Starting /dee2/code/volunteer_pipeline.sh SRR3311776 current disk space = 1523828469760 free memory = 1601583856 SRR3311776 SRAfilesize d1d0c235e59706b9a374012f3ca1e917 SRR3311776.sra SRR3311776.sra file validated SRR3311776 is single end SRR3311776 is conventional basespace SRR3311776 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3311776_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.73775 31.0 29.0 34.0 16.0 34.0 2 29.36625 31.0 30.0 34.0 24.0 34.0 3 29.664 31.0 30.0 34.0 26.0 34.0 4 33.21875 37.0 35.0 37.0 27.0 37.0 5 32.33225 37.0 33.0 37.0 22.0 37.0 6 31.9475 35.0 32.0 37.0 17.0 37.0 7 31.3665 35.0 32.0 37.0 17.0 37.0 8 31.63525 35.0 32.0 37.0 17.0 37.0 9 32.88725 37.0 33.0 39.0 16.0 39.0 10-11 33.148375 38.0 33.0 39.0 17.0 39.0 12-13 32.956875 38.0 33.0 39.0 16.5 39.0 14-15 33.802125000000004 39.0 33.0 41.0 11.5 41.0 16-17 33.78575 39.0 33.0 41.0 11.0 41.0 18-19 33.741125 39.0 33.5 41.0 10.0 41.0 20-21 33.701 39.0 33.0 41.0 10.0 41.0 22-23 33.5655 39.0 33.0 41.0 9.0 41.0 24-25 33.535875000000004 39.0 33.0 41.0 9.0 41.0 26-27 33.44175 39.0 33.0 41.0 8.0 41.0 28-29 33.15325 38.5 32.5 41.0 5.0 41.0 30-31 33.04375 38.0 32.5 40.0 2.0 41.0 32-33 32.951625 38.5 32.5 40.5 2.0 41.0 34-35 32.634125 38.0 31.5 40.0 2.0 41.0 36-37 32.689875 38.0 32.0 40.0 2.0 41.0 38-39 32.54075 38.0 32.0 40.0 2.0 41.0 40-41 32.277874999999995 38.0 31.0 40.0 2.0 41.0 42-43 32.15925 38.0 31.0 40.0 2.0 41.0 44-45 32.062 38.0 31.0 40.0 2.0 41.0 46-47 31.566499999999998 37.0 30.0 40.0 2.0 41.0 48-49 31.343 37.0 30.0 40.0 2.0 41.0 50-51 31.367375 37.0 30.5 40.0 2.0 41.0 52-53 31.389000000000003 37.0 31.0 40.0 2.0 41.0 54-55 30.962625000000003 36.0 29.5 40.0 2.0 41.0 56-57 30.5855 35.5 29.0 40.0 2.0 41.0 58-59 30.346625 35.0 28.5 39.0 2.0 41.0 60-61 30.216875 35.0 28.0 39.0 2.0 41.0 62-63 30.049 35.0 28.5 39.0 2.0 40.5 64-65 29.474874999999997 35.0 27.5 38.0 2.0 40.0 66-67 29.3415 35.0 28.0 38.0 2.0 40.0 68-69 29.179 35.0 28.0 37.0 2.0 40.0 70-71 28.888875 34.5 28.0 37.0 2.0 39.0 72-73 28.481625 34.0 27.0 36.0 2.0 39.0 74-75 28.328875 34.0 27.5 36.0 2.0 38.5 76-77 26.794125 32.5 24.5 34.5 2.0 36.0 78-79 27.555 34.0 26.0 35.0 2.0 37.0 80-81 27.627125 34.0 26.5 35.0 2.0 36.0 82-83 27.46475 34.0 26.5 35.0 2.0 36.0 84-85 27.3005 34.0 26.0 35.0 2.0 36.0 86-87 27.106749999999998 34.0 26.0 35.0 2.0 35.0 88-89 26.848 34.0 26.0 35.0 2.0 35.0 90-91 26.705375 34.0 25.0 35.0 2.0 35.0 92-93 26.5655 34.0 25.0 35.0 2.0 35.0 94-95 26.4605 34.0 25.0 35.0 2.0 35.0 96-97 26.125125 33.0 24.5 35.0 2.0 35.0 98-99 25.86225 33.0 23.5 35.0 2.0 35.0 100-101 25.311625 32.5 20.5 34.5 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2316 1 0.0 2316 2 0.0 2316 3 0.0 2316 4 0.0 2316 5 0.0 2316 6 0.0 2316 7 0.0 2316 8 0.0 2316 9 0.0 2316 10-11 0.0 2316 12-13 0.0 2316 14-15 0.0 2316 16-17 0.0 2316 18-19 0.0 2316 20-21 0.0 2316 22-23 0.0 2316 24-25 0.0 2316 26-27 0.0 2316 28-29 0.0 2316 30-31 0.0 2316 32-33 0.0 2316 34-35 0.0 2316 36-37 0.0 2316 38-39 0.0 2316 40-41 0.0 2316 42-43 0.0 2316 44-45 0.0 2316 46-47 0.0 2316 48-49 0.0 2316 50-51 0.0 2316 52-53 0.0 2316 54-55 0.0 2316 56-57 0.0 2316 58-59 0.0 2316 60-61 0.0 2316 62-63 0.0 2316 64-65 0.0 2316 66-67 0.0 2316 68-69 0.0 2316 70-71 0.0 2316 72-73 0.0 2316 74-75 0.0 2316 76-77 0.0 2316 78-79 0.0 2316 80-81 0.0 2316 82-83 0.0 2316 84-85 0.0 2316 86-87 0.0 2316 88-89 0.0 2316 90-91 0.0 2316 92-93 0.0 2316 94-95 0.0 2316 96-97 0.0 2316 98-99 0.0 2316 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 237.0 3 68.0 4 33.0 5 24.0 6 19.0 7 19.0 8 20.0 9 26.0 10 19.0 11 23.0 12 28.0 13 20.0 14 19.0 15 19.0 16 23.0 17 16.0 18 14.0 19 16.0 20 15.0 21 20.0 22 26.0 23 32.0 24 32.0 25 49.0 26 45.0 27 62.0 28 87.0 29 81.0 30 79.0 31 108.0 32 137.0 33 189.0 34 263.0 35 350.0 36 475.0 37 677.0 38 593.0 39 37.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.46873436718359 7.078539269634818 6.003001500750376 49.44972486243122 2 23.849999999999998 7.675 33.425 35.05 3 21.025 10.85 22.675 45.45 4 28.799999999999997 15.575 20.075000000000003 35.55 5 32.4 20.349999999999998 22.25 25.0 6 27.05 26.05 23.674999999999997 23.225 7 20.674999999999997 24.2 37.175000000000004 17.95 8 21.125 23.599999999999998 33.35 21.925 9 20.325 20.525 36.025 23.125 10-11 23.32791598949869 30.428803600450056 25.66570821352669 20.577572196524567 12-13 23.5625 24.725 28.5875 23.125 14-15 23.1807951987997 25.09377344336084 27.394348587146787 24.33108277069267 16-17 24.046517444041516 25.747155183193698 25.659622358384393 24.546705014380393 18-19 24.081020255063766 24.90622655663916 25.381345336334082 25.63140785196299 20-21 24.306076519129782 24.656164041010253 25.543885971492873 25.49387346836709 22-23 23.962500000000002 25.074999999999996 25.5125 25.45 24-25 23.971489308490685 24.934350381393024 25.672127047642867 25.422033262473427 26-27 23.567675756817614 25.469101826369776 25.781836377282964 25.181386039529645 28-29 24.099999999999998 24.2875 25.587500000000002 26.025 30-31 23.605901475368842 24.44361090272568 25.568892223055762 26.38159539884971 32-33 22.564102564102566 25.791119449656037 25.428392745465917 26.216385240775487 34-35 23.599999999999998 25.337500000000002 25.387500000000003 25.674999999999997 36-37 24.462500000000002 24.4875 24.4375 26.6125 38-39 22.470926597474055 25.24696761285482 26.384894335375762 25.89721145429536 40-41 23.3375 25.387500000000003 24.675 26.6 42-43 23.7375 24.0375 26.275 25.95 44-45 23.3625 25.124999999999996 26.0625 25.45 46-47 24.6625 24.762500000000003 24.887500000000003 25.687500000000004 48-49 24.212500000000002 24.887500000000003 25.25 25.650000000000002 50-51 23.8875 24.675 25.662499999999998 25.775 52-53 24.27160185069401 24.84681755658372 25.422033262473427 25.459547330248846 54-55 24.1125 24.3625 25.8 25.724999999999998 56-57 23.7375 25.4875 25.7 25.074999999999996 58-59 24.1875 25.0 25.174999999999997 25.637500000000003 60-61 24.9375 25.0125 24.4125 25.637500000000003 62-63 23.325000000000003 25.025 26.1 25.55 64-65 24.474999999999998 24.75 25.1875 25.587500000000002 66-67 23.64045505688211 24.54056757094637 25.278159769971246 26.540817602200274 68-69 23.150000000000002 25.137500000000003 25.387500000000003 26.325 70-71 24.712356178089045 25.56278139069535 24.84992496248124 24.874937468734366 72-73 24.587500000000002 24.9125 25.324999999999996 25.174999999999997 74-75 23.5625 25.0 25.825 25.6125 76-77 24.70926597474053 25.334500437664126 25.35950981618107 24.59672377141428 78-79 24.075 24.762500000000003 24.8625 26.3 80-81 23.6625 24.9375 25.374999999999996 26.025 82-83 24.527829893683553 24.815509693558475 24.452782989368355 26.20387742338962 84-85 24.359134675503313 24.296611229210953 25.347005126922596 25.997248968363134 86-87 23.605901475368842 26.019004751187797 24.656164041010253 25.71892973243311 88-89 25.3 24.75 24.3875 25.5625 90-91 24.424712356178087 25.50025012506253 24.262131065532767 25.812906453226613 92-93 25.143785946486624 25.18129532383096 24.63115778944736 25.04376094023506 94-95 24.821808178066775 25.372014505439537 24.90934100287608 24.896836313617605 96-97 24.484181568088033 25.38451919469801 24.19657371514318 25.934725522070778 98-99 23.6368184092046 24.749874937468736 26.450725362681343 25.162581290645324 100-101 25.440680085010626 25.153144143017876 24.778097262157768 24.62807850981373 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 0.5 28 1.5 29 2.5 30 5.0 31 10.0 32 11.5 33 11.5 34 15.5 35 31.0 36 41.0 37 41.0 38 60.5 39 84.0 40 90.5 41 120.5 42 158.0 43 183.0 44 181.5 45 172.0 46 205.0 47 209.0 48 196.0 49 190.0 50 170.0 51 163.0 52 165.5 53 145.0 54 130.5 55 118.5 56 104.0 57 105.5 58 89.0 59 71.5 60 80.0 61 91.5 62 78.0 63 66.5 64 65.5 65 65.5 66 64.5 67 49.0 68 45.0 69 41.5 70 22.5 71 16.0 72 14.5 73 7.5 74 2.5 75 1.5 76 0.5 77 0.5 78 1.0 79 1.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0125 12-13 0.0 14-15 0.025 16-17 0.0375 18-19 0.025 20-21 0.025 22-23 0.0 24-25 0.0375 26-27 0.075 28-29 0.0 30-31 0.025 32-33 0.0625 34-35 0.0 36-37 0.0 38-39 0.0375 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0375 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0125 68-69 0.0 70-71 0.05 72-73 0.0 74-75 0.0 76-77 0.0375 78-79 0.0 80-81 0.0 82-83 0.0625 84-85 0.0375 86-87 0.025 88-89 0.0 90-91 0.05 92-93 0.025 94-95 0.0375 96-97 0.0375 98-99 0.05 100-101 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14184755174155 98.2 2 0.7571933366986371 1.5 3 0.10095911155981827 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.037500000000000006 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.0625 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.16249999999999998 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.1875 0.0 0.0 0.0 0.0 60-61 0.21250000000000002 0.0 0.0 0.0 0.0 62-63 0.2625 0.0 0.0 0.0 0.0 64-65 0.3375 0.0 0.0 0.0 0.0 66-67 0.3875 0.0 0.0 0.0 0.0 68-69 0.4 0.0 0.0 0.0 0.0 70-71 0.475 0.0 0.0 0.0 0.0 72-73 0.5875 0.0 0.0 0.0 0.0 74-75 0.75 0.0 0.0 0.0 0.0 76-77 0.9624999999999999 0.0 0.0 0.0 0.0 78-79 1.1625 0.0 0.0 0.0 0.0 80-81 1.375 0.0 0.0 0.0 0.0 82-83 1.775 0.0 0.0 0.0 0.0 84-85 2.2375 0.0 0.0 0.0 0.0 86-87 2.5625 0.0 0.0 0.0 0.0 88-89 2.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1603710 spots for SRR3311776.sra Written 1603710 spots for SRR3311776.sra Read 1603710 spots for SRR3311776.sra Written 1603710 spots for SRR3311776.sra Read 1603710 spots for SRR3311776.sra Written 1603710 spots for SRR3311776.sra Read 1603710 spots for SRR3311776.sra Written 1603710 spots for SRR3311776.sra Read 1603710 spots for SRR3311776.sra Written 1603710 spots for SRR3311776.sra Read 1603718 spots for SRR3311776.sra Written 1603718 spots for SRR3311776.sra Read 1603710 spots for SRR3311776.sra Written 1603710 spots for SRR3311776.sra Read 1603710 spots for SRR3311776.sra Written 1603710 spots for SRR3311776.sra Read 1603710 spots for SRR3311776.sra Written 1603710 spots for SRR3311776.sra Read 1603710 spots for SRR3311776.sra Written 1603710 spots for SRR3311776.sra Read 1603710 spots for SRR3311776.sra Written 1603710 spots for SRR3311776.sra Read 1603710 spots for SRR3311776.sra Written 1603710 spots for SRR3311776.sra Read 1603710 spots for SRR3311776.sra Written 1603710 spots for SRR3311776.sra Read 1603710 spots for SRR3311776.sra Written 1603710 spots for SRR3311776.sra Read 1603710 spots for SRR3311776.sra Written 1603710 spots for SRR3311776.sra Read 1603710 spots for SRR3311776.sra Written 1603710 spots for SRR3311776.sra Read 1603710 spots for SRR3311776.sra Written 1603710 spots for SRR3311776.sra Read 1603710 spots for SRR3311776.sra Written 1603710 spots for SRR3311776.sra Read 1603710 spots for SRR3311776.sra Written 1603710 spots for SRR3311776.sra Read 1603710 spots for SRR3311776.sra Written 1603710 spots for SRR3311776.sra SRR ids: ['SRR3311776.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z13wsl6q SRR3311776.sra spots: 32074208 blocks: [[1, 1603710], [1603711, 3207420], [3207421, 4811130], [4811131, 6414840], [6414841, 8018550], [8018551, 9622260], [9622261, 11225970], [11225971, 12829680], [12829681, 14433390], [14433391, 16037100], [16037101, 17640810], [17640811, 19244520], [19244521, 20848230], [20848231, 22451940], [22451941, 24055650], [24055651, 25659360], [25659361, 27263070], [27263071, 28866780], [28866781, 30470490], [30470491, 32074208]] SRR3311776 file size 8649602 SRR3311776 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3311776 SRR3311776_1.fastq Input file: SRR3311776_1.fastq trimmed: SRR3311776-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:01:06 2024 >> started Tue Dec 10 01:01:23 2024 >> done (17.270s) 32074208 reads processed; of these: 771698 ( 2.41%) short reads filtered out after trimming by size control 858836 ( 2.68%) empty reads filtered out after trimming by size control 30443674 (94.92%) reads available; of these: 3806336 (12.50%) trimmed reads available after processing 26637338 (87.50%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 25419 0.08% 19 25038 0.08% 20 24476 0.08% 21 24091 0.08% 22 24584 0.08% 23 24124 0.08% 24 24901 0.08% 25 25509 0.08% 26 26021 0.09% 27 26575 0.09% 28 27168 0.09% 29 27324 0.09% 30 28155 0.09% 31 28758 0.09% 32 28919 0.09% 33 29450 0.10% 34 30494 0.10% 35 29326 0.10% 36 28604 0.09% 37 29960 0.10% 38 29947 0.10% 39 30912 0.10% 40 31367 0.10% 41 32045 0.11% 42 32730 0.11% 43 33316 0.11% 44 33909 0.11% 45 34247 0.11% 46 34691 0.11% 47 34406 0.11% 48 34555 0.11% 49 34413 0.11% 50 32572 0.11% 51 33843 0.11% 52 35108 0.12% 53 36288 0.12% 54 36490 0.12% 55 36799 0.12% 56 36157 0.12% 57 37377 0.12% 58 38113 0.13% 59 38010 0.12% 60 39084 0.13% 61 40046 0.13% 62 40791 0.13% 63 42302 0.14% 64 43035 0.14% 65 44168 0.15% 66 45400 0.15% 67 47075 0.15% 68 48472 0.16% 69 50708 0.17% 70 39567 0.13% 71 40432 0.13% 72 41208 0.14% 73 43217 0.14% 74 44237 0.15% 75 48966 0.16% 76 18875 0.06% 77 21167 0.07% 78 27201 0.09% 79 31966 0.11% 80 34762 0.11% 81 37946 0.12% 82 39363 0.13% 83 41528 0.14% 84 43219 0.14% 85 45917 0.15% 86 48511 0.16% 87 52120 0.17% 88 55795 0.18% 89 59326 0.19% 90 64205 0.21% 91 70516 0.23% 92 76445 0.25% 93 86193 0.28% 94 98037 0.32% 95 109930 0.36% 96 127288 0.42% 97 144475 0.47% 98 155883 0.51% 99 158106 0.52% 100 162663 0.53% 101 26637338 87.50% 30443674 reads passed initial QC criterion=sequence-density sequence-density=2.37 sequence-density-rank=1 fanout-score=58.44 fanout-score-rank=2 prefix-density=3.21 prefix-fanout=43.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=17 fanout-score=125.15 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=8.1 sequence=AAGAGGAGGGTCTTGTCGTTCTTGAGCTTGATGTCGCTGTGCTTCCAGTGGCCGTGGACGGTGTCGTACTTGAACATGTAGGTCATGTACTCGGTGGTGATGAAGGGGTCGTTGACGGCGACGAGCTCGATGTCATCGCTCTGGAGAGCAACCCTGGCGACGAGCCTCCCGATCCTTCCGAAACCGTTGATTCCGATC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGT -o SRR3311776 - Input file: STDIN trimmed: SRR3311776-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 01:02:49 2024 >> started Tue Dec 10 01:03:03 2024 >> done (13.452s) 10147891 reads processed; of these: 420 ( 0.00%) short reads filtered out after trimming by size control 2 ( 0.00%) empty reads filtered out after trimming by size control 10147469 (100.00%) reads available; of these: 850125 ( 8.38%) trimmed reads available after processing 9297344 (91.62%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8397 0.08% 19 8386 0.08% 20 8046 0.08% 21 8094 0.08% 22 8129 0.08% 23 8151 0.08% 24 8352 0.08% 25 8528 0.08% 26 8590 0.08% 27 8888 0.09% 28 9035 0.09% 29 9173 0.09% 30 9513 0.09% 31 9559 0.09% 32 9610 0.09% 33 9811 0.10% 34 10329 0.10% 35 9685 0.10% 36 9684 0.10% 37 9987 0.10% 38 9851 0.10% 39 10325 0.10% 40 10402 0.10% 41 10881 0.11% 42 11165 0.11% 43 11017 0.11% 44 11228 0.11% 45 11437 0.11% 46 11569 0.11% 47 11418 0.11% 48 11467 0.11% 49 11502 0.11% 50 10873 0.11% 51 11454 0.11% 52 11761 0.12% 53 12158 0.12% 54 12066 0.12% 55 12228 0.12% 56 11968 0.12% 57 12344 0.12% 58 12604 0.12% 59 12567 0.12% 60 13070 0.13% 61 13181 0.13% 62 13593 0.13% 63 14012 0.14% 64 14602 0.14% 65 14665 0.14% 66 14964 0.15% 67 15606 0.15% 68 16360 0.16% 69 16883 0.17% 70 17523 0.17% 71 18428 0.18% 72 19126 0.19% 73 20664 0.20% 74 21990 0.22% 75 24231 0.24% 76 15281 0.15% 77 16703 0.16% 78 19413 0.19% 79 22116 0.22% 80 24110 0.24% 81 26236 0.26% 82 28330 0.28% 83 30850 0.30% 84 33343 0.33% 85 36099 0.36% 86 38552 0.38% 87 41713 0.41% 88 44711 0.44% 89 47005 0.46% 90 49664 0.49% 91 53626 0.53% 92 58071 0.57% 93 63773 0.63% 94 70921 0.70% 95 77425 0.76% 96 94568 0.93% 97 128366 1.27% 98 256998 2.53% 99 49282 0.49% 100 51511 0.51% 101 8067672 79.50% criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=11.61 fanout-score-rank=7 prefix-density=0.55 prefix-fanout=5.4 sequence=TTGTTGTTGCTGCCACTGGCGTAGCCGTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=154.06 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=8.0 sequence=AAGAGGAGGGTCTTGTCGTTCTTGAGCTTGATGTCGCTGTGCTTCCAGTGGCCGTGGACGGTGTCGTACTTGAACATGTAGGTCATGTACTCGGTGGTGATGAAGGGGTCGTTGACGGCGACGAGCTCGATGTCATCGCTCTGGAGAGCAACCCTGGCGACGAGCCTCCCGATCCTTCCGAAACCGTTGATTCCGATC Started job on | Dec 10 01:03:36 Started mapping on | Dec 10 01:03:36 Finished on | Dec 10 01:04:04 Mapping speed, Million of reads per hour | 3914.13 Number of input reads | 30443252 Average input read length | 96 UNIQUE READS: Uniquely mapped reads number | 29700039 Uniquely mapped reads % | 97.56% Average mapped length | 96.50 Number of splices: Total | 9507635 Number of splices: Annotated (sjdb) | 9119221 Number of splices: GT/AG | 9384867 Number of splices: GC/AG | 104001 Number of splices: AT/AC | 6287 Number of splices: Non-canonical | 12480 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.45 Insertion rate per base | 0.00% Insertion average length | 1.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 419730 % of reads mapped to multiple loci | 1.38% Number of reads mapped to too many loci | 223804 % of reads mapped to too many loci | 0.74% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.29% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 323483 323483 323483 N_multimapping 419730 419730 419730 N_noFeature 835266 29010499 1090833 N_ambiguous 482343 3224 54840 UnstrandedReadsAssigned:28382430 PositiveStrandReadsAssigned:686316 NegativeStrandReadsAssigned:28554366 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR3311776 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR3311776-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,443,252 reads, 28,274,101 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52973 SRR3311776.ke.tsv 35125 SRR3311776.se.tsv 88098 total ==> SRR3311776.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 47.4789 3.40972 PNS24247 1044 945 71.3796 4.54032 PNS24249 1928 1829 60.652 1.99331 PNS24246 1044 945 71.3796 4.54032 PNS24248 1044 945 71.3796 4.54032 PNS24244 1471 1372 65.7302 2.87975 PNS24243 293 194 0 0 KQK14069 1603 1504 36.4119 1.45525 KQK14071 474 375 4.20692 0.674336 ==> SRR3311776.se.tsv <== BRADI_1g14170v3 53 BRADI_1g53295v3 70 BRADI_1g59795v3 214 BRADI_1g07683v3 0 BRADI_1g00485v3 34 BRADI_1g20270v3 3205 BRADI_1g74790v3 316 BRADI_1g09890v3 0 BRADI_1g77505v3 70 BRADI_1g48960v3 0 SRR3311776 completed mapping pipeline successfully