Starting /dee2/code/volunteer_pipeline.sh SRR3311782 current disk space = 1523692740608 free memory = 1566279084 SRR3311782 SRAfilesize aac1686fde78533f76cc5d483425c5ad SRR3311782.sra SRR3311782.sra file validated SRR3311782 is single end SRR3311782 is conventional basespace SRR3311782 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3311782_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.9925 33.0 33.0 33.0 2.0 33.0 2 30.972 33.0 33.0 33.0 27.0 33.0 3 31.2775 33.0 33.0 33.0 27.0 33.0 4 31.75025 33.0 33.0 33.0 33.0 33.0 5 31.90375 33.0 33.0 33.0 33.0 33.0 6 35.2455 37.0 37.0 37.0 33.0 37.0 7 35.24475 37.0 37.0 37.0 33.0 37.0 8 35.44275 37.0 37.0 37.0 33.0 37.0 9 35.56975 37.0 37.0 37.0 33.0 37.0 10-11 35.3625 37.0 37.0 37.0 33.0 37.0 12-13 35.286375 37.0 37.0 37.0 33.0 37.0 14-15 35.296375 37.0 37.0 37.0 33.0 37.0 16-17 35.240375 37.0 37.0 37.0 33.0 37.0 18-19 35.279624999999996 37.0 37.0 37.0 33.0 37.0 20-21 35.2435 37.0 37.0 37.0 33.0 37.0 22-23 35.242374999999996 37.0 37.0 37.0 33.0 37.0 24-25 35.148250000000004 37.0 37.0 37.0 33.0 37.0 26-27 35.180625 37.0 37.0 37.0 33.0 37.0 28-29 35.171125 37.0 37.0 37.0 33.0 37.0 30-31 35.214375000000004 37.0 37.0 37.0 33.0 37.0 32-33 35.18375 37.0 37.0 37.0 33.0 37.0 34-35 35.24125 37.0 37.0 37.0 33.0 37.0 36-37 35.052125000000004 37.0 37.0 37.0 33.0 37.0 38-39 35.007 37.0 37.0 37.0 33.0 37.0 40-41 35.077124999999995 37.0 37.0 37.0 33.0 37.0 42-43 35.063500000000005 37.0 37.0 37.0 33.0 37.0 44-45 35.07525 37.0 37.0 37.0 33.0 37.0 46-47 34.946375 37.0 37.0 37.0 33.0 37.0 48-49 34.855000000000004 37.0 37.0 37.0 33.0 37.0 50-51 34.953 37.0 37.0 37.0 33.0 37.0 52-53 34.986 37.0 37.0 37.0 33.0 37.0 54-55 34.96025 37.0 37.0 37.0 33.0 37.0 56-57 34.844875 37.0 37.0 37.0 33.0 37.0 58-59 34.959999999999994 37.0 37.0 37.0 33.0 37.0 60-61 34.860125 37.0 37.0 37.0 33.0 37.0 62-63 34.80475 37.0 37.0 37.0 33.0 37.0 64-65 34.738249999999994 37.0 37.0 37.0 33.0 37.0 66-67 34.747249999999994 37.0 37.0 37.0 33.0 37.0 68-69 34.533 37.0 37.0 37.0 30.0 37.0 70-71 34.61987499999999 37.0 37.0 37.0 33.0 37.0 72-73 34.54774999999999 37.0 37.0 37.0 30.0 37.0 74-75 34.498875 37.0 37.0 37.0 27.0 37.0 76-77 34.558625 37.0 37.0 37.0 33.0 37.0 78-79 34.49912500000001 37.0 37.0 37.0 30.0 37.0 80-81 34.511875 37.0 37.0 37.0 30.0 37.0 82-83 34.418000000000006 37.0 37.0 37.0 30.0 37.0 84-85 34.37625 37.0 37.0 37.0 30.0 37.0 86-87 34.313625 37.0 37.0 37.0 30.0 37.0 88-89 34.17125 37.0 37.0 37.0 27.0 37.0 90-91 33.9845 37.0 37.0 37.0 27.0 37.0 92-93 33.974374999999995 37.0 37.0 37.0 27.0 37.0 94-95 33.971875 37.0 37.0 37.0 27.0 37.0 96-97 33.74487499999999 37.0 37.0 37.0 27.0 37.0 98-99 33.340625 37.0 37.0 37.0 24.5 37.0 100-101 32.076375 37.0 35.0 37.0 8.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 21.0 4 14.0 5 10.0 6 7.0 7 6.0 8 6.0 9 3.0 10 5.0 11 3.0 12 0.0 13 4.0 14 1.0 15 5.0 16 4.0 17 10.0 18 6.0 19 5.0 20 11.0 21 16.0 22 9.0 23 11.0 24 24.0 25 22.0 26 25.0 27 27.0 28 42.0 29 42.0 30 56.0 31 70.0 32 93.0 33 95.0 34 142.0 35 384.0 36 2795.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.494466048459465 12.832784923721208 9.153454980556386 48.51929404726294 2 23.925 19.25 36.975 19.85 3 21.975 23.400000000000002 23.7 30.925000000000004 4 25.0 31.374999999999996 20.9 22.725 5 24.925 32.675 23.474999999999998 18.925 6 19.775000000000002 33.425 24.474999999999998 22.325 7 17.925 19.875 40.925 21.275 8 18.875 21.85 29.675 29.599999999999998 9 20.525 19.425 33.575 26.474999999999998 10-11 24.6 29.825000000000003 20.9875 24.587500000000002 12-13 24.55 22.575 25.724999999999998 27.150000000000002 14-15 22.5625 25.362499999999997 26.9625 25.112499999999997 16-17 23.95 25.55 25.3 25.2 18-19 23.4375 25.362499999999997 25.637500000000003 25.5625 20-21 23.3 25.874999999999996 25.674999999999997 25.15 22-23 23.5375 26.0 24.9 25.5625 24-25 23.375 25.575 25.0125 26.0375 26-27 22.55 26.487500000000004 25.4875 25.474999999999998 28-29 23.3 25.3125 25.650000000000002 25.7375 30-31 22.5625 25.6 25.775 26.0625 32-33 22.4625 26.2875 25.8 25.45 34-35 24.5125 25.5125 24.275 25.7 36-37 23.6125 25.2125 24.9875 26.187500000000004 38-39 22.412499999999998 25.1875 26.737499999999997 25.662499999999998 40-41 22.525000000000002 25.174999999999997 26.0625 26.237500000000004 42-43 23.6625 25.624999999999996 24.625 26.087500000000002 44-45 23.7 25.912499999999998 25.9625 24.425 46-47 24.1625 25.362499999999997 24.962500000000002 25.5125 48-49 23.150000000000002 25.362499999999997 24.9875 26.5 50-51 22.525000000000002 25.362499999999997 26.6125 25.5 52-53 24.525 25.825 25.1875 24.462500000000002 54-55 23.8125 25.5625 25.2375 25.387500000000003 56-57 23.7125 25.55 24.5625 26.174999999999997 58-59 24.1125 25.974999999999998 24.55 25.362499999999997 60-61 23.75 25.324999999999996 24.6875 26.237500000000004 62-63 24.0375 25.587500000000002 25.275 25.1 64-65 24.5125 26.2125 24.575 24.7 66-67 24.2375 25.3 25.25 25.2125 68-69 23.2125 25.412499999999998 25.837500000000002 25.5375 70-71 24.875 25.6125 24.2 25.3125 72-73 24.25 25.25 24.625 25.874999999999996 74-75 23.7125 24.1125 26.3125 25.8625 76-77 24.575 25.662499999999998 25.337500000000002 24.425 78-79 24.0 25.025 25.137500000000003 25.837500000000002 80-81 23.549999999999997 25.874999999999996 24.875 25.7 82-83 23.724999999999998 24.825 25.525 25.924999999999997 84-85 24.337500000000002 24.762500000000003 25.0125 25.887500000000003 86-87 22.5875 26.224999999999998 25.637500000000003 25.55 88-89 24.587500000000002 25.6 25.025 24.7875 90-91 24.5125 25.650000000000002 24.0375 25.8 92-93 23.599999999999998 25.2 24.5 26.700000000000003 94-95 25.15 25.7375 24.2625 24.85 96-97 23.9 25.4625 24.637500000000003 26.0 98-99 24.615576947118388 25.14064258032254 24.590573821727716 25.653206650831358 100-101 24.875 26.200000000000003 24.337500000000002 24.587500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 3.0 28 4.0 29 5.0 30 6.0 31 7.0 32 13.0 33 23.0 34 35.5 35 46.5 36 50.0 37 50.0 38 76.5 39 102.5 40 119.0 41 147.0 42 171.0 43 190.5 44 199.0 45 197.5 46 190.0 47 207.5 48 205.5 49 171.0 50 170.5 51 163.0 52 130.5 53 111.0 54 113.0 55 114.0 56 96.5 57 83.5 58 76.5 59 73.5 60 81.0 61 74.5 62 58.5 63 54.0 64 54.5 65 55.0 66 49.0 67 45.0 68 43.0 69 36.0 70 27.0 71 22.0 72 17.5 73 9.0 74 5.0 75 3.5 76 4.5 77 4.0 78 1.5 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 16.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0125 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.07500000000000001 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.30000000000000004 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 4125367 spots for SRR3311782.sra Written 4125367 spots for SRR3311782.sra Read 4125367 spots for SRR3311782.sra Written 4125367 spots for SRR3311782.sra Read 4125367 spots for SRR3311782.sra Written 4125367 spots for SRR3311782.sra Read 4125367 spots for SRR3311782.sra Written 4125367 spots for SRR3311782.sra Read 4125367 spots for SRR3311782.sra Written 4125367 spots for SRR3311782.sra Read 4125367 spots for SRR3311782.sra Written 4125367 spots for SRR3311782.sra Read 4125383 spots for SRR3311782.sra Written 4125383 spots for SRR3311782.sra Read 4125367 spots for SRR3311782.sra Written 4125367 spots for SRR3311782.sra Read 4125367 spots for SRR3311782.sra Written 4125367 spots for SRR3311782.sra Read 4125367 spots for SRR3311782.sra Written 4125367 spots for SRR3311782.sra Read 4125367 spots for SRR3311782.sra Written 4125367 spots for SRR3311782.sra Read 4125367 spots for SRR3311782.sra Written 4125367 spots for SRR3311782.sra Read 4125367 spots for SRR3311782.sra Written 4125367 spots for SRR3311782.sra Read 4125367 spots for SRR3311782.sra Written 4125367 spots for SRR3311782.sra Read 4125367 spots for SRR3311782.sra Written 4125367 spots for SRR3311782.sra Read 4125367 spots for SRR3311782.sra Written 4125367 spots for SRR3311782.sra Read 4125367 spots for SRR3311782.sra Written 4125367 spots for SRR3311782.sra Read 4125367 spots for SRR3311782.sra Written 4125367 spots for SRR3311782.sra Read 4125367 spots for SRR3311782.sra Written 4125367 spots for SRR3311782.sra Read 4125367 spots for SRR3311782.sra Written 4125367 spots for SRR3311782.sra SRR ids: ['SRR3311782.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v6wb5hnd SRR3311782.sra spots: 82507356 blocks: [[1, 4125367], [4125368, 8250734], [8250735, 12376101], [12376102, 16501468], [16501469, 20626835], [20626836, 24752202], [24752203, 28877569], [28877570, 33002936], [33002937, 37128303], [37128304, 41253670], [41253671, 45379037], [45379038, 49504404], [49504405, 53629771], [53629772, 57755138], [57755139, 61880505], [61880506, 66005872], [66005873, 70131239], [70131240, 74256606], [74256607, 78381973], [78381974, 82507356]] SRR3311782 file size 22266053 SRR3311782 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3311782 SRR3311782_1.fastq Input file: SRR3311782_1.fastq trimmed: SRR3311782-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:06:46 2024 >> started Tue Dec 10 01:07:41 2024 >> done (55.506s) 82507356 reads processed; of these: 1343157 ( 1.63%) short reads filtered out after trimming by size control 308131 ( 0.37%) empty reads filtered out after trimming by size control 80856068 (98.00%) reads available; of these: 10997050 (13.60%) trimmed reads available after processing 69859018 (86.40%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 34176 0.04% 19 31905 0.04% 20 29589 0.04% 21 28221 0.03% 22 27204 0.03% 23 26452 0.03% 24 25720 0.03% 25 24592 0.03% 26 24127 0.03% 27 23495 0.03% 28 22956 0.03% 29 22663 0.03% 30 22610 0.03% 31 22189 0.03% 32 21840 0.03% 33 21709 0.03% 34 22113 0.03% 35 21584 0.03% 36 21521 0.03% 37 22302 0.03% 38 22149 0.03% 39 21862 0.03% 40 21937 0.03% 41 21857 0.03% 42 21800 0.03% 43 21797 0.03% 44 22146 0.03% 45 21941 0.03% 46 21554 0.03% 47 22500 0.03% 48 22809 0.03% 49 23419 0.03% 50 23016 0.03% 51 23510 0.03% 52 24310 0.03% 53 24548 0.03% 54 25031 0.03% 55 25435 0.03% 56 25892 0.03% 57 26771 0.03% 58 27880 0.03% 59 28184 0.03% 60 27977 0.03% 61 29594 0.04% 62 30763 0.04% 63 31683 0.04% 64 32187 0.04% 65 33304 0.04% 66 34496 0.04% 67 36671 0.05% 68 38126 0.05% 69 38820 0.05% 70 33056 0.04% 71 35145 0.04% 72 35622 0.04% 73 36553 0.05% 74 38353 0.05% 75 40229 0.05% 76 42431 0.05% 77 44446 0.05% 78 47142 0.06% 79 49100 0.06% 80 51275 0.06% 81 55687 0.07% 82 59417 0.07% 83 61828 0.08% 84 67332 0.08% 85 73066 0.09% 86 80155 0.10% 87 89890 0.11% 88 97065 0.12% 89 107764 0.13% 90 121499 0.15% 91 138262 0.17% 92 158330 0.20% 93 192892 0.24% 94 230750 0.29% 95 298731 0.37% 96 386151 0.48% 97 613287 0.76% 98 772335 0.96% 99 1376212 1.70% 100 4212108 5.21% 101 69859018 86.40% 80856068 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=48.29 fanout-score-rank=4 prefix-density=0.63 prefix-fanout=35.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=18 fanout-score=270.35 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=27.1 sequence=CAGCAGCAGCAC Started job on | Dec 10 01:08:04 Started mapping on | Dec 10 01:08:04 Finished on | Dec 10 01:09:24 Mapping speed, Million of reads per hour | 3638.52 Number of input reads | 80856068 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 78590369 Uniquely mapped reads % | 97.20% Average mapped length | 99.33 Number of splices: Total | 25857908 Number of splices: Annotated (sjdb) | 24945647 Number of splices: GT/AG | 25494928 Number of splices: GC/AG | 307713 Number of splices: AT/AC | 13652 Number of splices: Non-canonical | 41615 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 1.92 Insertion rate per base | 0.01% Insertion average length | 1.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1065006 % of reads mapped to multiple loci | 1.32% Number of reads mapped to too many loci | 780111 % of reads mapped to too many loci | 0.96% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.44% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1200693 1200693 1200693 N_multimapping 1065006 1065006 1065006 N_noFeature 2553925 76719388 3249453 N_ambiguous 1306776 5036 145935 UnstrandedReadsAssigned:74729668 PositiveStrandReadsAssigned:1865945 NegativeStrandReadsAssigned:75194981 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR3311782 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR3311782-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 80,856,068 reads, 75,252,022 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,288 rounds 52973 SRR3311782.ke.tsv 35125 SRR3311782.se.tsv 88098 total ==> SRR3311782.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 259.788 7.15226 PNS24247 1044 945 83.1454 2.02748 PNS24249 1928 1829 108.261 1.36398 PNS24246 1044 945 83.1454 2.02748 PNS24248 1044 945 83.1454 2.02748 PNS24244 1471 1372 440.516 7.39873 PNS24243 293 194 0 0 KQK14069 1603 1504 1432.63 21.9501 KQK14071 474 375 164.57 10.1127 ==> SRR3311782.se.tsv <== BRADI_1g14170v3 1871 BRADI_1g53295v3 407 BRADI_1g59795v3 754 BRADI_1g07683v3 0 BRADI_1g00485v3 352 BRADI_1g20270v3 3574 BRADI_1g74790v3 2437 BRADI_1g09890v3 0 BRADI_1g77505v3 389 BRADI_1g48960v3 0 SRR3311782 completed mapping pipeline successfully