Starting /dee2/code/volunteer_pipeline.sh SRR3311805 current disk space = 1523758137344 free memory = 1569153664 SRR3311805 SRAfilesize 73dd3c8fcb363cd6ad203c7c6deaded5 SRR3311805.sra SRR3311805.sra file validated SRR3311805 is single end SRR3311805 is conventional basespace SRR3311805 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3311805_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.96525 33.0 33.0 33.0 2.0 33.0 2 30.99575 33.0 33.0 33.0 27.0 33.0 3 31.29925 33.0 33.0 33.0 27.0 33.0 4 31.5455 33.0 33.0 33.0 27.0 33.0 5 31.7905 33.0 33.0 33.0 33.0 33.0 6 35.03075 37.0 37.0 37.0 33.0 37.0 7 35.19975 37.0 37.0 37.0 33.0 37.0 8 35.212 37.0 37.0 37.0 33.0 37.0 9 35.376 37.0 37.0 37.0 33.0 37.0 10-11 35.295874999999995 37.0 37.0 37.0 33.0 37.0 12-13 35.213499999999996 37.0 37.0 37.0 33.0 37.0 14-15 35.1475 37.0 37.0 37.0 33.0 37.0 16-17 35.207875 37.0 37.0 37.0 33.0 37.0 18-19 35.291125 37.0 37.0 37.0 33.0 37.0 20-21 35.25725 37.0 37.0 37.0 33.0 37.0 22-23 35.20275 37.0 37.0 37.0 33.0 37.0 24-25 35.1225 37.0 37.0 37.0 33.0 37.0 26-27 35.1955 37.0 37.0 37.0 33.0 37.0 28-29 35.191375 37.0 37.0 37.0 33.0 37.0 30-31 35.170375 37.0 37.0 37.0 33.0 37.0 32-33 35.122749999999996 37.0 37.0 37.0 33.0 37.0 34-35 35.118750000000006 37.0 37.0 37.0 33.0 37.0 36-37 35.09375 37.0 37.0 37.0 33.0 37.0 38-39 35.081374999999994 37.0 37.0 37.0 33.0 37.0 40-41 35.0125 37.0 37.0 37.0 33.0 37.0 42-43 35.018 37.0 37.0 37.0 33.0 37.0 44-45 34.9785 37.0 37.0 37.0 33.0 37.0 46-47 34.948375 37.0 37.0 37.0 33.0 37.0 48-49 34.973875 37.0 37.0 37.0 33.0 37.0 50-51 34.902875 37.0 37.0 37.0 33.0 37.0 52-53 34.93375 37.0 37.0 37.0 33.0 37.0 54-55 34.90625 37.0 37.0 37.0 33.0 37.0 56-57 34.890625 37.0 37.0 37.0 33.0 37.0 58-59 34.915375 37.0 37.0 37.0 33.0 37.0 60-61 34.86875 37.0 37.0 37.0 33.0 37.0 62-63 34.794375 37.0 37.0 37.0 33.0 37.0 64-65 34.794250000000005 37.0 37.0 37.0 33.0 37.0 66-67 34.644999999999996 37.0 37.0 37.0 33.0 37.0 68-69 34.5385 37.0 37.0 37.0 27.0 37.0 70-71 34.554 37.0 37.0 37.0 27.0 37.0 72-73 34.646 37.0 37.0 37.0 33.0 37.0 74-75 34.625125 37.0 37.0 37.0 33.0 37.0 76-77 34.58125 37.0 37.0 37.0 30.0 37.0 78-79 34.45675 37.0 37.0 37.0 30.0 37.0 80-81 34.512 37.0 37.0 37.0 33.0 37.0 82-83 34.40075 37.0 37.0 37.0 27.0 37.0 84-85 34.2685 37.0 37.0 37.0 27.0 37.0 86-87 34.266875 37.0 37.0 37.0 27.0 37.0 88-89 34.139624999999995 37.0 37.0 37.0 27.0 37.0 90-91 34.029375 37.0 37.0 37.0 27.0 37.0 92-93 34.084875 37.0 37.0 37.0 27.0 37.0 94-95 34.00325 37.0 37.0 37.0 27.0 37.0 96-97 33.854375000000005 37.0 37.0 37.0 27.0 37.0 98-99 33.47225 37.0 37.0 37.0 24.5 37.0 100-101 32.05875 37.0 35.0 37.0 12.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 32.0 3 22.0 4 7.0 5 6.0 6 4.0 7 3.0 8 8.0 9 4.0 10 2.0 11 3.0 12 2.0 13 1.0 14 6.0 15 8.0 16 4.0 17 6.0 18 6.0 19 6.0 20 6.0 21 11.0 22 8.0 23 14.0 24 30.0 25 22.0 26 23.0 27 43.0 28 37.0 29 42.0 30 50.0 31 84.0 32 87.0 33 129.0 34 187.0 35 419.0 36 2678.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.447958596894765 17.9700977573318 8.424381828637149 34.15756181713628 2 23.65 19.8 34.825 21.725 3 19.8 25.924999999999997 27.200000000000003 27.075 4 24.099999999999998 31.8 23.1 21.0 5 23.925 34.525 22.475 19.075 6 20.4 32.775 24.425 22.400000000000002 7 16.85 21.349999999999998 39.85 21.95 8 19.2 22.625 29.549999999999997 28.625 9 18.2 21.7 31.924999999999997 28.175 10-11 23.8375 30.0875 21.4125 24.6625 12-13 23.0 23.8625 26.137500000000003 27.0 14-15 22.275 26.200000000000003 26.825 24.7 16-17 22.5625 26.924999999999997 26.3625 24.15 18-19 22.9875 26.487500000000004 25.2 25.324999999999996 20-21 22.5 27.4125 25.374999999999996 24.712500000000002 22-23 23.275000000000002 26.887499999999996 25.525 24.3125 24-25 23.05 27.05 24.7 25.2 26-27 22.3 26.825 25.2 25.674999999999997 28-29 22.5625 26.637499999999996 25.55 25.25 30-31 22.5875 27.1375 25.2875 24.9875 32-33 22.325 26.437500000000004 25.5125 25.724999999999998 34-35 22.575 27.075 25.7375 24.6125 36-37 22.2625 26.6 25.4375 25.7 38-39 22.537499999999998 26.25 25.974999999999998 25.2375 40-41 22.3875 26.637499999999996 25.900000000000002 25.074999999999996 42-43 22.4875 25.3125 25.0625 27.1375 44-45 22.95 26.424999999999997 25.4375 25.1875 46-47 22.900000000000002 26.1625 25.837500000000002 25.1 48-49 23.025000000000002 26.950000000000003 25.0 25.025 50-51 22.4875 26.787499999999998 25.724999999999998 25.0 52-53 23.425 26.8625 24.9 24.8125 54-55 23.1875 25.900000000000002 25.3 25.6125 56-57 21.8625 26.7125 26.0125 25.412499999999998 58-59 22.75 26.0 25.412499999999998 25.837500000000002 60-61 23.6875 25.9875 25.1 25.224999999999998 62-63 23.1875 26.075 25.35 25.387500000000003 64-65 23.3 26.375 24.9125 25.412499999999998 66-67 22.825 26.337500000000002 25.837500000000002 25.0 68-69 22.3125 26.5625 25.887500000000003 25.2375 70-71 23.3125 26.5375 25.2 24.95 72-73 22.3875 26.4625 25.3125 25.837500000000002 74-75 22.9375 26.125 26.400000000000002 24.5375 76-77 22.525000000000002 26.0125 25.825 25.637500000000003 78-79 23.3125 26.05 24.525 26.1125 80-81 22.475 26.0 26.25 25.275 82-83 23.1625 27.3 24.725 24.8125 84-85 23.4875 25.4875 25.275 25.75 86-87 23.0125 26.2625 25.3125 25.412499999999998 88-89 23.3375 25.8125 25.387500000000003 25.4625 90-91 23.200000000000003 26.1125 25.4 25.2875 92-93 22.1375 25.8125 26.325 25.724999999999998 94-95 23.1 25.5625 25.85 25.4875 96-97 23.7375 25.75 25.2125 25.3 98-99 22.67383691845923 26.588294147073537 26.163081540770385 24.574787393696848 100-101 22.8625 26.75 24.975 25.412499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 1.5 27 3.0 28 1.5 29 3.0 30 7.0 31 10.0 32 15.5 33 20.5 34 27.5 35 40.5 36 62.0 37 71.5 38 92.5 39 128.0 40 145.5 41 160.5 42 178.0 43 191.5 44 208.0 45 218.5 46 218.0 47 203.5 48 188.0 49 191.5 50 184.0 51 159.5 52 136.5 53 119.5 54 117.0 55 107.0 56 92.5 57 86.5 58 79.0 59 78.0 60 66.5 61 58.0 62 57.5 63 50.5 64 40.0 65 37.0 66 33.0 67 24.5 68 26.5 69 23.0 70 12.5 71 9.5 72 6.5 73 2.0 74 1.0 75 1.0 76 1.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 13.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.05 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3149241 spots for SRR3311805.sra Written 3149241 spots for SRR3311805.sra Read 3149241 spots for SRR3311805.sra Written 3149241 spots for SRR3311805.sra Read 3149241 spots for SRR3311805.sra Written 3149241 spots for SRR3311805.sra Read 3149248 spots for SRR3311805.sra Written 3149248 spots for SRR3311805.sra Read 3149241 spots for SRR3311805.sra Written 3149241 spots for SRR3311805.sra Read 3149241 spots for SRR3311805.sra Written 3149241 spots for SRR3311805.sra Read 3149241 spots for SRR3311805.sra Written 3149241 spots for SRR3311805.sra Read 3149241 spots for SRR3311805.sra Written 3149241 spots for SRR3311805.sra Read 3149241 spots for SRR3311805.sra Written 3149241 spots for SRR3311805.sra Read 3149241 spots for SRR3311805.sra Written 3149241 spots for SRR3311805.sra Read 3149241 spots for SRR3311805.sra Written 3149241 spots for SRR3311805.sra Read 3149241 spots for SRR3311805.sra Written 3149241 spots for SRR3311805.sra Read 3149241 spots for SRR3311805.sra Written 3149241 spots for SRR3311805.sra Read 3149241 spots for SRR3311805.sra Written 3149241 spots for SRR3311805.sra Read 3149241 spots for SRR3311805.sra Written 3149241 spots for SRR3311805.sra Read 3149241 spots for SRR3311805.sra Written 3149241 spots for SRR3311805.sra Read 3149241 spots for SRR3311805.sra Written 3149241 spots for SRR3311805.sra Read 3149241 spots for SRR3311805.sra Written 3149241 spots for SRR3311805.sra Read 3149241 spots for SRR3311805.sra Written 3149241 spots for SRR3311805.sra Read 3149241 spots for SRR3311805.sra Written 3149241 spots for SRR3311805.sra SRR ids: ['SRR3311805.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rhr6rhbw SRR3311805.sra spots: 62984827 blocks: [[1, 3149241], [3149242, 6298482], [6298483, 9447723], [9447724, 12596964], [12596965, 15746205], [15746206, 18895446], [18895447, 22044687], [22044688, 25193928], [25193929, 28343169], [28343170, 31492410], [31492411, 34641651], [34641652, 37790892], [37790893, 40940133], [40940134, 44089374], [44089375, 47238615], [47238616, 50387856], [50387857, 53537097], [53537098, 56686338], [56686339, 59835579], [59835580, 62984827]] SRR3311805 file size 16994985 SRR3311805 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3311805 SRR3311805_1.fastq Input file: SRR3311805_1.fastq trimmed: SRR3311805-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:06:56 2024 >> started Tue Dec 10 01:07:33 2024 >> done (36.899s) 62984827 reads processed; of these: 946381 ( 1.50%) short reads filtered out after trimming by size control 232279 ( 0.37%) empty reads filtered out after trimming by size control 61806167 (98.13%) reads available; of these: 8284151 (13.40%) trimmed reads available after processing 53522016 (86.60%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 24814 0.04% 19 23056 0.04% 20 21535 0.03% 21 20828 0.03% 22 20080 0.03% 23 19289 0.03% 24 18787 0.03% 25 18202 0.03% 26 17492 0.03% 27 17191 0.03% 28 16813 0.03% 29 16450 0.03% 30 16927 0.03% 31 16125 0.03% 32 16179 0.03% 33 16240 0.03% 34 16199 0.03% 35 15858 0.03% 36 16008 0.03% 37 16442 0.03% 38 16314 0.03% 39 16203 0.03% 40 16578 0.03% 41 16270 0.03% 42 16252 0.03% 43 16294 0.03% 44 16198 0.03% 45 16422 0.03% 46 16094 0.03% 47 16604 0.03% 48 16742 0.03% 49 17133 0.03% 50 17028 0.03% 51 17301 0.03% 52 17741 0.03% 53 18610 0.03% 54 18645 0.03% 55 18955 0.03% 56 19242 0.03% 57 19870 0.03% 58 20722 0.03% 59 20954 0.03% 60 21120 0.03% 61 21934 0.04% 62 22511 0.04% 63 23730 0.04% 64 23632 0.04% 65 24355 0.04% 66 25341 0.04% 67 26727 0.04% 68 27856 0.05% 69 28837 0.05% 70 24691 0.04% 71 26340 0.04% 72 26911 0.04% 73 27740 0.04% 74 28924 0.05% 75 30198 0.05% 76 31830 0.05% 77 33249 0.05% 78 35191 0.06% 79 36880 0.06% 80 38609 0.06% 81 42386 0.07% 82 45027 0.07% 83 47323 0.08% 84 50681 0.08% 85 55806 0.09% 86 60795 0.10% 87 67964 0.11% 88 74081 0.12% 89 82116 0.13% 90 92558 0.15% 91 104735 0.17% 92 121216 0.20% 93 147473 0.24% 94 176045 0.28% 95 228688 0.37% 96 296681 0.48% 97 465608 0.75% 98 589090 0.95% 99 1049192 1.70% 100 3149393 5.10% 101 53522016 86.60% 61806167 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=51.24 fanout-score-rank=5 prefix-density=0.56 prefix-fanout=38.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=304.33 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=26.1 sequence=CAGCAGCAGCAC Started job on | Dec 10 01:08:22 Started mapping on | Dec 10 01:08:22 Finished on | Dec 10 01:09:19 Mapping speed, Million of reads per hour | 3903.55 Number of input reads | 61806167 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 60178600 Uniquely mapped reads % | 97.37% Average mapped length | 99.34 Number of splices: Total | 19388054 Number of splices: Annotated (sjdb) | 18663048 Number of splices: GT/AG | 19113978 Number of splices: GC/AG | 230139 Number of splices: AT/AC | 10642 Number of splices: Non-canonical | 33295 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 1.81 Insertion rate per base | 0.01% Insertion average length | 1.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 855305 % of reads mapped to multiple loci | 1.38% Number of reads mapped to too many loci | 439158 % of reads mapped to too many loci | 0.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.47% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 772262 772262 772262 N_multimapping 855305 855305 855305 N_noFeature 2370869 58610247 2921082 N_ambiguous 1119371 4378 110602 UnstrandedReadsAssigned:56688360 PositiveStrandReadsAssigned:1563975 NegativeStrandReadsAssigned:57146916 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR3311805 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR3311805-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 61,806,167 reads, 57,227,636 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,262 rounds 52973 SRR3311805.ke.tsv 35125 SRR3311805.se.tsv 88098 total ==> SRR3311805.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 198.608 7.17294 PNS24247 1044 945 117.297 3.75215 PNS24249 1928 1829 73.5705 1.21595 PNS24246 1044 945 117.297 3.75215 PNS24248 1044 945 117.297 3.75215 PNS24244 1471 1372 545.931 12.0284 PNS24243 293 194 1 0.15582 KQK14069 1603 1504 6943.41 139.557 KQK14071 474 375 378.65 30.5233 ==> SRR3311805.se.tsv <== BRADI_1g14170v3 7998 BRADI_1g53295v3 435 BRADI_1g59795v3 847 BRADI_1g07683v3 0 BRADI_1g00485v3 383 BRADI_1g20270v3 3657 BRADI_1g74790v3 1895 BRADI_1g09890v3 0 BRADI_1g77505v3 497 BRADI_1g48960v3 2 SRR3311805 completed mapping pipeline successfully