Starting /dee2/code/volunteer_pipeline.sh SRR3311775 current disk space = 1523828469760 free memory = 1601585220 SRR3311775 SRAfilesize 99764f151d669116711ee2375714a840 SRR3311775.sra SRR3311775.sra file validated SRR3311775 is single end SRR3311775 is conventional basespace SRR3311775 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3311775_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 53 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9925 34.0 31.0 34.0 27.0 34.0 2 30.925 34.0 31.0 34.0 27.0 34.0 3 31.20725 34.0 31.0 34.0 27.0 34.0 4 34.6595 37.0 35.0 37.0 31.0 37.0 5 33.611 37.0 35.0 37.0 28.0 37.0 6 33.74575 37.0 35.0 37.0 28.0 37.0 7 34.0185 37.0 35.0 37.0 30.0 37.0 8 33.83825 37.0 35.0 37.0 30.0 37.0 9 35.21175 39.0 37.0 39.0 29.0 39.0 10-11 35.24575 39.0 37.0 39.0 27.5 39.0 12-13 35.211375000000004 39.0 37.0 39.0 28.0 39.0 14-15 36.403875 40.0 37.0 41.0 27.0 41.0 16-17 36.372125 40.0 37.0 41.0 28.5 41.0 18-19 36.307625 40.0 37.0 41.0 29.0 41.0 20-21 36.152874999999995 40.0 37.0 41.0 27.0 41.0 22-23 35.939499999999995 40.0 37.0 41.0 26.5 41.0 24-25 35.795375 40.0 36.0 41.0 27.0 41.0 26-27 35.543875 40.0 36.0 41.0 25.0 41.0 28-29 35.1235 40.0 35.5 41.0 21.5 41.0 30-31 35.039500000000004 40.0 35.0 41.0 23.5 41.0 32-33 34.804125 40.0 35.0 41.0 20.5 41.0 34-35 34.50975 39.0 34.0 41.0 19.5 41.0 36-37 34.223 39.0 34.5 41.0 15.0 41.0 38-39 33.814 39.0 33.5 41.0 7.0 41.0 40-41 33.570499999999996 39.0 33.0 41.0 7.0 41.0 42-43 33.161 38.5 33.0 41.0 5.0 41.0 44-45 33.354375000000005 38.0 33.0 41.0 8.0 41.0 46-47 33.297375 38.0 33.0 41.0 7.0 41.0 48-49 33.11625 38.0 33.0 40.5 2.0 41.0 50-51 32.888125 38.0 33.0 40.0 2.0 41.0 52-53 32.73725 37.0 33.0 40.0 2.0 41.0 54-55 32.32725 36.5 32.5 40.0 2.0 41.0 56-57 31.899 36.0 32.0 40.0 2.0 41.0 58-59 31.636875 35.0 31.5 40.0 2.0 41.0 60-61 31.1035 35.0 31.0 39.5 2.0 41.0 62-63 30.807000000000002 35.0 30.5 39.0 2.0 41.0 64-65 30.218375 35.0 30.0 39.0 2.0 41.0 66-67 29.915125 35.0 29.0 38.0 2.0 40.5 68-69 29.712 35.0 29.5 37.0 2.0 40.0 70-71 29.462875 35.0 29.0 37.0 2.0 39.5 72-73 29.229750000000003 35.0 29.0 36.5 2.0 39.0 74-75 28.50175 35.0 28.5 36.0 2.0 38.5 76-77 26.8575 32.5 25.0 34.5 2.0 36.5 78-79 27.780749999999998 34.0 26.5 35.0 2.0 37.0 80-81 27.857 34.0 27.0 35.0 2.0 36.5 82-83 27.616500000000002 34.0 27.0 35.0 2.0 36.0 84-85 27.525375 34.0 27.0 35.0 2.0 36.0 86-87 27.256375 34.0 27.0 35.0 2.0 35.5 88-89 26.84075 34.0 24.5 35.0 2.0 35.0 90-91 26.589875 34.0 24.0 35.0 2.0 35.0 92-93 26.24975 34.0 23.5 35.0 2.0 35.0 94-95 26.017 34.0 21.5 35.0 2.0 35.0 96-97 25.625875 33.5 19.5 35.0 2.0 35.0 98-99 25.3125 33.0 16.5 35.0 2.0 35.0 100-101 24.52675 32.5 2.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 132.0 3 43.0 4 29.0 5 13.0 6 24.0 7 18.0 8 20.0 9 21.0 10 27.0 11 27.0 12 28.0 13 25.0 14 26.0 15 22.0 16 28.0 17 27.0 18 18.0 19 24.0 20 26.0 21 24.0 22 26.0 23 34.0 24 38.0 25 39.0 26 42.0 27 57.0 28 63.0 29 64.0 30 83.0 31 99.0 32 130.0 33 157.0 34 230.0 35 354.0 36 465.0 37 676.0 38 747.0 39 94.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.24906132665832 5.632040050062578 7.859824780976219 47.25907384230288 2 27.29113924050633 6.70886075949367 32.40506329113924 33.594936708860764 3 24.925 9.3 19.425 46.35 4 33.35 13.025 18.525 35.099999999999994 5 34.47745901639344 18.084016393442624 22.15676229508197 25.28176229508197 6 29.675 24.975 21.975 23.375 7 24.275 23.225 35.0 17.5 8 24.257674886763965 23.024660291897334 29.71816809260191 22.99949672873679 9 21.958006577283076 19.7318492284341 35.46673412598027 22.843410068302557 10-11 25.587500000000002 28.3875 25.324999999999996 20.7 12-13 25.650000000000002 23.1125 26.6125 24.625 14-15 25.35 23.775 26.2875 24.587500000000002 16-17 27.1125 23.9875 24.4125 24.4875 18-19 26.1125 22.9625 24.275 26.650000000000002 20-21 25.6125 23.625 24.212500000000002 26.55 22-23 26.85 25.1875 23.025000000000002 24.9375 24-25 25.5625 23.075000000000003 24.6125 26.75 26-27 25.7 23.6875 24.3125 26.3 28-29 26.96558653604622 23.08465209746295 23.61215774930922 26.337603617181614 30-31 26.5375 23.1375 23.7125 26.6125 32-33 25.32581453634085 22.481203007518797 25.701754385964914 26.49122807017544 34-35 26.075 23.7125 22.55 27.6625 36-37 25.377263581488936 23.02565392354125 24.258048289738433 27.33903420523139 38-39 26.464980297445024 22.918520401677895 24.10067370026694 26.515825600610142 40-41 26.10731460389775 23.43710453049861 23.55099974689952 26.904581118704122 42-43 26.169293340111842 22.635993899339095 24.05948144382308 27.135231316725978 44-45 25.85 23.2375 24.099999999999998 26.8125 46-47 26.950000000000003 22.5625 24.425 26.0625 48-49 26.3125 23.525 23.95 26.2125 50-51 25.4625 23.7625 24.0625 26.7125 52-53 27.575 23.7875 23.2875 25.35 54-55 26.60216134707213 22.731842171399848 23.98843930635838 26.677557175169643 56-57 26.100113478754256 24.082713403101753 23.767494641281047 26.04967847686294 58-59 26.256913021618907 23.931623931623932 23.629964806435392 26.181498240321773 60-61 25.974190283400812 24.03846153846154 22.861842105263158 27.125506072874494 62-63 25.91567023285085 23.77595972309629 23.989930774071745 26.31843926998112 64-65 26.16491981310772 24.13183482762975 23.311024119206973 26.392221240055562 66-67 26.670894102726695 23.043753963221306 23.665187064045657 26.62016487000634 68-69 25.680443548387093 23.588709677419356 23.475302419354836 27.25554435483871 70-71 27.631578947368425 24.172932330827066 22.94486215538847 25.25062656641604 72-73 27.252167357708256 23.709008669430833 22.754114838547558 26.284709134313356 74-75 26.35629088110812 23.329485699628062 23.842503526997564 26.471719892266254 76-77 27.03282828282828 23.333333333333332 23.11868686868687 26.515151515151516 78-79 26.5375 23.35 23.1 27.0125 80-81 26.34738026760035 23.35875953482556 24.234087782918596 26.059772414655498 82-83 26.424546023794615 23.782091421415153 22.993112085159677 26.80025046963056 84-85 25.53618462310297 23.090430201931518 24.219239934779882 27.154145240185628 86-87 26.224999999999998 23.7125 23.674999999999997 26.387500000000003 88-89 26.21751198586929 24.060055513499872 23.530153923795105 26.192278576835733 90-91 26.400000000000002 24.025 22.825 26.75 92-93 26.465808226028255 23.97799724965621 23.72796599574947 25.828228528566072 94-95 26.832936458202784 22.91013911517734 23.33625767640055 26.920666750219326 96-97 26.431883694698584 24.125830304549442 22.64694823912771 26.795337761624268 98-99 26.900000000000002 23.2125 23.6375 26.25 100-101 27.800000000000004 24.474999999999998 21.625 26.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.5 26 1.5 27 2.0 28 3.5 29 3.0 30 3.0 31 5.0 32 8.0 33 7.5 34 10.5 35 19.5 36 29.5 37 38.5 38 53.5 39 69.5 40 87.5 41 109.5 42 124.5 43 143.5 44 149.0 45 159.5 46 170.5 47 169.0 48 163.5 49 146.5 50 143.5 51 146.5 52 137.0 53 124.5 54 112.0 55 98.5 56 106.0 57 110.5 58 97.0 59 87.0 60 84.0 61 87.5 62 94.0 63 86.5 64 81.5 65 81.5 66 78.5 67 79.5 68 71.5 69 70.0 70 64.0 71 55.0 72 52.5 73 44.0 74 30.0 75 17.5 76 15.0 77 14.5 78 12.5 79 8.5 80 5.5 81 6.0 82 4.0 83 2.0 84 2.5 85 2.5 86 1.5 87 1.0 88 0.0 89 0.0 90 1.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 1.25 3 0.0 4 0.0 5 2.4 6 0.0 7 0.0 8 0.65 9 1.175 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.475 30-31 0.0 32-33 0.25 34-35 0.0 36-37 0.6 38-39 1.6625 40-41 1.225 42-43 1.6500000000000001 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.525 56-57 0.8625 58-59 0.5499999999999999 60-61 1.2 62-63 0.6875 64-65 1.0125 66-67 1.4375 68-69 0.8 70-71 0.25 72-73 0.5125000000000001 74-75 2.5375 76-77 1.0 78-79 0.0 80-81 0.0375 82-83 0.1875 84-85 0.3375 86-87 0.0 88-89 0.9249999999999999 90-91 0.0 92-93 0.0125 94-95 0.2625 96-97 0.2625 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19273461150352 98.3 2 0.7315842583249244 1.4500000000000002 3 0.050454086781029264 0.15 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.16249999999999998 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.25 0.025 0.0 0.0 0.0 72-73 0.36250000000000004 0.025 0.0 0.0 0.0 74-75 0.6375 0.025 0.0 0.0 0.0 76-77 0.8375 0.025 0.0 0.0 0.0 78-79 1.1 0.025 0.0 0.0 0.0 80-81 1.3125 0.025 0.0 0.0 0.0 82-83 1.7375 0.025 0.0 0.0 0.0 84-85 1.9625 0.025 0.0 0.0 0.0 86-87 2.475 0.025 0.0 0.0 0.0 88-89 3.0875 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1795989 spots for SRR3311775.sra Written 1795989 spots for SRR3311775.sra Read 1795989 spots for SRR3311775.sra Written 1795989 spots for SRR3311775.sra Read 1795989 spots for SRR3311775.sra Written 1795989 spots for SRR3311775.sra Read 1795989 spots for SRR3311775.sra Written 1795989 spots for SRR3311775.sra Read 1795989 spots for SRR3311775.sra Written 1795989 spots for SRR3311775.sra Read 1795989 spots for SRR3311775.sra Written 1795989 spots for SRR3311775.sra Read 1795989 spots for SRR3311775.sra Written 1795989 spots for SRR3311775.sra Read 1795989 spots for SRR3311775.sra Written 1795989 spots for SRR3311775.sra Read 1795989 spots for SRR3311775.sra Written 1795989 spots for SRR3311775.sra Read 1795989 spots for SRR3311775.sra Written 1795989 spots for SRR3311775.sra Read 1795989 spots for SRR3311775.sra Written 1795989 spots for SRR3311775.sra Read 1795989 spots for SRR3311775.sra Written 1795989 spots for SRR3311775.sra Read 1795989 spots for SRR3311775.sra Written 1795989 spots for SRR3311775.sra Read 1795989 spots for SRR3311775.sra Written 1795989 spots for SRR3311775.sra Read 1795989 spots for SRR3311775.sra Written 1795989 spots for SRR3311775.sra Read 1796006 spots for SRR3311775.sra Written 1796006 spots for SRR3311775.sra Read 1795989 spots for SRR3311775.sra Written 1795989 spots for SRR3311775.sra Read 1795989 spots for SRR3311775.sra Written 1795989 spots for SRR3311775.sra Read 1795989 spots for SRR3311775.sra Written 1795989 spots for SRR3311775.sra Read 1795989 spots for SRR3311775.sra Written 1795989 spots for SRR3311775.sra SRR ids: ['SRR3311775.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g8745_bj SRR3311775.sra spots: 35919797 blocks: [[1, 1795989], [1795990, 3591978], [3591979, 5387967], [5387968, 7183956], [7183957, 8979945], [8979946, 10775934], [10775935, 12571923], [12571924, 14367912], [14367913, 16163901], [16163902, 17959890], [17959891, 19755879], [19755880, 21551868], [21551869, 23347857], [23347858, 25143846], [25143847, 26939835], [26939836, 28735824], [28735825, 30531813], [30531814, 32327802], [32327803, 34123791], [34123792, 35919797]] SRR3311775 file size 9687927 SRR3311775 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3311775 SRR3311775_1.fastq Input file: SRR3311775_1.fastq trimmed: SRR3311775-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:01:23 2024 >> started Tue Dec 10 01:01:42 2024 >> done (19.509s) 35919797 reads processed; of these: 1062077 ( 2.96%) short reads filtered out after trimming by size control 1161149 ( 3.23%) empty reads filtered out after trimming by size control 33696571 (93.81%) reads available; of these: 4877711 (14.48%) trimmed reads available after processing 28818860 (85.52%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 36395 0.11% 19 35866 0.11% 20 35406 0.11% 21 34813 0.10% 22 35780 0.11% 23 35191 0.10% 24 35619 0.11% 25 37258 0.11% 26 37276 0.11% 27 38035 0.11% 28 38615 0.11% 29 38886 0.12% 30 39447 0.12% 31 40076 0.12% 32 40164 0.12% 33 39734 0.12% 34 40854 0.12% 35 39616 0.12% 36 37669 0.11% 37 39336 0.12% 38 39747 0.12% 39 40652 0.12% 40 41920 0.12% 41 42777 0.13% 42 42001 0.12% 43 43219 0.13% 44 42819 0.13% 45 43292 0.13% 46 44436 0.13% 47 43432 0.13% 48 43337 0.13% 49 42777 0.13% 50 41342 0.12% 51 42385 0.13% 52 43277 0.13% 53 44660 0.13% 54 45075 0.13% 55 45678 0.14% 56 45660 0.14% 57 46836 0.14% 58 47480 0.14% 59 46942 0.14% 60 48710 0.14% 61 50129 0.15% 62 50715 0.15% 63 52316 0.16% 64 53908 0.16% 65 55340 0.16% 66 56795 0.17% 67 59333 0.18% 68 60934 0.18% 69 63781 0.19% 70 49289 0.15% 71 49793 0.15% 72 51184 0.15% 73 53873 0.16% 74 55510 0.16% 75 60574 0.18% 76 23661 0.07% 77 26705 0.08% 78 34863 0.10% 79 40258 0.12% 80 45141 0.13% 81 48282 0.14% 82 51031 0.15% 83 53320 0.16% 84 55023 0.16% 85 59635 0.18% 86 62413 0.19% 87 66926 0.20% 88 71789 0.21% 89 75508 0.22% 90 81397 0.24% 91 89223 0.26% 92 97320 0.29% 93 107160 0.32% 94 123739 0.37% 95 137717 0.41% 96 159646 0.47% 97 180851 0.54% 98 193975 0.58% 99 195490 0.58% 100 208674 0.62% 101 28818860 85.52% 33696571 reads passed initial QC criterion=sequence-density sequence-density=2.68 sequence-density-rank=1 fanout-score=62.39 fanout-score-rank=3 prefix-density=3.65 prefix-fanout=45.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=8 fanout-score=172.77 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=22.5 sequence=CGGCGGCGGCGG Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGT -o SRR3311775 - Input file: STDIN trimmed: SRR3311775-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 01:03:05 2024 >> started Tue Dec 10 01:03:20 2024 >> done (15.040s) 11232190 reads processed; of these: 579 ( 0.01%) short reads filtered out after trimming by size control 4 ( 0.00%) empty reads filtered out after trimming by size control 11231607 (99.99%) reads available; of these: 1073179 ( 9.55%) trimmed reads available after processing 10158428 (90.45%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12195 0.11% 19 11905 0.11% 20 11764 0.10% 21 11764 0.10% 22 11889 0.11% 23 11823 0.11% 24 11984 0.11% 25 12461 0.11% 26 12359 0.11% 27 12683 0.11% 28 12896 0.11% 29 13021 0.12% 30 13261 0.12% 31 13436 0.12% 32 13391 0.12% 33 13350 0.12% 34 13611 0.12% 35 13184 0.12% 36 12567 0.11% 37 13126 0.12% 38 13163 0.12% 39 13608 0.12% 40 13998 0.12% 41 14233 0.13% 42 13994 0.12% 43 14496 0.13% 44 14279 0.13% 45 14357 0.13% 46 14767 0.13% 47 14294 0.13% 48 14586 0.13% 49 14293 0.13% 50 13800 0.12% 51 14215 0.13% 52 14528 0.13% 53 14923 0.13% 54 15062 0.13% 55 15120 0.13% 56 15425 0.14% 57 15531 0.14% 58 16011 0.14% 59 15743 0.14% 60 16056 0.14% 61 16528 0.15% 62 17154 0.15% 63 17347 0.15% 64 18041 0.16% 65 18484 0.16% 66 18954 0.17% 67 19734 0.18% 68 20027 0.18% 69 21343 0.19% 70 22488 0.20% 71 23244 0.21% 72 24670 0.22% 73 26863 0.24% 74 28386 0.25% 75 30805 0.27% 76 20458 0.18% 77 22318 0.20% 78 25896 0.23% 79 29298 0.26% 80 32134 0.29% 81 34946 0.31% 82 38148 0.34% 83 40805 0.36% 84 44191 0.39% 85 48506 0.43% 86 51768 0.46% 87 54925 0.49% 88 59893 0.53% 89 62074 0.55% 90 65911 0.59% 91 70973 0.63% 92 76150 0.68% 93 82741 0.74% 94 92904 0.83% 95 101556 0.90% 96 118999 1.06% 97 153687 1.37% 98 285686 2.54% 99 61708 0.55% 100 66286 0.59% 101 8576426 76.36% criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=16.22 fanout-score-rank=9 prefix-density=0.61 prefix-fanout=6.5 sequence=TTGTTGTTGCTGCCACTGGCGTAGCCGTTGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=14 fanout-score=181.85 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=21.5 sequence=GGCGGCGGCGGA Started job on | Dec 10 01:03:50 Started mapping on | Dec 10 01:03:50 Finished on | Dec 10 01:04:21 Mapping speed, Million of reads per hour | 3913.08 Number of input reads | 33695988 Average input read length | 96 UNIQUE READS: Uniquely mapped reads number | 32895896 Uniquely mapped reads % | 97.63% Average mapped length | 95.66 Number of splices: Total | 9819016 Number of splices: Annotated (sjdb) | 9380657 Number of splices: GT/AG | 9678397 Number of splices: GC/AG | 118440 Number of splices: AT/AC | 5585 Number of splices: Non-canonical | 16594 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.49 Insertion rate per base | 0.00% Insertion average length | 1.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 491538 % of reads mapped to multiple loci | 1.46% Number of reads mapped to too many loci | 188166 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.33% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 308554 308554 308554 N_multimapping 491538 491538 491538 N_noFeature 934151 32118435 1267101 N_ambiguous 498993 2848 60500 UnstrandedReadsAssigned:31462752 PositiveStrandReadsAssigned:774613 NegativeStrandReadsAssigned:31568295 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=98 echo kmer=93 SRR3311775 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR3311775-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,695,988 reads, 31,167,142 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,294 rounds 52973 SRR3311775.ke.tsv 35125 SRR3311775.se.tsv 88098 total ==> SRR3311775.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 59.6561 3.72773 PNS24247 1044 945 52.6594 2.91447 PNS24249 1928 1829 239.244 6.84136 PNS24246 1044 945 52.6594 2.91447 PNS24248 1044 945 52.6594 2.91447 PNS24244 1471 1372 26.1219 0.995788 PNS24243 293 194 1 0.269596 KQK14069 1603 1504 999.85 34.7698 KQK14071 474 375 484.41 67.5612 ==> SRR3311775.se.tsv <== BRADI_1g14170v3 1704 BRADI_1g53295v3 142 BRADI_1g59795v3 229 BRADI_1g07683v3 1 BRADI_1g00485v3 147 BRADI_1g20270v3 1480 BRADI_1g74790v3 1202 BRADI_1g09890v3 1 BRADI_1g77505v3 142 BRADI_1g48960v3 0 SRR3311775 completed mapping pipeline successfully