 15.0 7 17.0 8 17.0 9 17.0 10 19.0 11 16.0 12 16.0 13 21.0 14 14.0 15 16.0 16 12.0 17 17.0 18 23.0 19 7.0 20 15.0 21 18.0 22 17.0 23 14.0 24 17.0 25 36.0 26 24.0 27 27.0 28 56.0 29 60.0 30 77.0 31 89.0 32 106.0 33 166.0 34 218.0 35 335.0 36 555.0 37 801.0 38 785.0 39 96.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.404553415061294 5.8293720290217665 9.882411808856641 44.88366274706029 2 25.624999999999996 7.1 29.099999999999998 38.175 3 24.6 11.125 18.85 45.425 4 31.45 14.2 18.25 36.1 5 33.900000000000006 19.275000000000002 22.625 24.2 6 29.65 25.35 21.675 23.325000000000003 7 21.099999999999998 22.45 38.675 17.775 8 23.875 21.7 31.125000000000004 23.3 9 21.775 21.175 35.8 21.25 10-11 23.817863397548162 29.271953965474108 26.8951713785339 20.01501125844383 12-13 24.190523815476936 22.852856607075882 27.86598324790599 25.090636329541194 14-15 24.34021263289556 24.89055659787367 26.779237023139462 23.989993746091308 16-17 25.178236397748595 23.97748592870544 25.8036272670419 25.040650406504067 18-19 24.55591693770328 25.11883912934701 24.7935951963973 25.531648736552416 20-21 24.771789421032885 25.034387895460796 24.934350381393024 25.259472302113295 22-23 25.275 23.400000000000002 25.7 25.624999999999996 24-25 25.181386039529645 23.367525644233176 25.056292219164373 26.394796097072803 26-27 25.42245587683064 24.345975716610337 24.45863061709851 25.77293778946051 28-29 25.662831415707853 24.087043521760883 24.299649824912457 25.950475237618807 30-31 24.474737368684345 24.187093546773387 24.499749874937468 26.8384192096048 32-33 25.21891418563923 23.34250688016012 25.881911433575183 25.55666750062547 34-35 24.809303488808304 23.42128298111792 25.57208953357509 26.19732399649869 36-37 25.85 23.825 24.837500000000002 25.4875 38-39 24.696761285482054 24.359134675503313 24.896836313617605 26.04726772539702 40-41 24.349999999999998 24.375 25.7375 25.5375 42-43 25.112499999999997 23.8875 24.3625 26.637499999999996 44-45 24.625 24.7375 25.05 25.587500000000002 46-47 25.362499999999997 22.6125 24.7375 27.287499999999998 48-49 25.174999999999997 23.8375 25.3 25.687500000000004 50-51 25.412499999999998 24.525 23.925 26.137500000000003 52-53 25.73179884913685 24.06805103827871 24.54340755566675 25.65674255691769 54-55 25.2375 24.875 24.7375 25.15 56-57 24.375 23.8875 25.6125 26.125 58-59 25.603200400050007 23.952994124265533 25.19064883110389 25.25315664458057 60-61 24.79059882485311 24.46555819477435 24.965620702587824 25.778222277784725 62-63 25.424999999999997 24.6 24.3625 25.6125 64-65 25.090636329541194 24.090511313914238 24.778097262157768 26.040755094386796 66-67 25.143785946486624 24.58114528632158 24.60615153788447 25.668917229307326 68-69 25.15 24.85 24.587500000000002 25.412499999999998 70-71 26.270337922403 23.504380475594495 25.093867334167708 25.131414267834796 72-73 26.0 24.2375 24.4875 25.275 74-75 24.4375 24.087500000000002 25.025 26.450000000000003 76-77 25.835105717502817 24.371324909295634 24.146127861879144 25.647441511322405 78-79 25.7 23.275000000000002 24.275 26.75 80-81 24.85621405351338 24.093523380845213 25.09377344336084 25.95648912228057 82-83 26.846057571964955 23.704630788485606 23.504380475594495 25.944931163954944 84-85 25.494120590442833 24.455841881411057 24.00550412809607 26.044533400050035 86-87 25.900450225112557 24.037018509254626 25.062531265632813 25.0 88-89 26.150000000000002 24.2875 24.212500000000002 25.35 90-91 25.809678629486054 24.221583093660122 24.484181568088033 25.484556708765787 92-93 25.484556708765787 23.646367387770415 24.59672377141428 26.27235213204952 94-95 26.55409631019387 24.315196998123827 23.66479049405879 25.465916197623518 96-97 26.775887943971988 23.874437218609305 23.24912456228114 26.100550275137568 98-99 26.20060030015007 24.374687343671837 24.562281140570285 24.862431215607803 100-101 25.703212901612705 25.315664458057256 23.1278909863733 25.853231653956744 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 0.0 28 0.0 29 2.0 30 3.5 31 2.5 32 4.0 33 9.0 34 19.5 35 25.0 36 24.5 37 34.0 38 47.5 39 65.5 40 91.0 41 119.0 42 138.0 43 157.5 44 175.0 45 167.0 46 167.5 47 178.0 48 175.5 49 168.5 50 166.0 51 162.0 52 158.0 53 140.5 54 121.0 55 115.5 56 111.0 57 114.0 58 108.0 59 101.0 60 102.0 61 96.0 62 91.0 63 85.5 64 76.5 65 77.5 66 77.5 67 69.5 68 64.0 69 52.0 70 38.5 71 31.5 72 25.0 73 18.0 74 9.0 75 5.0 76 4.0 77 2.0 78 1.0 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.075 12-13 0.0125 14-15 0.0625 16-17 0.0625 18-19 0.075 20-21 0.0375 22-23 0.0 24-25 0.075 26-27 0.13749999999999998 28-29 0.05 30-31 0.05 32-33 0.075 34-35 0.0375 36-37 0.0 38-39 0.0375 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.075 54-55 0.0 56-57 0.0 58-59 0.0125 60-61 0.0125 62-63 0.0 64-65 0.0125 66-67 0.025 68-69 0.0 70-71 0.125 72-73 0.0 74-75 0.0 76-77 0.08750000000000001 78-79 0.0 80-81 0.025 82-83 0.125 84-85 0.075 86-87 0.05 88-89 0.0 90-91 0.0375 92-93 0.0375 94-95 0.0625 96-97 0.05 98-99 0.05 100-101 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14163090128756 98.175 2 0.7321383489017925 1.4500000000000002 3 0.12623074981065388 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.07500000000000001 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.475 0.0 0.0 0.0 0.0 76-77 0.5625 0.0 0.0 0.0 0.0 78-79 0.7250000000000001 0.0 0.0 0.0 0.0 80-81 0.9 0.0 0.0 0.0 0.0 82-83 1.05 0.0 0.0 0.0 0.0 84-85 1.3 0.0 0.0 0.0 0.0 86-87 1.6375 0.0 0.0 0.0 0.0 88-89 2.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1895330 spots for SRR3311696.sra Written 1895330 spots for SRR3311696.sra Read 1895330 spots for SRR3311696.sra Written 1895330 spots for SRR3311696.sra Read 1895330 spots for SRR3311696.sra Written 1895330 spots for SRR3311696.sra Read 1895330 spots for SRR3311696.sra Written 1895330 spots for SRR3311696.sra Read 1895330 spots for SRR3311696.sra Written 1895330 spots for SRR3311696.sra Read 1895330 spots for SRR3311696.sra Written 1895330 spots for SRR3311696.sra Read 1895330 spots for SRR3311696.sra Written 1895330 spots for SRR3311696.sra Read 1895330 spots for SRR3311696.sra Written 1895330 spots for SRR3311696.sra Read 1895330 spots for SRR3311696.sra Written 1895330 spots for SRR3311696.sra Read 1895343 spots for SRR3311696.sra Written 1895343 spots for SRR3311696.sra Read 1895330 spots for SRR3311696.sra Written 1895330 spots for SRR3311696.sra Read 1895330 spots for SRR3311696.sra Written 1895330 spots for SRR3311696.sra Read 1895330 spots for SRR3311696.sra Written 1895330 spots for SRR3311696.sra Read 1895330 spots for SRR3311696.sra Written 1895330 spots for SRR3311696.sra Read 1895330 spots for SRR3311696.sra Written 1895330 spots for SRR3311696.sra Read 1895330 spots for SRR3311696.sra Written 1895330 spots for SRR3311696.sra Read 1895330 spots for SRR3311696.sra Written 1895330 spots for SRR3311696.sra Read 1895330 spots for SRR3311696.sra Written 1895330 spots for SRR3311696.sra Read 1895330 spots for SRR3311696.sra Written 1895330 spots for SRR3311696.sra Read 1895330 spots for SRR3311696.sra Written 1895330 spots for SRR3311696.sra SRR ids: ['SRR3311696.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kn_0cbtr SRR3311696.sra spots: 37906613 blocks: [[1, 1895330], [1895331, 3790660], [3790661, 5685990], [5685991, 7581320], [7581321, 9476650], [9476651, 11371980], [11371981, 13267310], [13267311, 15162640], [15162641, 17057970], [17057971, 18953300], [18953301, 20848630], [20848631, 22743960], [22743961, 24639290], [24639291, 26534620], [26534621, 28429950], [28429951, 30325280], [30325281, 32220610], [32220611, 34115940], [34115941, 36011270], [36011271, 37906613]] SRR3311696 file size 10224402 SRR3311696 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3311696 SRR3311696_1.fastq Input file: SRR3311696_1.fastq trimmed: SRR3311696-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:01:14 2024 >> started Tue Dec 10 01:01:35 2024 >> done (20.972s) 37906613 reads processed; of these: 948084 ( 2.50%) short reads filtered out after trimming by size control 1055509 ( 2.78%) empty reads filtered out after trimming by size control 35903020 (94.71%) reads available; of these: 4565295 (12.72%) trimmed reads available after processing 31337725 (87.28%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 31975 0.09% 19 31108 0.09% 20 31365 0.09% 21 30160 0.08% 22 30822 0.09% 23 30587 0.09% 24 30906 0.09% 25 31793 0.09% 26 32564 0.09% 27 33031 0.09% 28 33563 0.09% 29 33632 0.09% 30 34502 0.10% 31 35405 0.10% 32 35696 0.10% 33 35837 0.10% 34 36188 0.10% 35 35403 0.10% 36 33908 0.09% 37 35391 0.10% 38 36200 0.10% 39 36517 0.10% 40 38102 0.11% 41 38559 0.11% 42 38704 0.11% 43 39800 0.11% 44 39953 0.11% 45 40349 0.11% 46 40792 0.11% 47 40896 0.11% 48 40415 0.11% 49 40228 0.11% 50 38344 0.11% 51 39192 0.11% 52 40625 0.11% 53 41824 0.12% 54 42434 0.12% 55 42671 0.12% 56 42873 0.12% 57 43211 0.12% 58 43850 0.12% 59 43607 0.12% 60 44270 0.12% 61 45708 0.13% 62 45775 0.13% 63 47258 0.13% 64 48461 0.13% 65 49627 0.14% 66 51028 0.14% 67 52081 0.15% 68 52676 0.15% 69 54685 0.15% 70 46938 0.13% 71 47571 0.13% 72 49083 0.14% 73 51202 0.14% 74 52069 0.15% 75 56940 0.16% 76 22559 0.06% 77 25116 0.07% 78 32485 0.09% 79 37690 0.10% 80 42546 0.12% 81 45432 0.13% 82 47237 0.13% 83 49749 0.14% 84 52345 0.15% 85 55663 0.16% 86 59672 0.17% 87 63906 0.18% 88 67942 0.19% 89 72191 0.20% 90 78236 0.22% 91 85773 0.24% 92 93328 0.26% 93 104902 0.29% 94 119130 0.33% 95 134589 0.37% 96 157010 0.44% 97 177144 0.49% 98 192367 0.54% 99 194709 0.54% 100 205220 0.57% 101 31337725 87.28% 35903020 reads passed initial QC criterion=sequence-density sequence-density=1.55 sequence-density-rank=1 fanout-score=66.17 fanout-score-rank=2 prefix-density=2.14 prefix-fanout=47.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=164.02 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=8.6 sequence=AAGAGGAGGGTCTTGTCGTTCTTGAGCTTGATGTCGCTGTGCTTCCAGTGGCCGTGGACGGTGTCGTACTTGAACATGTAGGTCATGTACTCGGTGGTGATGAAGGGGTCGTTGACGGCGACGAGCTCGATGTCATCGCTCTGGAGAGCAACCCTGGCGACGAGCCTCCCGATCCTTCCGAAACCGTTGATTCCGATC Started job on | Dec 10 01:01:55 Started mapping on | Dec 10 01:01:55 Finished on | Dec 10 01:02:24 Mapping speed, Million of reads per hour | 4456.93 Number of input reads | 35903020 Average input read length | 97 UNIQUE READS: Uniquely mapped reads number | 35108945 Uniquely mapped reads % | 97.79% Average mapped length | 96.72 Number of splices: Total | 11086229 Number of splices: Annotated (sjdb) | 10617563 Number of splices: GT/AG | 10932473 Number of splices: GC/AG | 131108 Number of splices: AT/AC | 6472 Number of splices: Non-canonical | 16176 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.48 Insertion rate per base | 0.00% Insertion average length | 1.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 500401 % of reads mapped to multiple loci | 1.39% Number of reads mapped to too many loci | 166415 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.33% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 293674 293674 293674 N_multimapping 500401 500401 500401 N_noFeature 1042563 34296292 1360259 N_ambiguous 554229 3120 66403 UnstrandedReadsAssigned:33512153 PositiveStrandReadsAssigned:809533 NegativeStrandReadsAssigned:33682283 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR3311696 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR3311696-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,903,020 reads, 33,338,380 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52973 SRR3311696.ke.tsv 35125 SRR3311696.se.tsv 88098 total ==> SRR3311696.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 121.044 7.18622 PNS24247 1044 945 79.7325 4.19261 PNS24249 1928 1829 126.02 3.42379 PNS24246 1044 945 79.7325 4.19261 PNS24248 1044 945 79.7325 4.19261 PNS24244 1471 1372 77.7381 2.81554 PNS24243 293 194 0 0 KQK14069 1603 1504 862.187 28.4862 KQK14071 474 375 229.412 30.3995 ==> SRR3311696.se.tsv <== BRADI_1g14170v3 1319 BRADI_1g53295v3 170 BRADI_1g59795v3 250 BRADI_1g07683v3 0 BRADI_1g00485v3 177 BRADI_1g20270v3 1667 BRADI_1g74790v3 1088 BRADI_1g09890v3 0 BRADI_1g77505v3 152 BRADI_1g48960v3 0 SRR3311696 completed mapping pipeline successfully