Starting /dee2/code/volunteer_pipeline.sh SRR3311774 current disk space = 1523824336896 free memory = 1484763480 SRR3311774 SRAfilesize 45e132eb14b70180e72da6853011d96b SRR3311774.sra SRR3311774.sra file validated SRR3311774 is single end SRR3311774 is conventional basespace SRR3311774 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3311774_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.7755 33.0 33.0 33.0 2.0 33.0 2 31.1455 33.0 33.0 33.0 27.0 33.0 3 31.42725 33.0 33.0 33.0 27.0 33.0 4 31.8895 33.0 33.0 33.0 33.0 33.0 5 31.8995 33.0 33.0 33.0 33.0 33.0 6 35.2235 37.0 37.0 37.0 33.0 37.0 7 35.31 37.0 37.0 37.0 33.0 37.0 8 35.60175 37.0 37.0 37.0 33.0 37.0 9 35.71875 37.0 37.0 37.0 33.0 37.0 10-11 35.596000000000004 37.0 37.0 37.0 33.0 37.0 12-13 35.51975 37.0 37.0 37.0 33.0 37.0 14-15 35.519375 37.0 37.0 37.0 33.0 37.0 16-17 35.53375 37.0 37.0 37.0 33.0 37.0 18-19 35.597375 37.0 37.0 37.0 35.0 37.0 20-21 35.546125 37.0 37.0 37.0 33.0 37.0 22-23 35.53975 37.0 37.0 37.0 35.0 37.0 24-25 35.504999999999995 37.0 37.0 37.0 35.0 37.0 26-27 35.529624999999996 37.0 37.0 37.0 33.0 37.0 28-29 35.419375 37.0 37.0 37.0 33.0 37.0 30-31 35.493375 37.0 37.0 37.0 33.0 37.0 32-33 35.440875000000005 37.0 37.0 37.0 33.0 37.0 34-35 35.464 37.0 37.0 37.0 33.0 37.0 36-37 35.372 37.0 37.0 37.0 33.0 37.0 38-39 35.355125 37.0 37.0 37.0 33.0 37.0 40-41 35.46275 37.0 37.0 37.0 33.0 37.0 42-43 35.374375 37.0 37.0 37.0 33.0 37.0 44-45 35.2495 37.0 37.0 37.0 33.0 37.0 46-47 35.2855 37.0 37.0 37.0 33.0 37.0 48-49 35.3305 37.0 37.0 37.0 33.0 37.0 50-51 35.236625000000004 37.0 37.0 37.0 33.0 37.0 52-53 35.272999999999996 37.0 37.0 37.0 33.0 37.0 54-55 35.250875 37.0 37.0 37.0 33.0 37.0 56-57 35.2025 37.0 37.0 37.0 33.0 37.0 58-59 35.187375 37.0 37.0 37.0 33.0 37.0 60-61 35.241875 37.0 37.0 37.0 33.0 37.0 62-63 35.162 37.0 37.0 37.0 33.0 37.0 64-65 35.127250000000004 37.0 37.0 37.0 33.0 37.0 66-67 35.03875 37.0 37.0 37.0 33.0 37.0 68-69 34.87775 37.0 37.0 37.0 33.0 37.0 70-71 35.049375 37.0 37.0 37.0 33.0 37.0 72-73 34.937625 37.0 37.0 37.0 33.0 37.0 74-75 34.936499999999995 37.0 37.0 37.0 33.0 37.0 76-77 34.917 37.0 37.0 37.0 33.0 37.0 78-79 34.9675 37.0 37.0 37.0 33.0 37.0 80-81 34.91825 37.0 37.0 37.0 33.0 37.0 82-83 34.8245 37.0 37.0 37.0 33.0 37.0 84-85 34.802125000000004 37.0 37.0 37.0 33.0 37.0 86-87 34.604 37.0 37.0 37.0 30.0 37.0 88-89 34.601 37.0 37.0 37.0 33.0 37.0 90-91 34.434749999999994 37.0 37.0 37.0 27.0 37.0 92-93 34.53725 37.0 37.0 37.0 33.0 37.0 94-95 34.416125 37.0 37.0 37.0 30.0 37.0 96-97 34.284125 37.0 37.0 37.0 30.0 37.0 98-99 33.902625 37.0 37.0 37.0 27.0 37.0 100-101 32.57 37.0 35.0 37.0 14.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 13.0 4 8.0 5 6.0 6 5.0 7 4.0 8 4.0 9 8.0 10 2.0 11 3.0 12 0.0 13 1.0 14 2.0 15 1.0 16 4.0 17 2.0 18 2.0 19 4.0 20 7.0 21 7.0 22 10.0 23 14.0 24 19.0 25 20.0 26 28.0 27 31.0 28 48.0 29 44.0 30 62.0 31 70.0 32 93.0 33 88.0 34 186.0 35 379.0 36 2806.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.18075801749271 14.431486880466474 7.259475218658892 42.12827988338192 2 23.9 19.225 35.925000000000004 20.95 3 20.625 24.15 25.825 29.4 4 24.7 30.125 20.474999999999998 24.7 5 23.674999999999997 33.85 23.775 18.7 6 20.3 33.025 24.25 22.425 7 16.7 20.75 42.4 20.150000000000002 8 20.424999999999997 21.275 28.825 29.475 9 18.825 20.025000000000002 32.775 28.375 10-11 23.7625 30.0375 21.1625 25.0375 12-13 22.8 23.849999999999998 25.637500000000003 27.712500000000002 14-15 22.1 26.6 25.337500000000002 25.9625 16-17 23.225 25.7625 25.2 25.8125 18-19 22.9375 26.450000000000003 24.9875 25.624999999999996 20-21 22.8875 26.35 26.025 24.7375 22-23 22.8375 26.087500000000002 25.937500000000004 25.137500000000003 24-25 23.1125 26.575 24.8125 25.5 26-27 22.775000000000002 27.1125 24.3625 25.75 28-29 23.0875 26.487500000000004 25.2 25.224999999999998 30-31 22.375 26.0125 26.224999999999998 25.387500000000003 32-33 23.05 26.200000000000003 25.4375 25.3125 34-35 22.9625 26.525 25.087500000000002 25.424999999999997 36-37 22.925 25.8 25.2125 26.0625 38-39 23.7 25.9875 24.875 25.4375 40-41 24.087500000000002 26.2625 24.9875 24.6625 42-43 22.9875 26.174999999999997 25.3125 25.525 44-45 23.5 25.7125 25.275 25.5125 46-47 23.724999999999998 26.5625 24.9 24.8125 48-49 23.9 25.387500000000003 24.625 26.087500000000002 50-51 23.2875 25.7875 25.674999999999997 25.25 52-53 23.7625 26.637499999999996 24.575 25.025 54-55 23.7875 26.2625 24.275 25.674999999999997 56-57 22.0 26.2875 24.887500000000003 26.825 58-59 23.799999999999997 25.087500000000002 25.7625 25.35 60-61 23.825 25.424999999999997 25.174999999999997 25.575 62-63 22.6125 24.875 26.187500000000004 26.325 64-65 23.7375 26.3125 25.650000000000002 24.3 66-67 23.3 25.5375 25.424999999999997 25.7375 68-69 22.287499999999998 26.325 25.3 26.087500000000002 70-71 23.1875 26.3 25.15 25.362499999999997 72-73 24.15 25.474999999999998 24.5125 25.8625 74-75 23.6875 25.624999999999996 25.637500000000003 25.05 76-77 23.1 26.187500000000004 25.650000000000002 25.0625 78-79 24.0 25.162499999999998 25.7125 25.124999999999996 80-81 22.275 26.5625 25.05 26.1125 82-83 22.7625 26.5125 25.937500000000004 24.7875 84-85 23.200000000000003 25.724999999999998 25.7625 25.3125 86-87 22.85 26.2125 25.3125 25.624999999999996 88-89 23.400000000000002 26.650000000000002 24.587500000000002 25.362499999999997 90-91 23.8625 26.25 24.4875 25.4 92-93 23.0 25.8 25.25 25.95 94-95 23.275000000000002 25.474999999999998 25.8 25.45 96-97 23.375 26.35 24.712500000000002 25.5625 98-99 23.733900212579716 25.78466925096911 24.884331624359135 25.597098912092036 100-101 23.849999999999998 25.95 24.775 25.424999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 1.0 27 2.0 28 4.0 29 5.5 30 6.5 31 10.0 32 14.0 33 16.5 34 26.5 35 39.0 36 58.5 37 75.0 38 100.0 39 111.0 40 119.0 41 147.0 42 164.0 43 184.0 44 192.0 45 204.5 46 204.5 47 203.5 48 200.0 49 177.5 50 171.5 51 161.5 52 150.0 53 133.5 54 124.0 55 114.5 56 98.0 57 87.5 58 79.0 59 68.5 60 67.0 61 68.0 62 56.5 63 53.0 64 47.0 65 44.0 66 50.5 67 43.0 68 29.0 69 25.5 70 18.5 71 14.0 72 11.5 73 4.0 74 5.0 75 5.5 76 2.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.249999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0375 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2125 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3689620 spots for SRR3311774.sra Written 3689620 spots for SRR3311774.sra Read 3689620 spots for SRR3311774.sra Written 3689620 spots for SRR3311774.sra Read 3689620 spots for SRR3311774.sra Written 3689620 spots for SRR3311774.sra Read 3689620 spots for SRR3311774.sra Written 3689620 spots for SRR3311774.sra Read 3689620 spots for SRR3311774.sra Written 3689620 spots for SRR3311774.sra Read 3689624 spots for SRR3311774.sra Written 3689624 spots for SRR3311774.sra Read 3689620 spots for SRR3311774.sra Written 3689620 spots for SRR3311774.sra Read 3689620 spots for SRR3311774.sra Written 3689620 spots for SRR3311774.sra Read 3689620 spots for SRR3311774.sra Written 3689620 spots for SRR3311774.sra Read 3689620 spots for SRR3311774.sra Written 3689620 spots for SRR3311774.sra Read 3689620 spots for SRR3311774.sra Written 3689620 spots for SRR3311774.sra Read 3689620 spots for SRR3311774.sra Written 3689620 spots for SRR3311774.sra Read 3689620 spots for SRR3311774.sra Written 3689620 spots for SRR3311774.sra Read 3689620 spots for SRR3311774.sra Written 3689620 spots for SRR3311774.sra Read 3689620 spots for SRR3311774.sra Written 3689620 spots for SRR3311774.sra Read 3689620 spots for SRR3311774.sra Written 3689620 spots for SRR3311774.sra Read 3689620 spots for SRR3311774.sra Written 3689620 spots for SRR3311774.sra Read 3689620 spots for SRR3311774.sra Written 3689620 spots for SRR3311774.sra Read 3689620 spots for SRR3311774.sra Written 3689620 spots for SRR3311774.sra Read 3689620 spots for SRR3311774.sra Written 3689620 spots for SRR3311774.sra SRR ids: ['SRR3311774.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xztyz6pr SRR3311774.sra spots: 73792404 blocks: [[1, 3689620], [3689621, 7379240], [7379241, 11068860], [11068861, 14758480], [14758481, 18448100], [18448101, 22137720], [22137721, 25827340], [25827341, 29516960], [29516961, 33206580], [33206581, 36896200], [36896201, 40585820], [40585821, 44275440], [44275441, 47965060], [47965061, 51654680], [51654681, 55344300], [55344301, 59033920], [59033921, 62723540], [62723541, 66413160], [66413161, 70102780], [70102781, 73792404]] SRR3311774 file size 19913036 SRR3311774 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3311774 SRR3311774_1.fastq Input file: SRR3311774_1.fastq trimmed: SRR3311774-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:07:31 2024 >> started Tue Dec 10 01:08:18 2024 >> done (46.916s) 73792404 reads processed; of these: 1117706 ( 1.51%) short reads filtered out after trimming by size control 261002 ( 0.35%) empty reads filtered out after trimming by size control 72413696 (98.13%) reads available; of these: 9589628 (13.24%) trimmed reads available after processing 62824068 (86.76%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 29210 0.04% 19 26862 0.04% 20 25269 0.03% 21 24177 0.03% 22 23445 0.03% 23 22472 0.03% 24 21873 0.03% 25 21096 0.03% 26 20635 0.03% 27 20038 0.03% 28 19651 0.03% 29 19179 0.03% 30 19482 0.03% 31 18978 0.03% 32 18798 0.03% 33 18748 0.03% 34 18626 0.03% 35 18414 0.03% 36 18509 0.03% 37 18957 0.03% 38 18989 0.03% 39 18644 0.03% 40 18956 0.03% 41 18690 0.03% 42 18789 0.03% 43 18707 0.03% 44 18834 0.03% 45 19046 0.03% 46 18866 0.03% 47 19174 0.03% 48 19194 0.03% 49 19706 0.03% 50 19246 0.03% 51 19812 0.03% 52 20571 0.03% 53 20861 0.03% 54 20987 0.03% 55 21738 0.03% 56 22220 0.03% 57 22482 0.03% 58 23314 0.03% 59 23739 0.03% 60 23609 0.03% 61 25200 0.03% 62 25973 0.04% 63 26725 0.04% 64 27292 0.04% 65 27606 0.04% 66 28733 0.04% 67 30670 0.04% 68 31617 0.04% 69 32770 0.05% 70 28821 0.04% 71 30446 0.04% 72 30842 0.04% 73 32276 0.04% 74 33167 0.05% 75 35674 0.05% 76 36963 0.05% 77 38442 0.05% 78 41150 0.06% 79 42793 0.06% 80 45155 0.06% 81 48624 0.07% 82 52216 0.07% 83 54659 0.08% 84 59153 0.08% 85 63953 0.09% 86 69924 0.10% 87 79284 0.11% 88 85457 0.12% 89 95000 0.13% 90 107264 0.15% 91 121473 0.17% 92 139522 0.19% 93 169770 0.23% 94 202611 0.28% 95 263364 0.36% 96 341345 0.47% 97 537622 0.74% 98 679867 0.94% 99 1210994 1.67% 100 3664618 5.06% 101 62824068 86.76% 72413696 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=45.22 fanout-score-rank=4 prefix-density=0.49 prefix-fanout=34.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=24 fanout-score=265.55 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=25.0 sequence=CAGCAGCAGTAC Started job on | Dec 10 01:08:48 Started mapping on | Dec 10 01:08:48 Finished on | Dec 10 01:09:58 Mapping speed, Million of reads per hour | 3724.13 Number of input reads | 72413696 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 70348266 Uniquely mapped reads % | 97.15% Average mapped length | 99.39 Number of splices: Total | 22243875 Number of splices: Annotated (sjdb) | 21481969 Number of splices: GT/AG | 21932159 Number of splices: GC/AG | 264794 Number of splices: AT/AC | 11881 Number of splices: Non-canonical | 35041 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.81 Insertion rate per base | 0.01% Insertion average length | 1.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 926840 % of reads mapped to multiple loci | 1.28% Number of reads mapped to too many loci | 691997 % of reads mapped to too many loci | 0.96% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.53% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1138590 1138590 1138590 N_multimapping 926840 926840 926840 N_noFeature 2366218 68497949 3041180 N_ambiguous 1293299 4673 128867 UnstrandedReadsAssigned:66688749 PositiveStrandReadsAssigned:1845644 NegativeStrandReadsAssigned:67178219 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR3311774 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR3311774-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 72,413,696 reads, 67,218,542 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,272 rounds 52973 SRR3311774.ke.tsv 35125 SRR3311774.se.tsv 88098 total ==> SRR3311774.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 296.999 8.92035 PNS24247 1044 945 83.2048 2.21345 PNS24249 1928 1829 58.8268 0.808563 PNS24246 1044 945 83.2048 2.21345 PNS24248 1044 945 83.2048 2.21345 PNS24244 1471 1372 542.559 9.94135 PNS24243 293 194 0 0 KQK14069 1603 1504 2027.57 33.8907 KQK14071 474 375 192.339 12.8941 ==> SRR3311774.se.tsv <== BRADI_1g14170v3 2469 BRADI_1g53295v3 237 BRADI_1g59795v3 794 BRADI_1g07683v3 0 BRADI_1g00485v3 340 BRADI_1g20270v3 2648 BRADI_1g74790v3 2249 BRADI_1g09890v3 0 BRADI_1g77505v3 438 BRADI_1g48960v3 1 SRR3311774 completed mapping pipeline successfully