Starting /dee2/code/volunteer_pipeline.sh SRR3311777 current disk space = 1523898167296 free memory = 1568948124 SRR3311777 SRAfilesize 890a911d82e7500a5b5e249950fcdffc SRR3311777.sra SRR3311777.sra file validated SRR3311777 is single end SRR3311777 is conventional basespace SRR3311777 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3311777_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.05275 34.0 31.0 34.0 30.0 34.0 2 32.179 34.0 31.0 34.0 30.0 34.0 3 32.39025 34.0 31.0 34.0 30.0 34.0 4 35.59975 37.0 37.0 37.0 35.0 37.0 5 35.45625 37.0 37.0 37.0 35.0 37.0 6 35.34775 37.0 35.0 37.0 33.0 37.0 7 35.30825 37.0 35.0 37.0 33.0 37.0 8 35.24775 37.0 35.0 37.0 33.0 37.0 9 36.83675 39.0 37.0 39.0 33.0 39.0 10-11 36.78425 39.0 38.0 39.0 33.0 39.0 12-13 36.836749999999995 39.0 38.0 39.0 33.5 39.0 14-15 38.11775 41.0 38.5 41.0 33.5 41.0 16-17 38.08225 41.0 38.5 41.0 33.0 41.0 18-19 38.062125 41.0 39.0 41.0 33.0 41.0 20-21 37.824625 40.5 38.0 41.0 32.5 41.0 22-23 37.79575 40.0 38.0 41.0 33.0 41.0 24-25 37.673500000000004 40.0 38.0 41.0 32.5 41.0 26-27 37.459125 40.0 38.0 41.0 32.0 41.0 28-29 37.18475 40.0 38.0 41.0 31.5 41.0 30-31 37.104124999999996 40.0 38.0 41.0 31.0 41.0 32-33 36.810375 40.0 37.0 41.0 30.0 41.0 34-35 36.614000000000004 40.0 37.0 41.0 30.0 41.0 36-37 36.649125 40.0 36.5 41.0 30.0 41.0 38-39 36.6465 40.0 37.0 41.0 30.0 41.0 40-41 36.604875 40.0 36.0 41.0 30.0 41.0 42-43 36.449124999999995 40.0 36.0 41.0 30.0 41.0 44-45 36.204875 40.0 35.0 41.0 30.0 41.0 46-47 35.972375 40.0 35.0 41.0 29.0 41.0 48-49 35.4625 39.0 35.0 41.0 27.0 41.0 50-51 35.47925 39.0 35.0 41.0 28.0 41.0 52-53 35.48225 39.0 35.0 41.0 28.0 41.0 54-55 34.956375 38.0 35.0 41.0 26.0 41.0 56-57 34.805499999999995 37.5 34.5 41.0 26.5 41.0 58-59 34.6985 37.0 34.0 40.5 26.5 41.0 60-61 34.383375 37.0 34.5 40.0 26.5 41.0 62-63 34.050375 36.0 34.0 40.0 26.0 41.0 64-65 33.662000000000006 35.5 34.0 39.5 25.5 41.0 66-67 33.414875 35.0 34.0 39.0 26.0 41.0 68-69 32.96825 35.0 33.0 38.5 23.0 40.5 70-71 32.604749999999996 35.0 33.0 37.5 23.5 40.0 72-73 32.238 35.0 33.0 37.0 22.5 39.0 74-75 31.818875 35.0 33.0 36.5 20.0 39.0 76-77 30.144624999999998 33.5 30.0 35.0 16.5 37.0 78-79 31.208750000000002 35.0 32.5 35.0 20.0 37.0 80-81 31.208 35.0 33.0 35.0 20.0 37.0 82-83 30.98 35.0 32.5 35.0 18.5 36.0 84-85 30.620375 35.0 32.0 35.0 15.0 36.0 86-87 30.583375 35.0 32.5 35.0 16.5 36.0 88-89 30.4175 35.0 32.0 35.0 10.5 35.5 90-91 30.104 35.0 31.5 35.0 4.5 35.0 92-93 29.969 35.0 31.0 35.0 2.0 35.0 94-95 29.7165 34.5 31.0 35.0 2.0 35.0 96-97 29.442375 35.0 31.0 35.0 2.0 35.0 98-99 29.310499999999998 34.0 31.0 35.0 2.0 35.0 100-101 28.587249999999997 34.0 30.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1204 1 0.0 1204 2 0.0 1204 3 0.0 1204 4 0.0 1204 5 0.0 1204 6 0.0 1204 7 0.0 1204 8 0.0 1204 9 0.0 1204 10-11 0.0 1204 12-13 0.0 1204 14-15 0.0 1204 16-17 0.0 1204 18-19 0.0 1204 20-21 0.0 1204 22-23 0.0 1204 24-25 0.0 1204 26-27 0.0 1204 28-29 0.0 1204 30-31 0.0 1204 32-33 0.0 1204 34-35 0.0 1204 36-37 0.0 1204 38-39 0.0 1204 40-41 0.0 1204 42-43 0.0 1204 44-45 0.0 1204 46-47 0.0 1204 48-49 0.0 1204 50-51 0.0 1204 52-53 0.0 1204 54-55 0.0 1204 56-57 0.0 1204 58-59 0.0 1204 60-61 0.0 1204 62-63 0.0 1204 64-65 0.0 1204 66-67 0.0 1204 68-69 0.0 1204 70-71 0.0 1204 72-73 0.0 1204 74-75 0.0 1204 76-77 0.0 1204 78-79 0.0 1204 80-81 0.0 1204 82-83 0.0 1204 84-85 0.0 1204 86-87 0.0 1204 88-89 0.0 1204 90-91 0.0 1204 92-93 0.0 1204 94-95 0.0 1204 96-97 0.0 1204 98-99 0.0 1204 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 46.0 3 23.0 4 23.0 5 8.0 6 12.0 7 11.0 8 9.0 9 10.0 10 11.0 11 13.0 12 16.0 13 12.0 14 8.0 15 16.0 16 16.0 17 11.0 18 14.0 19 17.0 20 14.0 21 11.0 22 11.0 23 15.0 24 27.0 25 20.0 26 34.0 27 30.0 28 39.0 29 43.0 30 71.0 31 71.0 32 92.0 33 170.0 34 198.0 35 357.0 36 550.0 37 854.0 38 984.0 39 133.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.29902329075883 5.40946656649136 8.389681943400952 43.901828199348856 2 26.974999999999998 8.05 30.675 34.300000000000004 3 24.7 10.125 20.075000000000003 45.1 4 31.324999999999996 14.374999999999998 18.25 36.05 5 34.583645911477866 17.92948237059265 23.43085771442861 24.056014003500874 6 28.625 24.725 22.175 24.474999999999998 7 21.555388847211805 21.580395098774694 38.434608652163035 18.42960740185046 8 23.036518259129565 20.185092546273136 32.7663831915958 24.012006003001503 9 22.71703777833375 19.83987990993245 34.85113835376533 22.59194395796848 10-11 25.162581290645324 27.963981990995496 25.80040020010005 21.07303651825913 12-13 25.07817385866166 23.402126328955596 27.592245153220762 23.927454659161977 14-15 25.625312656328163 23.224112056028016 26.488244122061033 24.662331165582792 16-17 25.534575465799676 23.571339252219584 25.334500437664126 25.559584844316618 18-19 26.02225834688008 24.634237839189694 23.796423658872076 25.54708015505815 20-21 24.915614451806476 24.72809101137642 24.70308788598575 25.653206650831358 22-23 25.4 24.15 24.212500000000002 26.237500000000004 24-25 25.331332833208304 23.768442110527634 25.206301575393848 25.693923480870218 26-27 24.837500000000002 24.275 24.4375 26.450000000000003 28-29 25.76894223555889 23.730932733183295 24.081020255063766 26.419104776194047 30-31 25.63781890945473 23.986993496748372 24.062031015507753 26.313156578289142 32-33 25.50025012506253 24.049524762381193 24.249624812406203 26.20060030015007 34-35 25.853231653956744 24.04050506313289 24.0780097512189 26.02825353169146 36-37 25.15 23.5375 25.0375 26.275 38-39 25.1875 23.0125 25.424999999999997 26.375 40-41 25.403175396924617 24.753094136767096 24.603075384423054 25.240655081885237 42-43 24.99687382768538 24.27160185069401 23.721395523321245 27.01012879829936 44-45 25.25315664458057 23.665458182272783 24.453056632079008 26.62832854106763 46-47 25.993998499624904 23.755938984746187 24.44361090272568 25.806451612903224 48-49 25.340667583447928 23.052881610201275 24.85310663832979 26.753344168021005 50-51 25.415676959619955 24.278034754344294 24.603075384423054 25.703212901612705 52-53 26.1 23.625 23.65 26.625 54-55 25.575 23.8875 24.087500000000002 26.450000000000003 56-57 25.900000000000002 23.325000000000003 25.074999999999996 25.7 58-59 26.237500000000004 24.349999999999998 23.8875 25.525 60-61 25.825 24.75 22.9375 26.487500000000004 62-63 25.8 24.2625 24.0 25.937500000000004 64-65 25.5375 23.925 23.9375 26.6 66-67 26.137500000000003 24.3 24.15 25.412499999999998 68-69 25.7125 23.95 23.5 26.8375 70-71 26.087500000000002 23.5 24.425 25.9875 72-73 25.162499999999998 23.6625 24.762500000000003 26.4125 74-75 25.937500000000004 23.4125 24.5125 26.137500000000003 76-77 26.787499999999998 23.375 24.275 25.5625 78-79 25.25 24.3625 24.1375 26.25 80-81 25.5 23.575 25.15 25.775 82-83 27.1375 23.7125 23.724999999999998 25.424999999999997 84-85 26.174999999999997 23.5625 24.4375 25.825 86-87 24.975 23.1 24.7875 27.1375 88-89 25.5125 22.525000000000002 25.7875 26.174999999999997 90-91 25.10627656914228 24.06851712928232 24.36859214803701 26.456614153538382 92-93 25.597098912092036 23.271226710016258 24.821808178066775 26.30986619982493 94-95 25.559584844316618 23.633862698511944 24.0090033762661 26.79754908090534 96-97 26.525 23.25 23.674999999999997 26.55 98-99 26.687499999999996 23.425 24.025 25.8625 100-101 26.25 23.5875 23.775 26.387500000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.5 28 1.5 29 3.5 30 4.5 31 4.5 32 6.5 33 9.0 34 13.5 35 20.0 36 28.5 37 37.5 38 51.5 39 74.0 40 98.5 41 109.0 42 113.0 43 138.5 44 156.0 45 152.5 46 157.5 47 168.5 48 169.5 49 162.0 50 167.5 51 172.0 52 146.5 53 124.5 54 132.5 55 130.5 56 113.5 57 103.0 58 97.5 59 99.5 60 94.5 61 85.5 62 92.5 63 101.0 64 77.5 65 66.0 66 84.0 67 82.5 68 71.0 69 60.5 70 49.0 71 38.0 72 33.5 73 28.0 74 19.0 75 13.5 76 9.5 77 8.5 78 6.5 79 3.0 80 1.5 81 2.0 82 1.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.025 8 0.05 9 0.075 10-11 0.05 12-13 0.0625 14-15 0.05 16-17 0.0375 18-19 0.0375 20-21 0.0125 22-23 0.0 24-25 0.025 26-27 0.0 28-29 0.025 30-31 0.05 32-33 0.05 34-35 0.0125 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.0375 44-45 0.0125 46-47 0.025 48-49 0.0125 50-51 0.0125 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.025 92-93 0.0375 94-95 0.0375 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11705348133198 98.225 2 0.8577194752774974 1.7000000000000002 3 0.025227043390514632 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.30000000000000004 0.0 0.0 0.0 0.0 68-69 0.35 0.0 0.0 0.0 0.0 70-71 0.4625 0.0 0.0 0.0 0.0 72-73 0.5375000000000001 0.0 0.0 0.0 0.0 74-75 0.625 0.0 0.0 0.0 0.0 76-77 0.7375 0.0 0.0 0.0 0.0 78-79 0.8374999999999999 0.0 0.0 0.0 0.0 80-81 0.9750000000000001 0.0 0.0 0.0 0.0 82-83 1.3125 0.0 0.0 0.0 0.0 84-85 1.6 0.0 0.0 0.0 0.0 86-87 2.0 0.0 0.0 0.0 0.0 88-89 2.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1990854 spots for SRR3311777.sra Written 1990854 spots for SRR3311777.sra Read 1990872 spots for SRR3311777.sra Written 1990872 spots for SRR3311777.sra Read 1990854 spots for SRR3311777.sra Written 1990854 spots for SRR3311777.sra Read 1990854 spots for SRR3311777.sra Written 1990854 spots for SRR3311777.sra Read 1990854 spots for SRR3311777.sra Written 1990854 spots for SRR3311777.sra Read 1990854 spots for SRR3311777.sra Written 1990854 spots for SRR3311777.sra Read 1990854 spots for SRR3311777.sra Written 1990854 spots for SRR3311777.sra Read 1990854 spots for SRR3311777.sra Written 1990854 spots for SRR3311777.sra Read 1990854 spots for SRR3311777.sra Written 1990854 spots for SRR3311777.sra Read 1990854 spots for SRR3311777.sra Written 1990854 spots for SRR3311777.sra Read 1990854 spots for SRR3311777.sra Written 1990854 spots for SRR3311777.sra Read 1990854 spots for SRR3311777.sra Written 1990854 spots for SRR3311777.sra Read 1990854 spots for SRR3311777.sra Written 1990854 spots for SRR3311777.sra Read 1990854 spots for SRR3311777.sra Written 1990854 spots for SRR3311777.sra Read 1990854 spots for SRR3311777.sra Written 1990854 spots for SRR3311777.sra Read 1990854 spots for SRR3311777.sra Written 1990854 spots for SRR3311777.sra Read 1990854 spots for SRR3311777.sra Written 1990854 spots for SRR3311777.sra Read 1990854 spots for SRR3311777.sra Written 1990854 spots for SRR3311777.sra Read 1990854 spots for SRR3311777.sra Written 1990854 spots for SRR3311777.sra Read 1990854 spots for SRR3311777.sra Written 1990854 spots for SRR3311777.sra SRR ids: ['SRR3311777.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p49_ccq6 SRR3311777.sra spots: 39817098 blocks: [[1, 1990854], [1990855, 3981708], [3981709, 5972562], [5972563, 7963416], [7963417, 9954270], [9954271, 11945124], [11945125, 13935978], [13935979, 15926832], [15926833, 17917686], [17917687, 19908540], [19908541, 21899394], [21899395, 23890248], [23890249, 25881102], [25881103, 27871956], [27871957, 29862810], [29862811, 31853664], [31853665, 33844518], [33844519, 35835372], [35835373, 37826226], [37826227, 39817098]] SRR3311777 file size 10740235 SRR3311777 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3311777 SRR3311777_1.fastq Input file: SRR3311777_1.fastq trimmed: SRR3311777-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:07:30 2024 >> started Tue Dec 10 01:07:53 2024 >> done (23.255s) 39817098 reads processed; of these: 1088867 ( 2.73%) short reads filtered out after trimming by size control 1247869 ( 3.13%) empty reads filtered out after trimming by size control 37480362 (94.13%) reads available; of these: 4913647 (13.11%) trimmed reads available after processing 32566715 (86.89%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 35533 0.09% 19 35029 0.09% 20 34283 0.09% 21 33648 0.09% 22 34805 0.09% 23 34334 0.09% 24 35085 0.09% 25 36378 0.10% 26 36285 0.10% 27 37252 0.10% 28 37629 0.10% 29 37767 0.10% 30 38630 0.10% 31 39739 0.11% 32 40127 0.11% 33 39350 0.10% 34 40987 0.11% 35 38827 0.10% 36 37461 0.10% 37 39411 0.11% 38 39248 0.10% 39 40757 0.11% 40 41944 0.11% 41 41823 0.11% 42 42792 0.11% 43 43312 0.12% 44 43809 0.12% 45 44246 0.12% 46 44722 0.12% 47 44409 0.12% 48 44389 0.12% 49 43227 0.12% 50 41862 0.11% 51 42843 0.11% 52 43219 0.12% 53 45053 0.12% 54 45765 0.12% 55 46089 0.12% 56 45770 0.12% 57 47045 0.13% 58 47702 0.13% 59 47519 0.13% 60 48598 0.13% 61 50212 0.13% 62 50739 0.14% 63 51646 0.14% 64 52780 0.14% 65 54138 0.14% 66 54832 0.15% 67 57695 0.15% 68 58460 0.16% 69 60818 0.16% 70 50531 0.13% 71 50760 0.14% 72 52557 0.14% 73 54875 0.15% 74 56449 0.15% 75 61716 0.16% 76 23471 0.06% 77 27116 0.07% 78 34437 0.09% 79 40423 0.11% 80 44720 0.12% 81 48432 0.13% 82 49965 0.13% 83 53384 0.14% 84 56059 0.15% 85 58910 0.16% 86 62762 0.17% 87 66801 0.18% 88 71573 0.19% 89 76431 0.20% 90 82480 0.22% 91 91754 0.24% 92 99101 0.26% 93 111505 0.30% 94 126523 0.34% 95 142308 0.38% 96 162498 0.43% 97 185785 0.50% 98 200292 0.53% 99 202314 0.54% 100 217692 0.58% 101 32566715 86.89% 37480362 reads passed initial QC criterion=sequence-density sequence-density=1.95 sequence-density-rank=1 fanout-score=65.06 fanout-score-rank=2 prefix-density=2.74 prefix-fanout=46.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=20 fanout-score=160.15 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=8.4 sequence=AAGAGGAGGGTCTTGTCGTTCTTGAGCTTGATGTCGCTGTGCTTCCAGTGGCCGTGGACGGTGTCGTACTTGAACATGTAGGTCATGTACTCGGTGGTGATGAAGGGGTCGTTGACGGCGACGAGCTCGATGTCATCGCTCTGGAGAGCAACCCTGGCGACGAGCCTCCCGATCCTTCCGAAACCGTTGATTCCGATCTTAATCTTGCCCATGGCGACG Started job on | Dec 10 01:08:15 Started mapping on | Dec 10 01:08:15 Finished on | Dec 10 01:08:50 Mapping speed, Million of reads per hour | 3855.12 Number of input reads | 37480362 Average input read length | 96 UNIQUE READS: Uniquely mapped reads number | 36606840 Uniquely mapped reads % | 97.67% Average mapped length | 96.41 Number of splices: Total | 11284790 Number of splices: Annotated (sjdb) | 10807644 Number of splices: GT/AG | 11135634 Number of splices: GC/AG | 121968 Number of splices: AT/AC | 7403 Number of splices: Non-canonical | 19785 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.47 Insertion rate per base | 0.00% Insertion average length | 1.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 602721 % of reads mapped to multiple loci | 1.61% Number of reads mapped to too many loci | 157730 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.28% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 270801 270801 270801 N_multimapping 602721 602721 602721 N_noFeature 942245 35765884 1288297 N_ambiguous 550720 3537 61157 UnstrandedReadsAssigned:35113875 PositiveStrandReadsAssigned:837419 NegativeStrandReadsAssigned:35257386 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR3311777 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR3311777-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,480,362 reads, 34,955,403 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,303 rounds 52973 SRR3311777.ke.tsv 35125 SRR3311777.se.tsv 88098 total ==> SRR3311777.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 130.809 7.36339 PNS24247 1044 945 43.6731 2.17745 PNS24249 1928 1829 183.581 4.72912 PNS24246 1044 945 43.6731 2.17745 PNS24248 1044 945 43.6731 2.17745 PNS24244 1471 1372 57.5903 1.9777 PNS24243 293 194 0 0 KQK14069 1603 1504 17.1656 0.537746 KQK14071 474 375 2.19777 0.276132 ==> SRR3311777.se.tsv <== BRADI_1g14170v3 25 BRADI_1g53295v3 82 BRADI_1g59795v3 217 BRADI_1g07683v3 0 BRADI_1g00485v3 38 BRADI_1g20270v3 3619 BRADI_1g74790v3 385 BRADI_1g09890v3 2 BRADI_1g77505v3 106 BRADI_1g48960v3 0 SRR3311777 completed mapping pipeline successfully