Starting /dee2/code/volunteer_pipeline.sh SRR3311780 current disk space = 1523857666048 free memory = 1451231004 SRR3311780 SRAfilesize a311cc323168834fc40c2e9ac0a0dc8a SRR3311780.sra SRR3311780.sra file validated SRR3311780 is single end SRR3311780 is conventional basespace SRR3311780 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3311780_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.16075 31.0 31.0 34.0 26.0 34.0 2 30.2775 33.0 31.0 34.0 26.0 34.0 3 30.295 33.0 31.0 34.0 26.0 34.0 4 33.74275 37.0 35.0 37.0 30.0 37.0 5 33.1425 37.0 35.0 37.0 26.0 37.0 6 33.01625 37.0 35.0 37.0 25.0 37.0 7 32.34725 35.0 33.0 37.0 23.0 37.0 8 32.54025 36.0 35.0 37.0 23.0 37.0 9 34.05025 39.0 35.0 39.0 22.0 39.0 10-11 34.02525 39.0 35.0 39.0 22.0 39.0 12-13 33.893375 39.0 35.0 39.0 18.0 39.0 14-15 35.175625 40.0 36.0 41.0 19.5 41.0 16-17 34.927875 40.0 35.5 41.0 17.5 41.0 18-19 34.97825 40.0 36.0 41.0 18.5 41.0 20-21 34.84725 40.0 35.5 41.0 18.0 41.0 22-23 34.96225 40.0 36.0 41.0 18.0 41.0 24-25 34.795 40.0 35.5 41.0 17.0 41.0 26-27 34.605125 40.0 35.0 41.0 16.0 41.0 28-29 34.47225 40.0 35.0 41.0 16.0 41.0 30-31 34.446375 40.0 35.0 41.0 15.5 41.0 32-33 34.330375000000004 39.5 35.0 41.0 13.0 41.0 34-35 34.007125 39.0 34.0 41.0 9.0 41.0 36-37 33.9615 39.0 34.0 41.0 9.0 41.0 38-39 33.9555 39.0 34.5 41.0 8.0 41.0 40-41 33.85525 39.0 34.0 41.0 8.0 41.0 42-43 33.681375 39.0 34.0 41.0 4.5 41.0 44-45 33.508624999999995 39.0 33.0 41.0 2.0 41.0 46-47 33.38775 38.5 33.0 41.0 2.0 41.0 48-49 33.09975 38.0 33.0 40.5 2.0 41.0 50-51 33.012875 38.0 33.0 40.0 2.0 41.0 52-53 32.92075 38.0 33.0 40.5 2.0 41.0 54-55 32.760125 37.5 33.0 40.0 2.0 41.0 56-57 32.4915 37.0 32.5 40.0 2.0 41.0 58-59 32.293625 36.5 32.0 40.0 2.0 41.0 60-61 32.075874999999996 36.0 32.5 40.0 2.0 41.0 62-63 31.661875000000002 35.5 32.0 39.5 2.0 41.0 64-65 31.486375000000002 35.0 32.0 39.0 2.0 41.0 66-67 31.2455 35.0 31.5 39.0 2.0 41.0 68-69 30.866875 35.0 31.0 37.5 2.0 40.0 70-71 30.630499999999998 35.0 31.0 37.0 2.0 40.0 72-73 30.28275 35.0 31.0 37.0 2.0 39.0 74-75 29.971375000000002 35.0 30.5 36.0 2.0 39.0 76-77 28.593875 33.5 28.5 35.0 2.0 37.0 78-79 29.229 34.5 29.5 35.0 2.0 37.0 80-81 29.197499999999998 35.0 30.0 35.0 2.0 37.0 82-83 29.0995 35.0 30.0 35.0 2.0 36.0 84-85 28.885375 35.0 30.0 35.0 2.0 36.0 86-87 28.887 35.0 30.5 35.0 2.0 36.0 88-89 28.712375 35.0 30.0 35.0 2.0 35.5 90-91 28.495125 34.5 29.5 35.0 2.0 35.0 92-93 28.30075 34.0 29.0 35.0 2.0 35.0 94-95 28.0655 34.0 29.0 35.0 2.0 35.0 96-97 27.963250000000002 34.0 29.0 35.0 2.0 35.0 98-99 27.876125000000002 34.0 29.0 35.0 2.0 35.0 100-101 27.3245 34.0 28.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2314 1 0.0 2314 2 0.0 2314 3 0.0 2314 4 0.0 2314 5 0.0 2314 6 0.0 2314 7 0.0 2314 8 0.0 2314 9 0.0 2314 10-11 0.0 2314 12-13 0.0 2314 14-15 0.0 2314 16-17 0.0 2314 18-19 0.0 2314 20-21 0.0 2314 22-23 0.0 2314 24-25 0.0 2314 26-27 0.0 2314 28-29 0.0 2314 30-31 0.0 2314 32-33 0.0 2314 34-35 0.0 2314 36-37 0.0 2314 38-39 0.0 2314 40-41 0.0 2314 42-43 0.0 2314 44-45 0.0 2314 46-47 0.0 2314 48-49 0.0 2314 50-51 0.0 2314 52-53 0.0 2314 54-55 0.0 2314 56-57 0.0 2314 58-59 0.0 2314 60-61 0.0 2314 62-63 0.0 2314 64-65 0.0 2314 66-67 0.0 2314 68-69 0.0 2314 70-71 0.0 2314 72-73 0.0 2314 74-75 0.0 2314 76-77 0.0 2314 78-79 0.0 2314 80-81 0.0 2314 82-83 0.0 2314 84-85 0.0 2314 86-87 0.0 2314 88-89 0.0 2314 90-91 0.0 2314 92-93 0.0 2314 94-95 0.0 2314 96-97 0.0 2314 98-99 0.0 2314 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 204.0 3 75.0 4 24.0 5 13.0 6 16.0 7 14.0 8 13.0 9 18.0 10 15.0 11 14.0 12 14.0 13 18.0 14 12.0 15 17.0 16 18.0 17 15.0 18 11.0 19 17.0 20 12.0 21 10.0 22 18.0 23 23.0 24 19.0 25 29.0 26 36.0 27 42.0 28 53.0 29 59.0 30 64.0 31 88.0 32 109.0 33 146.0 34 187.0 35 326.0 36 516.0 37 806.0 38 834.0 39 95.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.784677015523286 6.534802203304957 6.4096144216324475 47.27090635953931 2 24.55 7.425 32.875 35.15 3 21.575 9.875 22.0 46.550000000000004 4 29.475 16.0 19.3 35.225 5 32.4 20.225 24.325 23.05 6 25.674999999999997 27.075 24.15 23.1 7 21.125 23.724999999999998 37.675 17.474999999999998 8 20.349999999999998 23.175 33.525 22.95 9 20.025000000000002 21.45 36.35 22.175 10-11 23.39042380297537 30.391298912364046 25.315664458057256 20.902612826603324 12-13 24.2625 24.5375 27.712500000000002 23.4875 14-15 22.552819102387797 25.728216027003377 27.55344418052256 24.16552069008626 16-17 23.375 25.95 25.75 24.925 18-19 24.6625 25.025 25.087500000000002 25.224999999999998 20-21 24.14051756469559 25.765720715089387 24.778097262157768 25.315664458057256 22-23 22.775000000000002 25.7875 26.337500000000002 25.1 24-25 23.425 25.3125 25.124999999999996 26.137500000000003 26-27 23.63090772693173 25.30632658164541 25.568892223055762 25.49387346836709 28-29 22.9625 25.35 26.450000000000003 25.2375 30-31 23.65 24.9 24.7875 26.6625 32-33 24.04050506313289 24.40305038129766 26.215776972121514 25.340667583447928 34-35 24.4875 24.712500000000002 25.837500000000002 24.962500000000002 36-37 24.2375 24.825 25.0625 25.874999999999996 38-39 23.415426928366045 25.028128516064506 25.240655081885237 26.31578947368421 40-41 24.55 25.1 24.825 25.525 42-43 24.337500000000002 25.45 24.4125 25.8 44-45 23.549999999999997 25.75 25.4875 25.2125 46-47 24.0625 25.637500000000003 25.6 24.7 48-49 24.275 24.6125 25.7625 25.35 50-51 23.4375 24.6 26.5625 25.4 52-53 23.6625 25.412499999999998 25.2625 25.662499999999998 54-55 24.6875 24.0625 25.2875 25.9625 56-57 23.775 24.962500000000002 25.874999999999996 25.387500000000003 58-59 24.9375 25.424999999999997 24.7875 24.85 60-61 24.9375 24.725 24.0625 26.275 62-63 24.087500000000002 24.55 25.4625 25.900000000000002 64-65 24.725 24.925 25.412499999999998 24.9375 66-67 24.525 24.212500000000002 24.762500000000003 26.5 68-69 23.45 25.650000000000002 25.8 25.1 70-71 24.84681755658372 25.034387895460796 24.83431286732525 25.28448168063024 72-73 24.425 24.825 24.325 26.424999999999997 74-75 24.175 25.4 25.324999999999996 25.1 76-77 25.18129532383096 25.668917229307326 24.36859214803701 24.781195298824706 78-79 24.4 25.2875 24.6125 25.7 80-81 23.9 25.074999999999996 25.0125 26.0125 82-83 24.19657371514318 25.497061398024258 24.496686257346507 25.809678629486054 84-85 24.23105776444111 25.156289072268066 24.981245311327832 25.63140785196299 86-87 24.765595699462434 26.128266033254157 25.378172271533945 23.72796599574947 88-89 23.9875 25.474999999999998 25.3 25.2375 90-91 24.637500000000003 25.85 23.7375 25.775 92-93 24.875 25.674999999999997 24.75 24.7 94-95 24.20605151287822 25.906476619154787 24.056014003500874 25.831457864466117 96-97 25.14064258032254 25.240655081885237 23.527940992624078 26.090761345168147 98-99 24.2625 26.75 24.5 24.4875 100-101 23.875 26.375 24.337500000000002 25.412499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.0 28 2.5 29 6.0 30 6.5 31 7.0 32 10.5 33 14.5 34 20.0 35 28.0 36 33.5 37 42.0 38 70.5 39 95.5 40 108.5 41 119.5 42 152.0 43 167.5 44 165.0 45 183.0 46 191.5 47 201.5 48 208.0 49 191.0 50 163.0 51 158.0 52 154.0 53 134.5 54 126.5 55 118.5 56 101.5 57 97.0 58 103.0 59 96.5 60 95.0 61 100.5 62 88.0 63 72.0 64 61.0 65 59.5 66 59.5 67 49.5 68 44.0 69 37.5 70 24.5 71 15.0 72 7.5 73 3.0 74 3.0 75 1.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0125 12-13 0.0 14-15 0.0125 16-17 0.0 18-19 0.0 20-21 0.0125 22-23 0.0 24-25 0.0 26-27 0.025 28-29 0.0 30-31 0.0 32-33 0.0125 34-35 0.0 36-37 0.0 38-39 0.0125 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0375 72-73 0.0 74-75 0.0 76-77 0.025 78-79 0.0 80-81 0.0 82-83 0.0375 84-85 0.025 86-87 0.0125 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.025 96-97 0.0125 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34508816120908 98.6 2 0.6045340050377833 1.2 3 0.0 0.0 4 0.05037783375314861 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.2125 0.0 0.0 0.0 0.0 70-71 0.32499999999999996 0.0 0.0 0.0 0.0 72-73 0.38749999999999996 0.0 0.0 0.0 0.0 74-75 0.5125 0.0 0.0 0.0 0.0 76-77 0.9125 0.0 0.0 0.0 0.0 78-79 1.275 0.0 0.0 0.0 0.0 80-81 1.45 0.0 0.0 0.0 0.0 82-83 1.725 0.0 0.0 0.0 0.0 84-85 2.175 0.0 0.0 0.0 0.0 86-87 2.7375 0.0 0.0 0.0 0.0 88-89 3.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1245989 spots for SRR3311780.sra Written 1245989 spots for SRR3311780.sra Read 1245989 spots for SRR3311780.sra Written 1245989 spots for SRR3311780.sra Read 1245989 spots for SRR3311780.sra Written 1245989 spots for SRR3311780.sra Read 1245989 spots for SRR3311780.sra Written 1245989 spots for SRR3311780.sra Read 1245989 spots for SRR3311780.sra Written 1245989 spots for SRR3311780.sra Read 1245989 spots for SRR3311780.sra Written 1245989 spots for SRR3311780.sra Read 1245989 spots for SRR3311780.sra Written 1245989 spots for SRR3311780.sra Read 1245989 spots for SRR3311780.sra Written 1245989 spots for SRR3311780.sra Read 1245989 spots for SRR3311780.sra Written 1245989 spots for SRR3311780.sra Read 1245989 spots for SRR3311780.sra Written 1245989 spots for SRR3311780.sra Read 1245989 spots for SRR3311780.sra Written 1245989 spots for SRR3311780.sra Read 1245989 spots for SRR3311780.sra Written 1245989 spots for SRR3311780.sra Read 1245989 spots for SRR3311780.sra Written 1245989 spots for SRR3311780.sra Read 1245989 spots for SRR3311780.sra Written 1245989 spots for SRR3311780.sra Read 1245989 spots for SRR3311780.sra Written 1245989 spots for SRR3311780.sra Read 1245989 spots for SRR3311780.sra Written 1245989 spots for SRR3311780.sra Read 1245989 spots for SRR3311780.sra Written 1245989 spots for SRR3311780.sra Read 1245989 spots for SRR3311780.sra Written 1245989 spots for SRR3311780.sra Read 1245989 spots for SRR3311780.sra Written 1245989 spots for SRR3311780.sra Read 1246005 spots for SRR3311780.sra Written 1246005 spots for SRR3311780.sra SRR ids: ['SRR3311780.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uwmdj5k6 SRR3311780.sra spots: 24919796 blocks: [[1, 1245989], [1245990, 2491978], [2491979, 3737967], [3737968, 4983956], [4983957, 6229945], [6229946, 7475934], [7475935, 8721923], [8721924, 9967912], [9967913, 11213901], [11213902, 12459890], [12459891, 13705879], [13705880, 14951868], [14951869, 16197857], [16197858, 17443846], [17443847, 18689835], [18689836, 19935824], [19935825, 21181813], [21181814, 22427802], [22427803, 23673791], [23673792, 24919796]] SRR3311780 file size 6717801 SRR3311780 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3311780 SRR3311780_1.fastq Input file: SRR3311780_1.fastq trimmed: SRR3311780-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:02:12 2024 >> started Tue Dec 10 01:02:25 2024 >> done (13.613s) 24919796 reads processed; of these: 730493 ( 2.93%) short reads filtered out after trimming by size control 846437 ( 3.40%) empty reads filtered out after trimming by size control 23342866 (93.67%) reads available; of these: 2901123 (12.43%) trimmed reads available after processing 20441743 (87.57%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 21818 0.09% 19 21051 0.09% 20 20692 0.09% 21 20162 0.09% 22 20317 0.09% 23 20019 0.09% 24 20364 0.09% 25 21032 0.09% 26 21190 0.09% 27 21180 0.09% 28 21908 0.09% 29 22033 0.09% 30 22348 0.10% 31 22618 0.10% 32 23011 0.10% 33 23098 0.10% 34 23312 0.10% 35 22759 0.10% 36 22072 0.09% 37 23487 0.10% 38 23677 0.10% 39 23808 0.10% 40 25206 0.11% 41 25505 0.11% 42 25515 0.11% 43 25835 0.11% 44 26249 0.11% 45 26513 0.11% 46 26843 0.11% 47 26523 0.11% 48 26376 0.11% 49 26332 0.11% 50 25526 0.11% 51 26300 0.11% 52 27264 0.12% 53 28010 0.12% 54 28598 0.12% 55 28362 0.12% 56 28604 0.12% 57 29417 0.13% 58 29733 0.13% 59 30008 0.13% 60 30647 0.13% 61 32199 0.14% 62 32121 0.14% 63 33060 0.14% 64 34188 0.15% 65 35319 0.15% 66 36373 0.16% 67 37879 0.16% 68 38712 0.17% 69 40545 0.17% 70 29825 0.13% 71 30251 0.13% 72 30718 0.13% 73 32675 0.14% 74 33218 0.14% 75 36350 0.16% 76 13982 0.06% 77 15814 0.07% 78 20069 0.09% 79 23286 0.10% 80 25950 0.11% 81 28366 0.12% 82 29670 0.13% 83 31070 0.13% 84 31972 0.14% 85 34342 0.15% 86 36206 0.16% 87 39283 0.17% 88 41407 0.18% 89 43832 0.19% 90 47660 0.20% 91 51823 0.22% 92 55979 0.24% 93 63687 0.27% 94 71600 0.31% 95 79851 0.34% 96 92870 0.40% 97 105409 0.45% 98 113675 0.49% 99 115554 0.50% 100 119011 0.51% 101 20441743 87.57% 23342866 reads passed initial QC criterion=sequence-density sequence-density=2.66 sequence-density-rank=1 fanout-score=60.91 fanout-score-rank=2 prefix-density=3.60 prefix-fanout=44.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=145.55 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=8.8 sequence=AAGAGGAGGGTCTTGTCGTTCTTGAGCTTGATGTCGCTGTGCTTCCAGTGGCCGTGGACGGTGTCGTACTTGAACATGTAGGTCATGTACTCGGTGGTGATGAAGGGGTCGTTGACGGCGACGAGCTCGATGTCATCGCTCTGGAGAGCAACCCTGGCGACGAGCCTCCCGATCCTTCCGAAACCGTTGATTCCGATCTTAATCTTGCCCATGGCGACG Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGT -o SRR3311780 - Input file: STDIN trimmed: SRR3311780-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 01:03:17 2024 >> started Tue Dec 10 01:03:28 2024 >> done (11.246s) 7780955 reads processed; of these: 405 ( 0.01%) short reads filtered out after trimming by size control 3 ( 0.00%) empty reads filtered out after trimming by size control 7780547 (99.99%) reads available; of these: 711959 ( 9.15%) trimmed reads available after processing 7068588 (90.85%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7245 0.09% 19 7110 0.09% 20 6834 0.09% 21 6745 0.09% 22 6736 0.09% 23 6664 0.09% 24 6720 0.09% 25 6944 0.09% 26 7143 0.09% 27 7223 0.09% 28 7270 0.09% 29 7388 0.09% 30 7527 0.10% 31 7478 0.10% 32 7692 0.10% 33 7721 0.10% 34 7895 0.10% 35 7700 0.10% 36 7478 0.10% 37 7822 0.10% 38 7901 0.10% 39 7993 0.10% 40 8412 0.11% 41 8469 0.11% 42 8510 0.11% 43 8701 0.11% 44 8765 0.11% 45 8913 0.11% 46 9047 0.12% 47 8659 0.11% 48 8874 0.11% 49 8778 0.11% 50 8608 0.11% 51 8899 0.11% 52 9288 0.12% 53 9377 0.12% 54 9639 0.12% 55 9498 0.12% 56 9615 0.12% 57 9919 0.13% 58 9882 0.13% 59 10056 0.13% 60 10208 0.13% 61 10755 0.14% 62 10813 0.14% 63 11091 0.14% 64 11371 0.15% 65 11898 0.15% 66 12135 0.16% 67 12559 0.16% 68 12797 0.16% 69 13569 0.17% 70 14269 0.18% 71 14840 0.19% 72 15598 0.20% 73 17169 0.22% 74 17839 0.23% 75 19722 0.25% 76 13207 0.17% 77 14195 0.18% 78 16095 0.21% 79 18147 0.23% 80 19831 0.25% 81 21656 0.28% 82 23397 0.30% 83 25480 0.33% 84 27218 0.35% 85 29617 0.38% 86 31435 0.40% 87 33394 0.43% 88 35986 0.46% 89 37824 0.49% 90 39969 0.51% 91 42595 0.55% 92 46363 0.60% 93 50396 0.65% 94 56575 0.73% 95 62217 0.80% 96 74166 0.95% 97 99826 1.28% 98 196817 2.53% 99 36027 0.46% 100 37428 0.48% 101 6130915 78.80% criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=14.24 fanout-score-rank=4 prefix-density=0.46 prefix-fanout=6.0 sequence=TTGTTGTTGCTGCCACTGGCGTAGCCGTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=153.61 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=8.5 sequence=AAGAGGAGGGTCTTGTCGTTCTTGAGCTTGATGTCGCTGTGCTTCCAGTGGCCGTGGACGGTGTCGTACTTGAACATGTAGGTCATGTACTCGGTGGTGATGAAGGGGTCGTTGACGGCGACGAGCTCGATGTCATCGCTCTGGAGAGCAACCCTGGCGACGAGCCTCCCGATCCTTCCGAAACCGTTGATTCCGATCTTAATCTTGCCCATGGCGACG Started job on | Dec 10 01:03:57 Started mapping on | Dec 10 01:03:57 Finished on | Dec 10 01:04:21 Mapping speed, Million of reads per hour | 3501.37 Number of input reads | 23342458 Average input read length | 96 UNIQUE READS: Uniquely mapped reads number | 22825197 Uniquely mapped reads % | 97.78% Average mapped length | 96.32 Number of splices: Total | 7080283 Number of splices: Annotated (sjdb) | 6778199 Number of splices: GT/AG | 6982858 Number of splices: GC/AG | 82469 Number of splices: AT/AC | 4281 Number of splices: Non-canonical | 10675 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.47 Insertion rate per base | 0.00% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 304047 % of reads mapped to multiple loci | 1.30% Number of reads mapped to too many loci | 119869 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.37% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 213214 213214 213214 N_multimapping 304047 304047 304047 N_noFeature 711811 22205014 944695 N_ambiguous 426987 1996 44820 UnstrandedReadsAssigned:21686399 PositiveStrandReadsAssigned:618187 NegativeStrandReadsAssigned:21835682 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=98 echo kmer=93 SRR3311780 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR3311780-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,342,458 reads, 21,590,886 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52973 SRR3311780.ke.tsv 35125 SRR3311780.se.tsv 88098 total ==> SRR3311780.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 20.7829 1.86426 PNS24247 1044 945 65.5709 5.20959 PNS24249 1928 1829 30.1649 1.23826 PNS24246 1044 945 65.5709 5.20959 PNS24248 1044 945 65.5709 5.20959 PNS24244 1471 1372 77.3395 4.23225 PNS24243 293 194 0 0 KQK14069 1603 1504 967.746 48.3101 KQK14071 474 375 93.8255 18.7851 ==> SRR3311780.se.tsv <== BRADI_1g14170v3 1278 BRADI_1g53295v3 64 BRADI_1g59795v3 202 BRADI_1g07683v3 0 BRADI_1g00485v3 49 BRADI_1g20270v3 971 BRADI_1g74790v3 683 BRADI_1g09890v3 0 BRADI_1g77505v3 141 BRADI_1g48960v3 0 SRR3311780 completed mapping pipeline successfully