Starting /dee2/code/volunteer_pipeline.sh SRR3311697 current disk space = 1523851825152 free memory = 1563847156 SRR3311697 SRAfilesize df61409f80a4db37b00584ecf1bc9d28 SRR3311697.sra SRR3311697.sra file validated SRR3311697 is single end SRR3311697 is conventional basespace SRR3311697 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3311697_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.666 31.0 31.0 34.0 27.0 34.0 2 30.80925 33.0 31.0 34.0 27.0 34.0 3 30.76775 33.0 31.0 34.0 27.0 34.0 4 34.1595 37.0 35.0 37.0 30.0 37.0 5 33.72625 37.0 35.0 37.0 28.0 37.0 6 33.68325 37.0 35.0 37.0 29.0 37.0 7 33.0765 36.0 35.0 37.0 26.0 37.0 8 33.30975 37.0 35.0 37.0 28.0 37.0 9 34.92825 39.0 35.0 39.0 28.0 39.0 10-11 34.825 39.0 35.0 39.0 27.0 39.0 12-13 34.4885 39.0 35.0 39.0 25.5 39.0 14-15 35.679249999999996 40.0 36.0 41.0 26.5 41.0 16-17 35.6625 40.0 36.0 41.0 25.5 41.0 18-19 35.557500000000005 40.0 36.0 41.0 24.5 41.0 20-21 35.622 40.0 36.0 41.0 25.0 41.0 22-23 35.4015 40.0 36.0 41.0 24.5 41.0 24-25 35.336124999999996 40.0 36.0 41.0 24.5 41.0 26-27 35.146 40.0 36.0 41.0 23.0 41.0 28-29 35.0475 40.0 35.5 41.0 22.0 41.0 30-31 34.94725 40.0 35.0 41.0 20.0 41.0 32-33 34.756375000000006 40.0 35.0 41.0 18.5 41.0 34-35 34.794875000000005 40.0 35.0 41.0 21.0 41.0 36-37 34.65625 39.0 35.0 41.0 19.5 41.0 38-39 34.715875 40.0 35.0 41.0 20.0 41.0 40-41 34.485875 39.0 35.0 41.0 18.5 41.0 42-43 34.491875 39.0 35.0 41.0 18.0 41.0 44-45 34.43625 39.0 35.0 41.0 18.0 41.0 46-47 34.23350000000001 39.0 34.0 41.0 17.0 41.0 48-49 34.052625 39.0 34.0 41.0 15.0 41.0 50-51 33.97225 38.5 34.0 41.0 15.5 41.0 52-53 33.813375 38.5 34.0 41.0 14.0 41.0 54-55 33.574250000000006 38.0 33.0 40.0 12.5 41.0 56-57 33.376125 38.0 33.5 40.0 8.5 41.0 58-59 33.052625 37.0 33.0 40.0 7.0 41.0 60-61 32.827749999999995 37.0 33.0 40.0 6.5 41.0 62-63 32.53075 36.0 33.0 40.0 2.0 41.0 64-65 32.2325 35.5 32.5 39.0 2.0 41.0 66-67 31.9035 35.0 32.0 39.0 2.0 41.0 68-69 31.582875 35.0 32.0 38.5 2.0 40.0 70-71 31.224125 35.0 31.5 37.5 2.0 40.0 72-73 30.780625 35.0 31.0 37.0 2.0 39.0 74-75 30.605125 35.0 31.0 36.5 2.0 39.0 76-77 29.048375 33.5 28.5 35.0 2.0 37.0 78-79 29.799 34.5 30.5 35.0 2.0 37.0 80-81 29.893375 35.0 31.0 35.0 2.0 37.0 82-83 29.724 35.0 31.0 35.0 2.0 36.5 84-85 29.513875 35.0 31.0 35.0 2.0 36.0 86-87 29.258625 35.0 30.5 35.0 2.0 36.0 88-89 29.11225 34.5 31.0 35.0 2.0 35.5 90-91 29.044125 34.5 30.5 35.0 2.0 35.0 92-93 28.997 34.0 30.5 35.0 2.0 35.0 94-95 28.875875 34.0 30.5 35.0 2.0 35.0 96-97 28.56575 34.0 30.0 35.0 2.0 35.0 98-99 28.594250000000002 34.0 30.0 35.0 2.0 35.0 100-101 28.05 34.0 29.5 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2313 1 0.0 2313 2 0.0 2313 3 0.0 2313 4 0.0 2313 5 0.0 2313 6 0.0 2313 7 0.0 2313 8 0.0 2313 9 0.0 2313 10-11 0.0 2313 12-13 0.0 2313 14-15 0.0 2313 16-17 0.0 2313 18-19 0.0 2313 20-21 0.0 2313 22-23 0.0 2313 24-25 0.0 2313 26-27 0.0 2313 28-29 0.0 2313 30-31 0.0 2313 32-33 0.0 2313 34-35 0.0 2313 36-37 0.0 2313 38-39 0.0 2313 40-41 0.0 2313 42-43 0.0 2313 44-45 0.0 2313 46-47 0.0 2313 48-49 0.0 2313 50-51 0.0 2313 52-53 0.0 2313 54-55 0.0 2313 56-57 0.0 2313 58-59 0.0 2313 60-61 0.0 2313 62-63 0.0 2313 64-65 0.0 2313 66-67 0.0 2313 68-69 0.0 2313 70-71 0.0 2313 72-73 0.0 2313 74-75 0.0 2313 76-77 0.0 2313 78-79 0.0 2313 80-81 0.0 2313 82-83 0.0 2313 84-85 0.0 2313 86-87 0.0 2313 88-89 0.0 2313 90-91 0.0 2313 92-93 0.0 2313 94-95 0.0 2313 96-97 0.0 2313 98-99 0.0 2313 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 146.0 3 58.0 4 30.0 5 18.0 6 16.0 7 13.0 8 10.0 9 12.0 10 11.0 11 10.0 12 18.0 13 15.0 14 19.0 15 21.0 16 16.0 17 15.0 18 15.0 19 9.0 20 12.0 21 17.0 22 13.0 23 17.0 24 20.0 25 23.0 26 37.0 27 44.0 28 56.0 29 51.0 30 88.0 31 90.0 32 114.0 33 142.0 34 180.0 35 302.0 36 502.0 37 850.0 38 877.0 39 113.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 59.35467733866934 7.303651825912956 3.026513256628314 30.315157578789393 2 25.900000000000002 7.725 35.325 31.05 3 22.8 11.425 24.3 41.475 4 29.849999999999998 17.525 21.725 30.9 5 31.45 22.25 23.200000000000003 23.1 6 27.400000000000002 26.6 21.65 24.349999999999998 7 21.125 22.650000000000002 40.699999999999996 15.525 8 19.525000000000002 22.05 36.15 22.275 9 20.1 20.075000000000003 36.025 23.799999999999997 10-11 23.589743589743588 29.46841776110069 27.66729205753596 19.274546591619764 12-13 24.3625 24.887500000000003 27.500000000000004 23.25 14-15 23.3991995997999 26.300650325162582 27.301150575287643 22.998999499749875 16-17 24.559209703638864 25.559584844316618 26.49743653870201 23.383768913342504 18-19 23.95898461923221 24.78429411029136 26.15980992872327 25.09691134175316 20-21 23.22120795298237 26.672502188320617 25.859697386519947 24.246592472177067 22-23 24.4125 26.1125 25.4625 24.0125 24-25 24.474737368684345 25.237618809404704 25.52526263131566 24.7623811905953 26-27 23.767825869402053 25.64423317488116 26.432324243182386 24.1556167125344 28-29 23.096161060397648 25.584594222833562 26.02225834688008 25.296986369888707 30-31 24.681170292573142 24.3935983995999 25.168792198049513 25.756439109777446 32-33 23.19909954977489 24.949974987493746 26.050525262631314 25.80040020010005 34-35 24.290536317039628 25.66570821352669 25.19064883110389 24.85310663832979 36-37 24.1625 24.962500000000002 25.724999999999998 25.15 38-39 23.458797048893334 24.609228460672753 26.7725397023884 25.159434788045516 40-41 24.9875 24.637500000000003 25.387500000000003 24.9875 42-43 23.925 26.150000000000002 25.124999999999996 24.8 44-45 23.1625 25.7875 25.8625 25.1875 46-47 24.349999999999998 26.0375 25.45 24.1625 48-49 23.474999999999998 25.5625 26.5625 24.4 50-51 23.0 25.5125 25.624999999999996 25.8625 52-53 23.521320495185694 25.484556708765787 25.497061398024258 25.497061398024258 54-55 23.825 25.5125 25.55 25.112499999999997 56-57 23.2375 25.924999999999997 25.637500000000003 25.2 58-59 24.3875 25.55 24.875 25.1875 60-61 24.45 25.837500000000002 24.975 24.7375 62-63 23.9 25.6 25.8625 24.637500000000003 64-65 24.087500000000002 25.0 25.637500000000003 25.275 66-67 24.85 25.5375 24.825 24.7875 68-69 23.8125 24.8625 26.125 25.2 70-71 24.42136869761041 25.509821093456775 25.347178781433755 24.721631427499062 72-73 24.85 24.575 25.75 24.825 74-75 23.3875 25.55 25.8 25.2625 76-77 24.559209703638864 25.697136426159812 25.071901963236215 24.671751906965113 78-79 24.587500000000002 25.074999999999996 24.95 25.387500000000003 80-81 23.102887860982623 25.59069883735467 25.95324415551944 25.353169146143266 82-83 24.31485421098736 24.452509072706796 26.392191215117005 24.84044550118884 84-85 24.02150806552457 24.98436913842691 25.109416031011627 25.884706765036892 86-87 22.733525071901965 25.409528573214956 26.32237088908341 25.534575465799676 88-89 23.8875 26.387500000000003 24.9375 24.7875 90-91 23.718429607401852 24.99374843710928 25.331332833208304 25.95648912228057 92-93 23.686843421710854 25.26263131565783 25.80040020010005 25.250125062531264 94-95 24.034012754783042 25.50956608728273 25.196948855820935 25.259472302113295 96-97 24.484181568088033 24.98436913842691 25.02188320620233 25.50956608728273 98-99 22.758534450418907 26.985119419782418 25.296986369888707 24.959359759909965 100-101 25.090636329541194 26.190773846730842 24.290536317039628 24.428053506688336 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 1.0 27 1.5 28 5.0 29 6.0 30 7.5 31 9.5 32 10.5 33 20.5 34 27.5 35 28.5 36 37.0 37 45.0 38 51.5 39 73.0 40 109.0 41 140.0 42 151.5 43 184.5 44 221.5 45 209.0 46 200.5 47 193.5 48 179.5 49 180.0 50 175.5 51 170.0 52 158.0 53 144.0 54 137.0 55 120.0 56 108.0 57 103.0 58 94.5 59 92.5 60 88.0 61 78.0 62 74.0 63 75.5 64 66.0 65 48.0 66 43.0 67 37.5 68 28.5 69 27.0 70 17.0 71 6.5 72 3.5 73 2.0 74 1.5 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0625 12-13 0.0 14-15 0.05 16-17 0.0375 18-19 0.0375 20-21 0.0375 22-23 0.0 24-25 0.05 26-27 0.075 28-29 0.0375 30-31 0.025 32-33 0.05 34-35 0.0125 36-37 0.0 38-39 0.0375 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0375 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.08750000000000001 72-73 0.0 74-75 0.0 76-77 0.0375 78-79 0.0 80-81 0.0125 82-83 0.11249999999999999 84-85 0.0375 86-87 0.0375 88-89 0.0 90-91 0.025 92-93 0.05 94-95 0.0375 96-97 0.0375 98-99 0.0375 100-101 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1166077738516 98.175 2 0.8076728924785461 1.6 3 0.0757193336698637 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.21250000000000002 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.2875 0.0 0.0 0.0 0.0 72-73 0.38749999999999996 0.0 0.0 0.0 0.0 74-75 0.5375000000000001 0.0 0.0 0.0 0.0 76-77 0.5874999999999999 0.0 0.0 0.0 0.0 78-79 0.7749999999999999 0.0 0.0 0.0 0.0 80-81 0.9624999999999999 0.0 0.0 0.0 0.0 82-83 1.075 0.0 0.0 0.0 0.0 84-85 1.3624999999999998 0.0 0.0 0.0 0.0 86-87 1.6875 0.0 0.0 0.0 0.0 88-89 2.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1665281 spots for SRR3311697.sra Written 1665281 spots for SRR3311697.sra Read 1665281 spots for SRR3311697.sra Written 1665281 spots for SRR3311697.sra Read 1665281 spots for SRR3311697.sra Written 1665281 spots for SRR3311697.sra Read 1665281 spots for SRR3311697.sra Written 1665281 spots for SRR3311697.sra Read 1665281 spots for SRR3311697.sra Written 1665281 spots for SRR3311697.sra Read 1665281 spots for SRR3311697.sra Written 1665281 spots for SRR3311697.sra Read 1665281 spots for SRR3311697.sra Written 1665281 spots for SRR3311697.sra Read 1665281 spots for SRR3311697.sra Written 1665281 spots for SRR3311697.sra Read 1665281 spots for SRR3311697.sra Written 1665281 spots for SRR3311697.sra Read 1665281 spots for SRR3311697.sra Written 1665281 spots for SRR3311697.sra Read 1665281 spots for SRR3311697.sra Written 1665281 spots for SRR3311697.sra Read 1665282 spots for SRR3311697.sra Written 1665282 spots for SRR3311697.sra Read 1665281 spots for SRR3311697.sra Written 1665281 spots for SRR3311697.sra Read 1665281 spots for SRR3311697.sra Written 1665281 spots for SRR3311697.sra Read 1665281 spots for SRR3311697.sra Written 1665281 spots for SRR3311697.sra Read 1665281 spots for SRR3311697.sra Written 1665281 spots for SRR3311697.sra Read 1665281 spots for SRR3311697.sra Written 1665281 spots for SRR3311697.sra Read 1665281 spots for SRR3311697.sra Written 1665281 spots for SRR3311697.sra Read 1665281 spots for SRR3311697.sra Written 1665281 spots for SRR3311697.sra Read 1665281 spots for SRR3311697.sra Written 1665281 spots for SRR3311697.sra SRR ids: ['SRR3311697.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4uyvyxrb SRR3311697.sra spots: 33305621 blocks: [[1, 1665281], [1665282, 3330562], [3330563, 4995843], [4995844, 6661124], [6661125, 8326405], [8326406, 9991686], [9991687, 11656967], [11656968, 13322248], [13322249, 14987529], [14987530, 16652810], [16652811, 18318091], [18318092, 19983372], [19983373, 21648653], [21648654, 23313934], [23313935, 24979215], [24979216, 26644496], [26644497, 28309777], [28309778, 29975058], [29975059, 31640339], [31640340, 33305621]] SRR3311697 file size 8982092 SRR3311697 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3311697 SRR3311697_1.fastq Input file: SRR3311697_1.fastq trimmed: SRR3311697-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:00:52 2024 >> started Tue Dec 10 01:01:09 2024 >> done (16.634s) 33305621 reads processed; of these: 824895 ( 2.48%) short reads filtered out after trimming by size control 846170 ( 2.54%) empty reads filtered out after trimming by size control 31634556 (94.98%) reads available; of these: 3484502 (11.01%) trimmed reads available after processing 28150054 (88.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 27762 0.09% 19 25545 0.08% 20 24715 0.08% 21 24107 0.08% 22 24450 0.08% 23 23720 0.07% 24 23941 0.08% 25 23979 0.08% 26 24242 0.08% 27 24337 0.08% 28 24481 0.08% 29 24377 0.08% 30 25425 0.08% 31 25524 0.08% 32 25907 0.08% 33 26443 0.08% 34 26698 0.08% 35 25878 0.08% 36 25133 0.08% 37 26396 0.08% 38 26312 0.08% 39 27247 0.09% 40 28382 0.09% 41 28889 0.09% 42 28915 0.09% 43 29416 0.09% 44 30309 0.10% 45 30379 0.10% 46 30986 0.10% 47 30420 0.10% 48 30543 0.10% 49 30070 0.10% 50 29406 0.09% 51 30438 0.10% 52 31243 0.10% 53 32549 0.10% 54 32465 0.10% 55 32859 0.10% 56 33323 0.11% 57 33802 0.11% 58 34002 0.11% 59 34554 0.11% 60 35436 0.11% 61 36183 0.11% 62 36630 0.12% 63 38123 0.12% 64 38836 0.12% 65 39554 0.13% 66 40926 0.13% 67 42218 0.13% 68 42956 0.14% 69 45537 0.14% 70 36453 0.12% 71 36351 0.11% 72 37599 0.12% 73 39413 0.12% 74 40519 0.13% 75 44321 0.14% 76 17220 0.05% 77 19388 0.06% 78 25033 0.08% 79 28950 0.09% 80 31969 0.10% 81 34436 0.11% 82 36228 0.11% 83 37532 0.12% 84 39213 0.12% 85 41690 0.13% 86 44531 0.14% 87 47917 0.15% 88 51387 0.16% 89 54634 0.17% 90 58968 0.19% 91 63892 0.20% 92 70201 0.22% 93 79561 0.25% 94 89151 0.28% 95 101246 0.32% 96 117712 0.37% 97 132925 0.42% 98 146788 0.46% 99 148456 0.47% 100 154850 0.49% 101 28150054 88.99% 31634556 reads passed initial QC criterion=sequence-density sequence-density=2.02 sequence-density-rank=1 fanout-score=53.65 fanout-score-rank=2 prefix-density=2.79 prefix-fanout=38.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=226.44 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=9.0 sequence=AAGAGGAGGGTCTTGTCGTTCTTGAGCTTGATGTCGCTGTGCTTCCAGTGGCCGTGGACGGTGTCGTACTTGAACATGTAGGTCATGTACTCGGTGGTGATGAAGGGGTCGTTGACGGCGACGAGCTCGATGTCATCGCTCTGGAGAGCAACCCTGGCGACGAGCCTCCCGATCCTTCCGAAACCGTTGATTCCGATC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGT -o SRR3311697 - Input file: STDIN trimmed: SRR3311697-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 01:02:43 2024 >> started Tue Dec 10 01:02:58 2024 >> done (15.379s) 10544852 reads processed; of these: 397 ( 0.00%) short reads filtered out after trimming by size control 3 ( 0.00%) empty reads filtered out after trimming by size control 10544452 (100.00%) reads available; of these: 830836 ( 7.88%) trimmed reads available after processing 9713616 (92.12%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9204 0.09% 19 8425 0.08% 20 8244 0.08% 21 8070 0.08% 22 8310 0.08% 23 7749 0.07% 24 7896 0.07% 25 8030 0.08% 26 8189 0.08% 27 8107 0.08% 28 8100 0.08% 29 8154 0.08% 30 8218 0.08% 31 8488 0.08% 32 8513 0.08% 33 8780 0.08% 34 8957 0.08% 35 8515 0.08% 36 8453 0.08% 37 8809 0.08% 38 8732 0.08% 39 8992 0.09% 40 9392 0.09% 41 9564 0.09% 42 9672 0.09% 43 9749 0.09% 44 10116 0.10% 45 10130 0.10% 46 10300 0.10% 47 10282 0.10% 48 10172 0.10% 49 10159 0.10% 50 9854 0.09% 51 10139 0.10% 52 10504 0.10% 53 10935 0.10% 54 11040 0.10% 55 10929 0.10% 56 11264 0.11% 57 11037 0.10% 58 11518 0.11% 59 11509 0.11% 60 11744 0.11% 61 12035 0.11% 62 12069 0.11% 63 12731 0.12% 64 12796 0.12% 65 13148 0.12% 66 13624 0.13% 67 13997 0.13% 68 14287 0.14% 69 15219 0.14% 70 16160 0.15% 71 16244 0.15% 72 17518 0.17% 73 18787 0.18% 74 19631 0.19% 75 21750 0.21% 76 13379 0.13% 77 14695 0.14% 78 17260 0.16% 79 19683 0.19% 80 21466 0.20% 81 23733 0.23% 82 26088 0.25% 83 28096 0.27% 84 30037 0.28% 85 32998 0.31% 86 34527 0.33% 87 37571 0.36% 88 40751 0.39% 89 42899 0.41% 90 46751 0.44% 91 50644 0.48% 92 55064 0.52% 93 61325 0.58% 94 67520 0.64% 95 76017 0.72% 96 93440 0.89% 97 128999 1.22% 98 264192 2.51% 99 46661 0.44% 100 48755 0.46% 101 8586961 81.44% criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=10.68 fanout-score-rank=11 prefix-density=0.56 prefix-fanout=5.5 sequence=TTGTTGTTGCTGCCACTGGCGTAGCCGTTGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=64.82 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=12.7 sequence=CAGCATCATCAATTCTGCTCATGGGGATAATGTTGTTCTTAACTTGGGATGTCAGATCATCAATGAATTCTGTGTAGGCAAAAGGAACCATGATCATGTCAATACCGGCACCAACTCCAGCCTCAATGGAATATGAATAGTTTAGTTTCGGAGGGGTAGTAATCCGATCGATGCCTTGCCAGTCTGAAATCACAAAGCCCCTAAATTTGAGCTTGTTCTTGAGAAAATCAGTGATCAGGAAATGGTTGGCGTGCATTTTCTGTCCATTCCAACTAGAGTACGAGACCATAACAGTAGAGACACCTCTGATGATAGAGTTATAATAAGCAGGCATGTGGATAGTCATTAGCCCACGTTTGTCGATGATTGTATTGTTCTCATTGATCCCCATAAATGTACCACCGTCACCAACATAGTGCTTTGCGCATGCAGCAACTTTCTTACTTCCACCAACATATGGTCTTCCCGCAAAACCTGATGGAGCTTCGCCTTGCAAACCAGAGATAAGTGT Started job on | Dec 10 01:03:27 Started mapping on | Dec 10 01:03:27 Finished on | Dec 10 01:03:51 Mapping speed, Million of reads per hour | 4745.12 Number of input reads | 31634156 Average input read length | 97 UNIQUE READS: Uniquely mapped reads number | 30928747 Uniquely mapped reads % | 97.77% Average mapped length | 97.01 Number of splices: Total | 10207233 Number of splices: Annotated (sjdb) | 9794852 Number of splices: GT/AG | 10068013 Number of splices: GC/AG | 116438 Number of splices: AT/AC | 6122 Number of splices: Non-canonical | 16660 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.46 Insertion rate per base | 0.00% Insertion average length | 1.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 449365 % of reads mapped to multiple loci | 1.42% Number of reads mapped to too many loci | 133368 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.35% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 256044 256044 256044 N_multimapping 449365 449365 449365 N_noFeature 1083230 30212160 1323442 N_ambiguous 531984 2751 62594 UnstrandedReadsAssigned:29313533 PositiveStrandReadsAssigned:713836 NegativeStrandReadsAssigned:29542711 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR3311697 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR3311697-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,634,156 reads, 29,311,223 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,373 rounds 52973 SRR3311697.ke.tsv 35125 SRR3311697.se.tsv 88098 total ==> SRR3311697.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 118.429 8.19482 PNS24247 1044 945 48.2754 2.95869 PNS24249 1928 1829 31.151 0.986425 PNS24246 1044 945 48.2754 2.95869 PNS24248 1044 945 48.2754 2.95869 PNS24244 1471 1372 147.594 6.23047 PNS24243 293 194 0 0 KQK14069 1603 1504 1718.45 66.1751 KQK14071 474 375 130.593 20.1696 ==> SRR3311697.se.tsv <== BRADI_1g14170v3 2284 BRADI_1g53295v3 168 BRADI_1g59795v3 236 BRADI_1g07683v3 0 BRADI_1g00485v3 230 BRADI_1g20270v3 1562 BRADI_1g74790v3 719 BRADI_1g09890v3 1 BRADI_1g77505v3 159 BRADI_1g48960v3 0 SRR3311697 completed mapping pipeline successfully