Starting /dee2/code/volunteer_pipeline.sh SRR3311778 current disk space = 1523902255104 free memory = 1568949380 SRR3311778 SRAfilesize 665988977a2ebcfd2473fdb4a9bb9ae1 SRR3311778.sra SRR3311778.sra file validated SRR3311778 is single end SRR3311778 is conventional basespace SRR3311778 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3311778_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.079 34.0 31.0 34.0 27.0 34.0 2 31.02675 34.0 31.0 34.0 27.0 34.0 3 31.3605 34.0 31.0 34.0 28.0 34.0 4 34.82125 37.0 35.0 37.0 32.0 37.0 5 33.72975 37.0 35.0 37.0 28.0 37.0 6 33.888 37.0 35.0 37.0 28.0 37.0 7 34.0715 37.0 35.0 37.0 30.0 37.0 8 33.9405 37.0 35.0 37.0 30.0 37.0 9 35.37125 39.0 37.0 39.0 29.0 39.0 10-11 35.495875 39.0 37.0 39.0 29.5 39.0 12-13 35.504000000000005 39.0 37.0 39.0 30.0 39.0 14-15 36.795249999999996 40.0 38.0 41.0 30.0 41.0 16-17 36.66825 40.0 38.0 41.0 30.0 41.0 18-19 36.607749999999996 40.0 38.0 41.0 29.5 41.0 20-21 36.595 40.0 38.0 41.0 30.0 41.0 22-23 36.482125 40.0 37.5 41.0 29.5 41.0 24-25 36.363125 40.0 37.0 41.0 29.5 41.0 26-27 36.106125 40.0 37.0 41.0 28.0 41.0 28-29 35.767375 40.0 36.5 41.0 25.5 41.0 30-31 35.598625 40.0 36.0 41.0 25.0 41.0 32-33 35.394375 40.0 36.0 41.0 25.5 41.0 34-35 35.159875 40.0 35.0 41.0 24.5 41.0 36-37 34.907250000000005 39.5 35.0 41.0 22.5 41.0 38-39 34.530249999999995 40.0 35.0 41.0 13.5 41.0 40-41 34.381125 39.5 35.0 41.0 12.0 41.0 42-43 33.960875 39.0 34.5 41.0 8.5 41.0 44-45 34.054249999999996 39.0 33.5 41.0 16.5 41.0 46-47 34.11750000000001 39.0 34.0 41.0 18.0 41.0 48-49 33.889624999999995 39.0 33.5 41.0 14.0 41.0 50-51 33.79525 38.0 33.5 41.0 14.5 41.0 52-53 33.627624999999995 38.0 33.5 41.0 8.5 41.0 54-55 33.1965 38.0 33.0 40.5 4.5 41.0 56-57 32.8285 37.0 33.0 40.0 2.0 41.0 58-59 32.548249999999996 36.5 33.0 40.0 2.0 41.0 60-61 31.844625 36.0 32.0 40.0 2.0 41.0 62-63 31.701375 35.0 32.0 39.5 2.0 41.0 64-65 31.173000000000002 35.0 31.0 39.0 2.0 41.0 66-67 30.79375 35.0 31.0 39.0 2.0 41.0 68-69 30.6 35.0 31.0 38.0 2.0 40.0 70-71 30.292 35.0 30.5 37.0 2.0 40.0 72-73 30.0005 35.0 30.5 37.0 2.0 39.0 74-75 29.138375 35.0 29.0 36.0 2.0 39.0 76-77 27.640875 32.5 26.0 35.0 2.0 37.0 78-79 28.61125 34.0 29.0 35.0 2.0 37.0 80-81 28.706625000000003 34.0 29.0 35.0 2.0 37.0 82-83 28.488374999999998 34.0 29.0 35.0 2.0 36.5 84-85 28.308125 34.0 29.0 35.0 2.0 36.0 86-87 28.101875 34.0 29.0 35.0 2.0 36.0 88-89 27.861874999999998 34.0 29.0 35.0 2.0 35.0 90-91 27.456375 34.0 27.0 35.0 2.0 35.0 92-93 27.00575 34.0 25.5 35.0 2.0 35.0 94-95 26.84075 34.0 25.0 35.0 2.0 35.0 96-97 26.618375 34.0 24.5 35.0 2.0 35.0 98-99 26.283125 34.0 24.0 35.0 2.0 35.0 100-101 25.63425 33.5 21.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 126.0 3 43.0 4 20.0 5 12.0 6 13.0 7 23.0 8 12.0 9 21.0 10 17.0 11 19.0 12 22.0 13 23.0 14 19.0 15 29.0 16 24.0 17 20.0 18 14.0 19 15.0 20 27.0 21 23.0 22 25.0 23 31.0 24 25.0 25 31.0 26 55.0 27 45.0 28 55.0 29 67.0 30 90.0 31 93.0 32 109.0 33 170.0 34 217.0 35 343.0 36 458.0 37 717.0 38 815.0 39 132.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.53580370555834 5.533299949924888 6.209313970956434 47.72158237356034 2 24.94302355026589 7.191694099772095 32.10939478348949 35.75588756647253 3 22.375 10.15 21.375 46.1 4 30.45 13.825000000000001 18.325 37.4 5 32.812899923214744 18.326081392372664 23.368313283849503 25.492705400563093 6 27.55 25.05 22.7 24.7 7 21.8 22.1 37.25 18.85 8 21.663734606685097 23.850213621512943 31.339532545865794 23.146519225936167 9 20.592705167173253 21.12462006079027 35.94224924012158 22.340425531914892 10-11 23.05 30.3 25.874999999999996 20.775 12-13 24.0125 23.45 28.4 24.1375 14-15 23.69046130766346 24.353044130516317 27.465933241655204 24.49056132016502 16-17 24.462500000000002 24.75 26.5625 24.224999999999998 18-19 25.55638909727432 24.568642160540136 25.09377344336084 24.781195298824706 20-21 24.60615153788447 25.29382345586397 25.11877969492373 24.981245311327832 22-23 25.174999999999997 25.7125 23.6625 25.45 24-25 24.715589448681087 24.20302537817227 24.8906113264158 26.190773846730842 26-27 24.787393696848426 24.224612306153077 25.475237618809405 25.512756378189096 28-29 24.707951262404222 24.68282879035297 24.65770631830172 25.951513628941086 30-31 24.4875 23.9875 24.6875 26.8375 32-33 24.915487667459622 23.888819331413547 24.76524352072117 26.43044948040566 34-35 25.137500000000003 25.087500000000002 23.925 25.85 36-37 25.709264373587747 23.374340949033392 24.730102937484308 26.18629173989455 38-39 24.389933909506865 24.644128113879006 25.228774783934927 25.73716319267921 40-41 24.62979369700038 23.56663713453993 25.819516516896595 25.984052651563093 42-43 25.46308043643745 24.359299670134487 24.346612534889623 25.831007358538443 44-45 24.712500000000002 24.3 24.825 26.1625 46-47 25.137500000000003 25.2 24.6125 25.05 48-49 24.75 24.462500000000002 24.337500000000002 26.450000000000003 50-51 24.590573821727716 24.40305038129766 25.51568946118265 25.490686335791974 52-53 25.922220832812304 23.708890834062775 24.871826935100664 25.497061398024258 54-55 24.45392919909616 24.0145618880241 24.805423047953802 26.726085864925935 56-57 24.051908781655538 24.08970643820083 24.833060350258286 27.025324429885345 58-59 25.732612250031444 24.500062885171676 24.44975474783046 25.31757011696642 60-61 25.357278360945994 24.016694068546858 23.649930441381052 26.976097129126092 62-63 25.462089777442475 24.69508361624544 24.19212875644411 25.650697849867974 64-65 24.60277427490542 23.94703656998739 24.968474148802017 26.48171500630517 66-67 25.528949702267834 24.350690485240087 24.768782465475738 25.351577347016345 68-69 25.213997985901308 23.892245720040282 25.08811681772407 25.805639476334342 70-71 25.528984599974958 24.139226242644295 24.52735695505196 25.804432202328787 72-73 25.53618462310297 24.08127430076508 23.85551235419541 26.527028721936535 74-75 24.612229201384437 23.496987565696706 24.676323548263042 27.21445968465581 76-77 24.70988900100908 24.697275479313824 24.77295660948537 25.819878910191722 78-79 25.624999999999996 24.8 23.425 26.150000000000002 80-81 25.165645705713214 24.52806600825103 24.478059757469683 25.828228528566072 82-83 25.910627112279382 24.13318312679935 24.308424083114282 25.647765677806984 84-85 25.475951903807616 24.461422845691384 23.171342685370742 26.891282565130258 86-87 25.224999999999998 24.1875 24.375 26.2125 88-89 25.182757751449458 25.031509957146458 23.821527602722462 25.964204688681626 90-91 25.8125 24.587500000000002 23.6375 25.9625 92-93 25.040630078759847 24.640580072509064 24.14051756469559 26.178272284035504 94-95 25.770483588073162 24.668003006765222 23.402655975945876 26.158857429215736 96-97 25.040670754598928 24.990614441246404 23.61406582405206 26.354648980102613 98-99 24.474999999999998 25.05 24.4875 25.9875 100-101 25.7375 24.7875 23.7875 25.687500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.0 27 4.0 28 6.0 29 5.0 30 4.5 31 8.5 32 15.5 33 18.5 34 20.5 35 36.0 36 47.0 37 55.5 38 73.0 39 96.0 40 102.5 41 107.5 42 123.5 43 140.0 44 168.0 45 181.0 46 178.0 47 178.0 48 167.0 49 152.5 50 148.5 51 145.5 52 143.5 53 127.0 54 111.5 55 103.5 56 96.0 57 92.5 58 89.5 59 88.0 60 92.0 61 96.0 62 76.5 63 67.0 64 74.5 65 80.5 66 79.5 67 75.0 68 63.5 69 51.5 70 47.0 71 36.5 72 33.0 73 27.0 74 17.5 75 12.0 76 9.5 77 5.5 78 5.5 79 5.0 80 2.5 81 2.5 82 1.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 1.275 3 0.0 4 0.0 5 2.325 6 0.0 7 0.0 8 0.525 9 1.3 10-11 0.0 12-13 0.0 14-15 0.0125 16-17 0.0 18-19 0.025 20-21 0.025 22-23 0.0 24-25 0.0125 26-27 0.05 28-29 0.4875 30-31 0.0 32-33 0.1625 34-35 0.0 36-37 0.42500000000000004 38-39 1.6500000000000001 40-41 1.2375 42-43 1.4749999999999999 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0125 52-53 0.0375 54-55 0.42500000000000004 56-57 0.7875 58-59 0.6125 60-61 1.1625 62-63 0.5875 64-65 0.8750000000000001 66-67 1.3375 68-69 0.7000000000000001 70-71 0.1625 72-73 0.3375 74-75 2.4875000000000003 76-77 0.8999999999999999 78-79 0.0 80-81 0.0125 82-83 0.13749999999999998 84-85 0.2 86-87 0.0 88-89 0.8250000000000001 90-91 0.0 92-93 0.0125 94-95 0.22499999999999998 96-97 0.11249999999999999 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9638615112459 97.89999999999999 2 0.9855951478392722 1.95 3 0.050543340914834464 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.037500000000000006 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.2625 0.0 0.0 0.0 0.0 70-71 0.35 0.0 0.0 0.0 0.0 72-73 0.425 0.0 0.0 0.0 0.0 74-75 0.6125 0.0 0.0 0.0 0.0 76-77 0.6875 0.0 0.0 0.0 0.0 78-79 0.825 0.0 0.0 0.0 0.0 80-81 1.025 0.0 0.0 0.0 0.0 82-83 1.4125 0.0 0.0 0.0 0.0 84-85 1.7000000000000002 0.0 0.0 0.0 0.0 86-87 1.9625 0.0 0.0 0.0 0.0 88-89 2.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1795334 spots for SRR3311778.sra Written 1795334 spots for SRR3311778.sra Read 1795334 spots for SRR3311778.sra Written 1795334 spots for SRR3311778.sra Read 1795334 spots for SRR3311778.sra Written 1795334 spots for SRR3311778.sra Read 1795334 spots for SRR3311778.sra Written 1795334 spots for SRR3311778.sra Read 1795334 spots for SRR3311778.sra Written 1795334 spots for SRR3311778.sra Read 1795334 spots for SRR3311778.sra Written 1795334 spots for SRR3311778.sra Read 1795334 spots for SRR3311778.sra Written 1795334 spots for SRR3311778.sra Read 1795334 spots for SRR3311778.sra Written 1795334 spots for SRR3311778.sra Read 1795334 spots for SRR3311778.sra Written 1795334 spots for SRR3311778.sra Read 1795334 spots for SRR3311778.sra Written 1795334 spots for SRR3311778.sra Read 1795334 spots for SRR3311778.sra Written 1795334 spots for SRR3311778.sra Read 1795334 spots for SRR3311778.sra Written 1795334 spots for SRR3311778.sra Read 1795334 spots for SRR3311778.sra Written 1795334 spots for SRR3311778.sra Read 1795334 spots for SRR3311778.sra Written 1795334 spots for SRR3311778.sra Read 1795334 spots for SRR3311778.sra Written 1795334 spots for SRR3311778.sra Read 1795334 spots for SRR3311778.sra Written 1795334 spots for SRR3311778.sra Read 1795334 spots for SRR3311778.sra Written 1795334 spots for SRR3311778.sra Read 1795334 spots for SRR3311778.sra Written 1795334 spots for SRR3311778.sra Read 1795334 spots for SRR3311778.sra Written 1795334 spots for SRR3311778.sra Read 1795341 spots for SRR3311778.sra Written 1795341 spots for SRR3311778.sra SRR ids: ['SRR3311778.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uqc5pohs SRR3311778.sra spots: 35906687 blocks: [[1, 1795334], [1795335, 3590668], [3590669, 5386002], [5386003, 7181336], [7181337, 8976670], [8976671, 10772004], [10772005, 12567338], [12567339, 14362672], [14362673, 16158006], [16158007, 17953340], [17953341, 19748674], [19748675, 21544008], [21544009, 23339342], [23339343, 25134676], [25134677, 26930010], [26930011, 28725344], [28725345, 30520678], [30520679, 32316012], [32316013, 34111346], [34111347, 35906687]] SRR3311778 file size 9684409 SRR3311778 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3311778 SRR3311778_1.fastq Input file: SRR3311778_1.fastq trimmed: SRR3311778-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:03:09 2024 >> started Tue Dec 10 01:04:21 2024 >> done (71.815s) 35906687 reads processed; of these: 1106047 ( 3.08%) short reads filtered out after trimming by size control 1331399 ( 3.71%) empty reads filtered out after trimming by size control 33469241 (93.21%) reads available; of these: 4522734 (13.51%) trimmed reads available after processing 28946507 (86.49%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 33986 0.10% 19 33179 0.10% 20 32593 0.10% 21 31989 0.10% 22 32832 0.10% 23 32385 0.10% 24 32882 0.10% 25 33818 0.10% 26 34236 0.10% 27 34685 0.10% 28 34881 0.10% 29 35175 0.11% 30 35617 0.11% 31 36873 0.11% 32 36513 0.11% 33 36370 0.11% 34 37574 0.11% 35 36212 0.11% 36 34842 0.10% 37 36869 0.11% 38 37168 0.11% 39 38059 0.11% 40 39272 0.12% 41 39915 0.12% 42 39963 0.12% 43 40727 0.12% 44 40358 0.12% 45 40931 0.12% 46 41782 0.12% 47 41452 0.12% 48 41115 0.12% 49 40739 0.12% 50 39583 0.12% 51 40256 0.12% 52 41438 0.12% 53 42781 0.13% 54 43688 0.13% 55 43116 0.13% 56 43482 0.13% 57 44076 0.13% 58 44853 0.13% 59 44686 0.13% 60 45920 0.14% 61 47025 0.14% 62 47024 0.14% 63 48659 0.15% 64 50069 0.15% 65 51087 0.15% 66 52799 0.16% 67 54421 0.16% 68 55480 0.17% 69 57709 0.17% 70 47001 0.14% 71 46671 0.14% 72 48707 0.15% 73 50717 0.15% 74 51332 0.15% 75 56378 0.17% 76 21977 0.07% 77 24640 0.07% 78 32118 0.10% 79 37131 0.11% 80 41359 0.12% 81 44814 0.13% 82 47042 0.14% 83 47981 0.14% 84 50934 0.15% 85 54616 0.16% 86 57669 0.17% 87 61791 0.18% 88 65603 0.20% 89 70089 0.21% 90 75854 0.23% 91 82586 0.25% 92 89468 0.27% 93 99603 0.30% 94 113702 0.34% 95 127340 0.38% 96 146747 0.44% 97 165669 0.49% 98 178796 0.53% 99 181149 0.54% 100 190106 0.57% 101 28946507 86.49% 33469241 reads passed initial QC criterion=sequence-density sequence-density=2.18 sequence-density-rank=1 fanout-score=61.97 fanout-score-rank=2 prefix-density=3.02 prefix-fanout=44.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=155.50 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=8.8 sequence=AAGAGGAGGGTCTTGTCGTTCTTGAGCTTGATGTCGCTGTGCTTCCAGTGGCCGTGGACGGTGTCGTACTTGAACATGTAGGTCATGTACTCGGTGGTGATGAAGGGGTCGTTGACGGCGACGAGCTCGATGTCATCGCTCTGGAGAGCAACCCTGGCGACGAGCCTCCCGATCCTTCCGAAACCGTTGATTCCGATCTTAATCTTGCCCATGGCGACG Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGT -o SRR3311778 - Input file: STDIN trimmed: SRR3311778-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 01:05:22 2024 >> started Tue Dec 10 01:05:37 2024 >> done (14.869s) 11156414 reads processed; of these: 608 ( 0.01%) short reads filtered out after trimming by size control 9 ( 0.00%) empty reads filtered out after trimming by size control 11155797 (99.99%) reads available; of these: 958826 ( 8.59%) trimmed reads available after processing 10196971 (91.41%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11345 0.10% 19 11103 0.10% 20 10821 0.10% 21 10578 0.09% 22 11059 0.10% 23 10921 0.10% 24 11060 0.10% 25 11497 0.10% 26 11420 0.10% 27 11557 0.10% 28 11742 0.11% 29 11772 0.11% 30 12048 0.11% 31 12296 0.11% 32 11877 0.11% 33 12178 0.11% 34 12618 0.11% 35 12263 0.11% 36 11671 0.10% 37 12364 0.11% 38 12353 0.11% 39 12676 0.11% 40 13305 0.12% 41 13329 0.12% 42 13287 0.12% 43 13560 0.12% 44 13405 0.12% 45 13505 0.12% 46 13958 0.13% 47 13960 0.13% 48 13603 0.12% 49 13557 0.12% 50 13332 0.12% 51 13522 0.12% 52 13938 0.12% 53 14364 0.13% 54 14533 0.13% 55 14335 0.13% 56 14460 0.13% 57 14768 0.13% 58 15141 0.14% 59 14920 0.13% 60 15321 0.14% 61 15644 0.14% 62 15741 0.14% 63 16168 0.14% 64 16694 0.15% 65 16983 0.15% 66 17559 0.16% 67 18335 0.16% 68 18391 0.16% 69 19429 0.17% 70 20432 0.18% 71 20805 0.19% 72 22250 0.20% 73 23871 0.21% 74 24525 0.22% 75 27304 0.24% 76 16899 0.15% 77 18656 0.17% 78 21875 0.20% 79 24859 0.22% 80 27412 0.25% 81 29906 0.27% 82 32502 0.29% 83 34825 0.31% 84 37729 0.34% 85 41500 0.37% 86 44053 0.39% 87 47961 0.43% 88 51198 0.46% 89 54568 0.49% 90 57877 0.52% 91 63100 0.57% 92 67982 0.61% 93 74388 0.67% 94 83134 0.75% 95 92377 0.83% 96 109851 0.98% 97 146448 1.31% 98 284573 2.55% 99 56742 0.51% 100 60112 0.54% 101 8729817 78.25% criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=17.63 fanout-score-rank=7 prefix-density=0.41 prefix-fanout=6.7 sequence=TTGTTGTTGCTGCCACTGGCGTAGCCGTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=171.05 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=8.8 sequence=AAGAGGAGGGTCTTGTCGTTCTTGAGCTTGATGTCGCTGTGCTTCCAGTGGCCGTGGACGGTGTCGTACTTGAACATGTAGGTCATGTACTCGGTGGTGATGAAGGGGTCGTTGACGGCGACGAGCTCGATGTCATCGCTCTGGAGAGCAACCCTGGCGACGAGCCTCCCGATCCTTCCGAAACCGTTGATTCCGATCTTAATCTTGCCCATGGCGACG Started job on | Dec 10 01:06:08 Started mapping on | Dec 10 01:06:08 Finished on | Dec 10 01:06:39 Mapping speed, Million of reads per hour | 3886.68 Number of input reads | 33468624 Average input read length | 96 UNIQUE READS: Uniquely mapped reads number | 32782497 Uniquely mapped reads % | 97.95% Average mapped length | 96.08 Number of splices: Total | 9864014 Number of splices: Annotated (sjdb) | 9430628 Number of splices: GT/AG | 9721758 Number of splices: GC/AG | 122287 Number of splices: AT/AC | 5736 Number of splices: Non-canonical | 14233 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.47 Insertion rate per base | 0.00% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 427927 % of reads mapped to multiple loci | 1.28% Number of reads mapped to too many loci | 133062 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.35% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 258200 258200 258200 N_multimapping 427927 427927 427927 N_noFeature 1028044 31905680 1366284 N_ambiguous 594526 2599 63050 UnstrandedReadsAssigned:31159927 PositiveStrandReadsAssigned:874218 NegativeStrandReadsAssigned:31353163 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=98 echo kmer=93 SRR3311778 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR3311778-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,468,624 reads, 30,965,041 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52973 SRR3311778.ke.tsv 35125 SRR3311778.se.tsv 88098 total ==> SRR3311778.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 52.8928 3.28743 PNS24247 1044 945 89.4924 4.92651 PNS24249 1928 1829 143.303 4.07593 PNS24246 1044 945 89.4924 4.92651 PNS24248 1044 945 89.4924 4.92651 PNS24244 1471 1372 73.3272 2.78033 PNS24243 293 194 1 0.268154 KQK14069 1603 1504 2604.02 90.0703 KQK14071 474 375 879.288 121.979 ==> SRR3311778.se.tsv <== BRADI_1g14170v3 4178 BRADI_1g53295v3 91 BRADI_1g59795v3 275 BRADI_1g07683v3 0 BRADI_1g00485v3 98 BRADI_1g20270v3 1079 BRADI_1g74790v3 1144 BRADI_1g09890v3 3 BRADI_1g77505v3 188 BRADI_1g48960v3 0 SRR3311778 completed mapping pipeline successfully