Starting /dee2/code/volunteer_pipeline.sh SRR3311866 current disk space = 1523735801856 free memory = 1568478096 SRR3311866 SRAfilesize 5772a8b0e58aaf6bf2d50fccabdee583 SRR3311866.sra SRR3311866.sra file validated SRR3311866 is single end SRR3311866 is conventional basespace SRR3311866 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3311866_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.77875 33.0 33.0 33.0 2.0 33.0 2 30.85 33.0 33.0 33.0 27.0 33.0 3 31.227 33.0 33.0 33.0 27.0 33.0 4 31.661 33.0 33.0 33.0 27.0 33.0 5 31.77025 33.0 33.0 33.0 33.0 33.0 6 35.1725 37.0 37.0 37.0 33.0 37.0 7 35.299 37.0 37.0 37.0 33.0 37.0 8 35.45325 37.0 37.0 37.0 33.0 37.0 9 35.60375 37.0 37.0 37.0 33.0 37.0 10-11 35.4615 37.0 37.0 37.0 33.0 37.0 12-13 35.402125 37.0 37.0 37.0 33.0 37.0 14-15 35.352625 37.0 37.0 37.0 33.0 37.0 16-17 35.39625 37.0 37.0 37.0 33.0 37.0 18-19 35.360125 37.0 37.0 37.0 33.0 37.0 20-21 35.306250000000006 37.0 37.0 37.0 33.0 37.0 22-23 35.240750000000006 37.0 37.0 37.0 33.0 37.0 24-25 35.238625 37.0 37.0 37.0 33.0 37.0 26-27 35.202375 37.0 37.0 37.0 33.0 37.0 28-29 35.264125 37.0 37.0 37.0 33.0 37.0 30-31 35.256 37.0 37.0 37.0 33.0 37.0 32-33 35.2675 37.0 37.0 37.0 33.0 37.0 34-35 35.267625 37.0 37.0 37.0 33.0 37.0 36-37 35.21775 37.0 37.0 37.0 33.0 37.0 38-39 35.22475 37.0 37.0 37.0 33.0 37.0 40-41 35.2975 37.0 37.0 37.0 33.0 37.0 42-43 35.186125000000004 37.0 37.0 37.0 33.0 37.0 44-45 35.122375000000005 37.0 37.0 37.0 33.0 37.0 46-47 35.169375 37.0 37.0 37.0 33.0 37.0 48-49 35.157375 37.0 37.0 37.0 33.0 37.0 50-51 35.1185 37.0 37.0 37.0 33.0 37.0 52-53 35.188500000000005 37.0 37.0 37.0 33.0 37.0 54-55 35.148875000000004 37.0 37.0 37.0 33.0 37.0 56-57 35.024375000000006 37.0 37.0 37.0 33.0 37.0 58-59 34.9955 37.0 37.0 37.0 33.0 37.0 60-61 35.0005 37.0 37.0 37.0 33.0 37.0 62-63 35.04075 37.0 37.0 37.0 33.0 37.0 64-65 35.05825 37.0 37.0 37.0 33.0 37.0 66-67 34.911875 37.0 37.0 37.0 33.0 37.0 68-69 34.8295 37.0 37.0 37.0 33.0 37.0 70-71 34.770250000000004 37.0 37.0 37.0 30.0 37.0 72-73 34.775499999999994 37.0 37.0 37.0 33.0 37.0 74-75 34.820750000000004 37.0 37.0 37.0 33.0 37.0 76-77 34.7715 37.0 37.0 37.0 33.0 37.0 78-79 34.791375 37.0 37.0 37.0 33.0 37.0 80-81 34.739000000000004 37.0 37.0 37.0 33.0 37.0 82-83 34.66375 37.0 37.0 37.0 33.0 37.0 84-85 34.6395 37.0 37.0 37.0 33.0 37.0 86-87 34.618125 37.0 37.0 37.0 33.0 37.0 88-89 34.509125 37.0 37.0 37.0 33.0 37.0 90-91 34.356 37.0 37.0 37.0 27.0 37.0 92-93 34.4405 37.0 37.0 37.0 33.0 37.0 94-95 34.341625 37.0 37.0 37.0 30.0 37.0 96-97 34.171625 37.0 37.0 37.0 27.0 37.0 98-99 33.778 37.0 37.0 37.0 27.0 37.0 100-101 32.62975 37.0 35.0 37.0 14.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 32.0 3 14.0 4 11.0 5 9.0 6 4.0 7 3.0 8 4.0 9 2.0 10 1.0 11 0.0 12 2.0 13 2.0 14 4.0 15 6.0 16 2.0 17 3.0 18 7.0 19 9.0 20 10.0 21 4.0 22 1.0 23 12.0 24 23.0 25 27.0 26 25.0 27 39.0 28 39.0 29 44.0 30 42.0 31 77.0 32 77.0 33 125.0 34 176.0 35 370.0 36 2794.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.86554115164305 15.16430509496533 7.567078685559241 39.403075067832376 2 24.3 20.5 34.699999999999996 20.5 3 20.349999999999998 25.0 27.1 27.55 4 23.525 31.874999999999996 21.725 22.875 5 23.974999999999998 32.6 21.875 21.55 6 20.674999999999997 33.975 23.575 21.775 7 17.224999999999998 20.95 39.875 21.95 8 20.349999999999998 22.325 26.700000000000003 30.625000000000004 9 19.45 19.975 30.95 29.625 10-11 24.2 30.025000000000002 21.3 24.474999999999998 12-13 23.9375 22.6125 25.1 28.349999999999998 14-15 22.5875 25.674999999999997 26.474999999999998 25.2625 16-17 23.4125 25.4 25.174999999999997 26.0125 18-19 23.5125 26.187500000000004 24.65 25.650000000000002 20-21 22.6875 26.474999999999998 25.3 25.5375 22-23 23.1875 26.974999999999998 24.637500000000003 25.2 24-25 23.8625 25.074999999999996 24.962500000000002 26.1 26-27 22.8125 26.224999999999998 25.624999999999996 25.337500000000002 28-29 23.4625 25.674999999999997 24.887500000000003 25.974999999999998 30-31 22.912499999999998 26.35 24.587500000000002 26.150000000000002 32-33 23.1625 26.9625 25.124999999999996 24.75 34-35 23.2625 26.937499999999996 23.75 26.05 36-37 22.2 26.4625 25.5 25.837500000000002 38-39 23.3875 26.087500000000002 24.7875 25.7375 40-41 22.575 26.8375 25.025 25.5625 42-43 23.875 25.8 25.025 25.3 44-45 23.7375 25.900000000000002 25.2875 25.074999999999996 46-47 23.1875 26.187500000000004 25.387500000000003 25.2375 48-49 23.9125 25.6125 23.5 26.974999999999998 50-51 22.900000000000002 25.95 25.624999999999996 25.525 52-53 23.6375 25.937500000000004 24.9875 25.4375 54-55 24.075 25.837500000000002 24.75 25.337500000000002 56-57 23.4375 25.7875 25.124999999999996 25.650000000000002 58-59 23.3375 25.55 25.374999999999996 25.7375 60-61 23.65 25.412499999999998 24.675 26.2625 62-63 23.325000000000003 25.937500000000004 25.35 25.387500000000003 64-65 23.95 25.6 25.2625 25.1875 66-67 23.724999999999998 25.35 25.087500000000002 25.837500000000002 68-69 22.8 25.85 26.224999999999998 25.124999999999996 70-71 23.5875 25.25 25.2 25.9625 72-73 23.45 25.124999999999996 25.7 25.724999999999998 74-75 23.9875 26.237500000000004 24.837500000000002 24.9375 76-77 23.799999999999997 26.224999999999998 24.575 25.4 78-79 23.75 25.174999999999997 25.087500000000002 25.9875 80-81 23.45 26.450000000000003 24.5375 25.5625 82-83 23.575 26.35 24.775 25.3 84-85 25.1 25.3 24.462500000000002 25.137500000000003 86-87 23.6875 24.587500000000002 26.337500000000002 25.387500000000003 88-89 24.5125 25.112499999999997 24.55 25.825 90-91 23.2375 25.8 24.75 26.2125 92-93 23.75 26.125 24.3875 25.7375 94-95 24.2375 25.687500000000004 24.275 25.8 96-97 24.025 25.4625 24.825 25.687500000000004 98-99 23.302912864108013 25.51568946118265 25.678209776222026 25.50318789848731 100-101 23.474999999999998 26.224999999999998 24.337500000000002 25.9625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 2.0 27 4.0 28 4.5 29 3.5 30 5.0 31 7.5 32 13.0 33 21.0 34 26.0 35 32.5 36 50.0 37 65.5 38 80.0 39 104.0 40 131.0 41 159.0 42 161.5 43 177.0 44 202.0 45 197.5 46 206.0 47 210.0 48 189.5 49 166.0 50 161.0 51 162.0 52 140.0 53 122.0 54 110.0 55 96.0 56 96.5 57 96.0 58 91.0 59 86.5 60 77.5 61 74.5 62 75.5 63 62.5 64 53.0 65 52.5 66 53.0 67 47.5 68 33.0 69 27.0 70 21.5 71 12.0 72 10.0 73 9.0 74 5.5 75 3.5 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 17.075000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0125 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 4104439 spots for SRR3311866.sra Written 4104439 spots for SRR3311866.sra Read 4104439 spots for SRR3311866.sra Written 4104439 spots for SRR3311866.sra Read 4104439 spots for SRR3311866.sra Written 4104439 spots for SRR3311866.sra Read 4104439 spots for SRR3311866.sra Written 4104439 spots for SRR3311866.sra Read 4104439 spots for SRR3311866.sra Written 4104439 spots for SRR3311866.sra Read 4104439 spots for SRR3311866.sra Written 4104439 spots for SRR3311866.sra Read 4104441 spots for SRR3311866.sra Written 4104441 spots for SRR3311866.sra Read 4104439 spots for SRR3311866.sra Written 4104439 spots for SRR3311866.sra Read 4104439 spots for SRR3311866.sra Written 4104439 spots for SRR3311866.sra Read 4104439 spots for SRR3311866.sra Written 4104439 spots for SRR3311866.sra Read 4104439 spots for SRR3311866.sra Written 4104439 spots for SRR3311866.sra Read 4104439 spots for SRR3311866.sra Written 4104439 spots for SRR3311866.sra Read 4104439 spots for SRR3311866.sra Written 4104439 spots for SRR3311866.sra Read 4104439 spots for SRR3311866.sra Written 4104439 spots for SRR3311866.sra Read 4104439 spots for SRR3311866.sra Written 4104439 spots for SRR3311866.sra Read 4104439 spots for SRR3311866.sra Written 4104439 spots for SRR3311866.sra Read 4104439 spots for SRR3311866.sra Written 4104439 spots for SRR3311866.sra Read 4104439 spots for SRR3311866.sra Written 4104439 spots for SRR3311866.sra Read 4104439 spots for SRR3311866.sra Written 4104439 spots for SRR3311866.sra Read 4104439 spots for SRR3311866.sra Written 4104439 spots for SRR3311866.sra SRR ids: ['SRR3311866.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vjizzypt SRR3311866.sra spots: 82088782 blocks: [[1, 4104439], [4104440, 8208878], [8208879, 12313317], [12313318, 16417756], [16417757, 20522195], [20522196, 24626634], [24626635, 28731073], [28731074, 32835512], [32835513, 36939951], [36939952, 41044390], [41044391, 45148829], [45148830, 49253268], [49253269, 53357707], [53357708, 57462146], [57462147, 61566585], [61566586, 65671024], [65671025, 69775463], [69775464, 73879902], [73879903, 77984341], [77984342, 82088782]] SRR3311866 file size 22153053 SRR3311866 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3311866 SRR3311866_1.fastq Input file: SRR3311866_1.fastq trimmed: SRR3311866-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:10:15 2024 >> started Tue Dec 10 01:10:57 2024 >> done (41.508s) 82088782 reads processed; of these: 1193830 ( 1.45%) short reads filtered out after trimming by size control 288468 ( 0.35%) empty reads filtered out after trimming by size control 80606484 (98.19%) reads available; of these: 10578817 (13.12%) trimmed reads available after processing 70027667 (86.88%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 30636 0.04% 19 28476 0.04% 20 26454 0.03% 21 25612 0.03% 22 24765 0.03% 23 23956 0.03% 24 23231 0.03% 25 22318 0.03% 26 21822 0.03% 27 21242 0.03% 28 21173 0.03% 29 20489 0.03% 30 20464 0.03% 31 20239 0.03% 32 20144 0.02% 33 20175 0.03% 34 19946 0.02% 35 19853 0.02% 36 19907 0.02% 37 20319 0.03% 38 20067 0.02% 39 20370 0.03% 40 20514 0.03% 41 20671 0.03% 42 20405 0.03% 43 20311 0.03% 44 20577 0.03% 45 20281 0.03% 46 20426 0.03% 47 20862 0.03% 48 21086 0.03% 49 21682 0.03% 50 21698 0.03% 51 22110 0.03% 52 22600 0.03% 53 23152 0.03% 54 23904 0.03% 55 24405 0.03% 56 25088 0.03% 57 25349 0.03% 58 26264 0.03% 59 27067 0.03% 60 27459 0.03% 61 28469 0.04% 62 29834 0.04% 63 31063 0.04% 64 31404 0.04% 65 32327 0.04% 66 33691 0.04% 67 35675 0.04% 68 36728 0.05% 69 38512 0.05% 70 31149 0.04% 71 32956 0.04% 72 33788 0.04% 73 35116 0.04% 74 36234 0.04% 75 38357 0.05% 76 40249 0.05% 77 41935 0.05% 78 44459 0.06% 79 46716 0.06% 80 49202 0.06% 81 53175 0.07% 82 56820 0.07% 83 58942 0.07% 84 63903 0.08% 85 70093 0.09% 86 76410 0.09% 87 85721 0.11% 88 92726 0.12% 89 103798 0.13% 90 116626 0.14% 91 133812 0.17% 92 152602 0.19% 93 186019 0.23% 94 222946 0.28% 95 290359 0.36% 96 374655 0.46% 97 595703 0.74% 98 749103 0.93% 99 1329232 1.65% 100 4070739 5.05% 101 70027667 86.88% 80606484 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=54.57 fanout-score-rank=2 prefix-density=0.81 prefix-fanout=39.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=11 fanout-score=221.05 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=24.9 sequence=CAGCAGCAGCAC Started job on | Dec 10 01:11:14 Started mapping on | Dec 10 01:11:15 Finished on | Dec 10 01:12:29 Mapping speed, Million of reads per hour | 3921.40 Number of input reads | 80606484 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 78512729 Uniquely mapped reads % | 97.40% Average mapped length | 99.34 Number of splices: Total | 25203771 Number of splices: Annotated (sjdb) | 24328150 Number of splices: GT/AG | 24843347 Number of splices: GC/AG | 301944 Number of splices: AT/AC | 13353 Number of splices: Non-canonical | 45127 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.79 Insertion rate per base | 0.01% Insertion average length | 1.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1054538 % of reads mapped to multiple loci | 1.31% Number of reads mapped to too many loci | 561723 % of reads mapped to too many loci | 0.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.53% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1039217 1039217 1039217 N_multimapping 1054538 1054538 1054538 N_noFeature 2683314 76508732 3428503 N_ambiguous 1391555 5113 146394 UnstrandedReadsAssigned:74437860 PositiveStrandReadsAssigned:1998884 NegativeStrandReadsAssigned:74937832 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR3311866 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR3311866-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 80,606,484 reads, 75,031,188 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,280 rounds 52973 SRR3311866.ke.tsv 35125 SRR3311866.se.tsv 88098 total ==> SRR3311866.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 159.911 4.33668 PNS24247 1044 945 116.67 2.8024 PNS24249 1928 1829 107.912 1.33924 PNS24246 1044 945 116.67 2.8024 PNS24248 1044 945 116.67 2.8024 PNS24244 1471 1372 596.167 9.86318 PNS24243 293 194 0 0 KQK14069 1603 1504 2502.47 37.768 KQK14071 474 375 218.451 13.2229 ==> SRR3311866.se.tsv <== BRADI_1g14170v3 2984 BRADI_1g53295v3 319 BRADI_1g59795v3 870 BRADI_1g07683v3 0 BRADI_1g00485v3 310 BRADI_1g20270v3 2686 BRADI_1g74790v3 2711 BRADI_1g09890v3 0 BRADI_1g77505v3 435 BRADI_1g48960v3 0 SRR3311866 completed mapping pipeline successfully