Starting /dee2/code/volunteer_pipeline.sh SRR3420430 current disk space = 1523539873792 free memory = 1569518648 SRR3420430 SRAfilesize 22596ff0a0380f91c34cd6cf7dd036ce SRR3420430.sra SRR3420430.sra file validated SRR3420430 is paired end SRR3420430 is conventional basespace SRR3420430 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3420430_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02625 34.0 33.0 34.0 31.0 34.0 2 32.71925 34.0 33.0 34.0 31.0 34.0 3 33.0035 34.0 34.0 34.0 31.0 34.0 4 36.4545 37.0 37.0 37.0 35.0 37.0 5 36.514 37.0 37.0 37.0 35.0 37.0 6 36.53 37.0 37.0 37.0 35.0 37.0 7 36.53975 37.0 37.0 37.0 35.0 37.0 8 36.537 37.0 37.0 37.0 35.0 37.0 9 38.362 39.0 39.0 39.0 37.0 39.0 10-14 38.6893 39.4 39.2 39.4 37.2 39.4 15-19 40.01255 41.0 40.0 41.0 38.0 41.0 20-24 40.0044 41.0 40.0 41.0 38.0 41.0 25-29 39.8667 41.0 40.0 41.0 37.8 41.0 30-34 39.65495 41.0 40.0 41.0 36.8 41.0 35-39 39.392 41.0 39.2 41.0 35.2 41.0 40-44 39.03855 41.0 38.6 41.0 35.0 41.0 45-49 38.62050000000001 40.4 37.2 41.0 35.0 41.0 50-54 38.1344 39.8 35.4 41.0 35.0 41.0 55-59 37.56655 39.0 35.0 41.0 34.2 41.0 60-64 36.93725 37.2 35.0 40.6 34.0 41.0 65-69 36.241200000000006 35.8 35.0 39.2 33.4 41.0 70-74 35.5561 35.0 35.0 37.6 33.0 40.0 75-79 34.94665 35.0 35.0 36.4 33.0 38.6 80-84 34.45515 35.0 35.0 35.4 33.0 36.8 85-89 34.13205000000001 35.0 35.0 35.0 33.0 36.0 90-94 33.92635 35.0 35.0 35.0 33.0 35.4 95-99 33.86125 35.0 35.0 35.0 33.0 35.0 100-104 33.07525 34.4 33.6 34.8 30.6 35.0 105-109 33.7893 35.0 35.0 35.0 32.6 35.0 110-114 33.741 35.0 35.0 35.0 32.2 35.0 115-119 33.6993 35.0 35.0 35.0 32.2 35.0 120-124 33.583800000000004 35.0 35.0 35.0 32.0 35.0 125-129 33.568349999999995 35.0 35.0 35.0 32.0 35.0 130-134 33.45855 35.0 35.0 35.0 31.6 35.0 135-139 33.29 35.0 34.4 35.0 31.0 35.0 140-144 33.2368 35.0 34.6 35.0 31.0 35.0 145-149 33.102 35.0 34.0 35.0 31.0 35.0 150-151 31.5875 34.0 31.5 35.0 27.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 4.0 9 2.0 10 5.0 11 0.0 12 3.0 13 4.0 14 2.0 15 4.0 16 6.0 17 6.0 18 2.0 19 6.0 20 2.0 21 5.0 22 8.0 23 3.0 24 9.0 25 14.0 26 12.0 27 22.0 28 22.0 29 40.0 30 41.0 31 52.0 32 56.0 33 114.0 34 170.0 35 500.0 36 1390.0 37 1460.0 38 35.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.506876719179797 13.578394598649663 10.127531882970743 48.7871967991998 2 26.1101243339254 19.639685359045927 34.10301953818828 20.147170768840393 3 25.174999999999997 24.474999999999998 22.650000000000002 27.700000000000003 4 28.349999999999998 29.9 16.150000000000002 25.6 5 29.175 32.0 18.3 20.525 6 20.724999999999998 35.675000000000004 20.1 23.5 7 19.875 14.674999999999999 39.0 26.450000000000003 8 21.425 19.6 25.424999999999997 33.550000000000004 9 21.825 20.3 28.125 29.75 10-14 25.03 24.915000000000003 23.435 26.619999999999997 15-19 25.650000000000002 23.990000000000002 23.815 26.545 20-24 25.605 24.265 23.555 26.575 25-29 25.72 24.154999999999998 23.915 26.21 30-34 25.765 24.5 23.580000000000002 26.155 35-39 25.845000000000002 24.005000000000003 23.575 26.575 40-44 25.97 23.86 23.04 27.13 45-49 25.515 23.755000000000003 23.87 26.86 50-54 25.290000000000003 24.224999999999998 23.97 26.515 55-59 25.919999999999998 23.91 23.880000000000003 26.290000000000003 60-64 25.929999999999996 23.87 23.54 26.66 65-69 25.5 23.935000000000002 23.95 26.615 70-74 26.840000000000003 23.525 23.585 26.05 75-79 25.935000000000002 23.794999999999998 23.865 26.405 80-84 26.674999999999997 23.94 23.544999999999998 25.840000000000003 85-89 26.334999999999997 23.715 24.09 25.86 90-94 26.195 24.02 23.91 25.874999999999996 95-99 26.534999999999997 24.075 23.375 26.015 100-104 26.334999999999997 24.09 23.505000000000003 26.07 105-109 26.064999999999998 24.3 23.235 26.400000000000002 110-114 26.279999999999998 24.555 23.125 26.040000000000003 115-119 26.58 24.9 22.955000000000002 25.564999999999998 120-124 26.915 24.66 23.205000000000002 25.22 125-129 26.245 25.330000000000002 23.155 25.27 130-134 27.055 25.540000000000003 22.62 24.785 135-139 26.474999999999998 25.44 22.775000000000002 25.31 140-144 26.26 25.275 22.27 26.195 145-149 25.81 26.090000000000003 22.875 25.224999999999998 150-151 26.3625 24.9 22.2 26.5375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 2.5 28 3.5 29 4.0 30 4.5 31 5.5 32 11.5 33 17.0 34 19.0 35 27.5 36 38.5 37 45.0 38 63.0 39 81.5 40 102.5 41 128.0 42 142.5 43 146.0 44 149.5 45 152.5 46 152.5 47 171.0 48 173.0 49 156.5 50 147.0 51 141.0 52 123.0 53 102.0 54 99.0 55 96.0 56 92.5 57 94.0 58 85.0 59 87.5 60 98.5 61 85.0 62 82.5 63 87.5 64 81.5 65 78.0 66 73.5 67 74.0 68 76.5 69 64.0 70 50.5 71 48.0 72 45.5 73 42.0 74 40.0 75 30.0 76 21.5 77 17.0 78 10.5 79 8.5 80 8.0 81 4.5 82 1.5 83 1.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 1.4749999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.4625000000000004 0.0 0.0 0.0 0.0 112-113 2.8625 0.0 0.0 0.0 0.0 114-115 3.4125 0.0 0.0 0.0 0.0 116-117 4.199999999999999 0.0 0.0 0.0 0.0 118-119 5.112500000000001 0.0 0.0 0.0 0.0 120-121 5.7625 0.0 0.0 0.0 0.0 122-123 6.699999999999999 0.0 0.0 0.0 0.0 124-125 7.7125 0.0 0.0 0.0 0.0 126-127 9.2 0.0 0.0 0.0 0.0 128-129 10.425 0.0 0.0 0.0 0.0 130-131 11.524999999999999 0.0 0.0 0.0 0.0 132-133 12.7375 0.0 0.0 0.0 0.0 134-135 14.0375 0.0 0.0 0.0 0.0 136-137 15.162500000000001 0.0 0.0 0.0 0.0 138-139 16.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3420430 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3420430_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3715 34.0 31.0 34.0 31.0 34.0 2 32.58275 34.0 31.0 34.0 31.0 34.0 3 32.7175 34.0 31.0 34.0 31.0 34.0 4 36.0815 37.0 37.0 37.0 35.0 37.0 5 36.16275 37.0 37.0 37.0 35.0 37.0 6 36.11075 37.0 37.0 37.0 35.0 37.0 7 36.13375 37.0 37.0 37.0 35.0 37.0 8 36.0185 37.0 37.0 37.0 35.0 37.0 9 37.86875 39.0 39.0 39.0 37.0 39.0 10-14 38.2395 39.4 39.2 39.4 37.2 39.4 15-19 39.439949999999996 41.0 40.0 41.0 37.4 41.0 20-24 39.38 41.0 40.0 41.0 37.2 41.0 25-29 39.208800000000004 41.0 40.0 41.0 36.4 41.0 30-34 39.06405 41.0 39.8 41.0 35.4 41.0 35-39 38.72025000000001 41.0 39.0 41.0 35.0 41.0 40-44 38.356849999999994 40.4 37.8 41.0 35.0 41.0 45-49 37.904050000000005 40.0 36.4 41.0 34.4 41.0 50-54 37.38935 39.8 35.0 41.0 33.2 41.0 55-59 36.854749999999996 38.8 35.0 41.0 33.0 41.0 60-64 36.2033 37.0 35.0 40.6 33.0 41.0 65-69 35.56515 35.6 35.0 39.2 32.8 41.0 70-74 34.807900000000004 35.0 35.0 37.6 31.8 39.8 75-79 34.152699999999996 35.0 35.0 36.2 31.8 38.4 80-84 33.6329 35.0 35.0 35.4 31.4 36.8 85-89 33.2718 35.0 34.6 35.0 31.0 36.0 90-94 33.02165000000001 35.0 34.2 35.0 30.2 35.2 95-99 32.8969 35.0 34.0 35.0 30.2 35.0 100-104 31.968650000000004 34.2 32.6 34.8 28.0 35.0 105-109 32.70625 35.0 34.0 35.0 29.8 35.0 110-114 32.65689999999999 35.0 34.0 35.0 29.4 35.0 115-119 32.59625 35.0 34.0 35.0 29.4 35.0 120-124 32.495799999999996 35.0 34.0 35.0 29.0 35.0 125-129 32.464800000000004 35.0 34.0 35.0 29.0 35.0 130-134 32.327749999999995 35.0 34.0 35.0 29.0 35.0 135-139 32.05765 35.0 34.0 35.0 27.4 35.0 140-144 31.776549999999997 35.0 34.0 35.0 25.8 35.0 145-149 31.202199999999998 35.0 33.0 35.0 22.8 35.0 150-151 28.709625 33.5 28.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 4.0 4 6.0 5 6.0 6 5.0 7 8.0 8 4.0 9 5.0 10 7.0 11 12.0 12 11.0 13 4.0 14 6.0 15 5.0 16 9.0 17 4.0 18 9.0 19 3.0 20 6.0 21 13.0 22 7.0 23 6.0 24 13.0 25 13.0 26 24.0 27 23.0 28 36.0 29 42.0 30 47.0 31 56.0 32 85.0 33 142.0 34 209.0 35 540.0 36 1251.0 37 1334.0 38 20.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.862691054873466 13.40516161363067 9.42119769481333 49.31094963668254 2 24.61152882205514 20.0 35.46365914786968 19.924812030075188 3 26.49122807017544 22.857142857142858 22.706766917293233 27.94486215538847 4 27.662240040090204 30.268103232272615 15.835630167877726 26.23402655975946 5 28.915058882485596 31.971936857930345 18.36632422951641 20.74668003006765 6 22.283425137706562 33.37506259389084 20.105157736604905 24.236354531797698 7 19.163326653306616 15.00501002004008 40.7314629258517 25.100200400801604 8 22.668004012036107 18.480441323971917 25.526579739217652 33.324974924774324 9 22.405601400350086 18.37959489872468 28.657164291072768 30.55763940985246 10-14 25.32203899553907 24.805774146659314 22.93118139441632 26.94100546338529 15-19 25.20936763452184 23.5795597011183 23.740033097638033 27.471039566721828 20-24 25.557616159590996 24.0840058142449 24.444889980452107 25.913488045711997 25-29 25.53127506014435 24.278267842822775 23.496391339214114 26.694065757818763 30-34 25.220396714085354 24.49408936084953 23.517331196153076 26.768182728912045 35-39 25.998496617389126 24.650463542971686 23.392633425206714 25.95840641443247 40-44 25.79416775227979 24.01543240805692 23.183685740054113 27.00671409960918 45-49 25.42194621124856 23.674062202634346 24.20493814794411 26.69905343817299 50-54 25.846523742736927 24.09336806251252 23.887998397114806 26.172109797635745 55-59 25.766379483069525 23.75275495892607 23.948106591865358 26.532758966139053 60-64 25.780115201602804 23.856749311294767 23.971950914099676 26.391184573002757 65-69 26.09958921951708 23.509668369902815 24.205991383628895 26.184751026951208 70-74 26.244865243963535 23.609858731590023 24.045686804929367 26.09958921951708 75-79 26.33266533066132 24.083166332665332 23.617234468937877 25.96693386773547 80-84 25.761523046092183 24.19839679358717 23.892785571142284 26.147294589178355 85-89 26.12987273273875 23.42419080068143 24.01042188596052 26.4355145806193 90-94 25.991983967935873 24.37374749498998 23.436873747494992 26.19739478957916 95-99 26.698396793587175 23.932865731462925 23.667334669338675 25.701402805611224 100-104 26.51067241206534 23.890169355646858 23.654674817115943 25.94448341517186 105-109 25.736472945891787 24.549098196392784 23.717434869739478 25.99699398797595 110-114 25.976111612967983 24.460503864297902 24.059018367961457 25.504366154772658 115-119 26.76282051282051 24.704527243589745 23.2421875 25.29046474358974 120-124 27.13403924323782 24.45927635870929 23.746675365082552 24.660009032970343 125-129 27.550764602657306 24.87340185510153 23.17372775131612 24.402105790925045 130-134 28.543474988711054 24.464402187547037 22.778586122121318 24.21353670162059 135-139 29.0180139495208 25.199458076170405 22.42460735611421 23.35792061819459 140-144 29.45899829368664 24.731506574325003 22.663856268192312 23.145638863796044 145-149 30.14572864321608 25.407035175879393 22.025125628140703 22.42211055276382 150-151 31.07785184253553 25.292416048295813 21.557036850710602 22.072695258458054 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 1.5 7 1.5 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.5 25 1.0 26 1.5 27 1.5 28 1.5 29 3.5 30 6.5 31 10.0 32 9.0 33 11.5 34 20.5 35 29.0 36 42.0 37 57.5 38 67.0 39 78.5 40 90.0 41 112.0 42 140.0 43 165.5 44 179.5 45 164.5 46 157.0 47 163.0 48 162.0 49 152.5 50 145.5 51 129.5 52 110.0 53 110.0 54 103.5 55 87.5 56 84.5 57 87.0 58 93.0 59 96.0 60 94.5 61 94.5 62 88.0 63 72.5 64 64.0 65 67.5 66 63.5 67 68.0 68 67.5 69 57.5 70 55.0 71 57.0 72 54.5 73 46.5 74 41.0 75 32.0 76 23.5 77 17.5 78 13.5 79 11.5 80 9.5 81 7.0 82 3.5 83 0.0 84 1.5 85 1.5 86 1.0 87 1.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.25 3 0.25 4 0.22499999999999998 5 0.22499999999999998 6 0.15 7 0.2 8 0.3 9 0.025 10-14 0.245 15-19 0.295 20-24 0.245 25-29 0.24 30-34 0.18 35-39 0.22499999999999998 40-44 0.21 45-49 0.165 50-54 0.18 55-59 0.18 60-64 0.17500000000000002 65-69 0.19 70-74 0.19 75-79 0.2 80-84 0.2 85-89 0.21 90-94 0.2 95-99 0.2 100-104 0.21 105-109 0.2 110-114 0.37 115-119 0.16 120-124 0.365 125-129 0.27499999999999997 130-134 0.345 135-139 0.35500000000000004 140-144 0.37 145-149 0.5 150-151 0.6125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5475113122172 99.0 2 0.3770739064856712 0.75 3 0.050276520864756154 0.15 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.4124999999999996 0.0 0.0 0.0 0.0 112-113 2.8 0.0 0.0 0.0 0.0 114-115 3.3 0.0 0.0 0.0 0.0 116-117 4.025 0.0 0.0 0.0 0.0 118-119 4.875 0.0 0.0 0.0 0.0 120-121 5.5 0.0 0.0 0.0 0.0 122-123 6.4 0.0 0.0 0.0 0.0 124-125 7.4 0.0 0.0 0.0 0.0 126-127 8.8625 0.0 0.0 0.0 0.0 128-129 10.1 0.0 0.0 0.0 0.0 130-131 11.1875 0.0 0.0 0.0 0.0 132-133 12.375 0.0 0.0 0.0 0.0 134-135 13.6375 0.0 0.0 0.0 0.0 136-137 14.712499999999999 0.0 0.0 0.0 0.0 138-139 16.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAGC 100 0.009792263 10.263994 140-144 >>END_MODULE Read 1943399 spots for SRR3420430.sra Written 1943399 spots for SRR3420430.sra Read 1943399 spots for SRR3420430.sra Written 1943399 spots for SRR3420430.sra Read 1943399 spots for SRR3420430.sra Written 1943399 spots for SRR3420430.sra Read 1943406 spots for SRR3420430.sra Written 1943406 spots for SRR3420430.sra Read 1943399 spots for SRR3420430.sra Written 1943399 spots for SRR3420430.sra Read 1943399 spots for SRR3420430.sra Written 1943399 spots for SRR3420430.sra Read 1943399 spots for SRR3420430.sra Written 1943399 spots for SRR3420430.sra Read 1943399 spots for SRR3420430.sra Written 1943399 spots for SRR3420430.sra Read 1943399 spots for SRR3420430.sra Written 1943399 spots for SRR3420430.sra Read 1943399 spots for SRR3420430.sra Written 1943399 spots for SRR3420430.sra Read 1943399 spots for SRR3420430.sra Written 1943399 spots for SRR3420430.sra Read 1943399 spots for SRR3420430.sra Written 1943399 spots for SRR3420430.sra Read 1943399 spots for SRR3420430.sra Written 1943399 spots for SRR3420430.sra Read 1943399 spots for SRR3420430.sra Written 1943399 spots for SRR3420430.sra Read 1943399 spots for SRR3420430.sra Written 1943399 spots for SRR3420430.sra Read 1943399 spots for SRR3420430.sra Written 1943399 spots for SRR3420430.sra Read 1943399 spots for SRR3420430.sra Written 1943399 spots for SRR3420430.sra Read 1943399 spots for SRR3420430.sra Written 1943399 spots for SRR3420430.sra Read 1943399 spots for SRR3420430.sra Written 1943399 spots for SRR3420430.sra Read 1943399 spots for SRR3420430.sra Written 1943399 spots for SRR3420430.sra SRR ids: ['SRR3420430.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kqfvj7av SRR3420430.sra spots: 38867987 blocks: [[1, 1943399], [1943400, 3886798], [3886799, 5830197], [5830198, 7773596], [7773597, 9716995], [9716996, 11660394], [11660395, 13603793], [13603794, 15547192], [15547193, 17490591], [17490592, 19433990], [19433991, 21377389], [21377390, 23320788], [23320789, 25264187], [25264188, 27207586], [27207587, 29150985], [29150986, 31094384], [31094385, 33037783], [33037784, 34981182], [34981183, 36924581], [36924582, 38867987]] SRR3420430 file size 13149385 SRR3420430 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3420430 SRR3420430_1.fastq SRR3420430_2.fastq Input file: SRR3420430_1.fastq Paired file: SRR3420430_2.fastq trimmed: SRR3420430-trimmed-pair1.fastq, SRR3420430-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:19:57 2024 >> started Tue Dec 10 00:20:43 2024 >> done (45.816s) 38867987 read pairs processed; of these: 180667 ( 0.46%) short read pairs filtered out after trimming by size control 267434 ( 0.69%) empty read pairs filtered out after trimming by size control 38419886 (98.85%) read pairs available; of these: 14708438 (38.28%) trimmed read pairs available after processing 23711448 (61.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 416 0.00% 19 433 0.00% 20 486 0.00% 21 518 0.00% 22 603 0.00% 23 638 0.00% 24 734 0.00% 25 777 0.00% 26 791 0.00% 27 911 0.00% 28 930 0.00% 29 959 0.00% 30 1064 0.00% 31 1115 0.00% 32 1223 0.00% 33 1202 0.00% 34 1374 0.00% 35 1336 0.00% 36 1448 0.00% 37 1487 0.00% 38 1539 0.00% 39 1659 0.00% 40 1654 0.00% 41 1787 0.00% 42 1736 0.00% 43 1804 0.00% 44 1899 0.00% 45 1915 0.00% 46 1989 0.01% 47 2050 0.01% 48 2081 0.01% 49 2195 0.01% 50 2218 0.01% 51 2201 0.01% 52 2316 0.01% 53 2387 0.01% 54 2445 0.01% 55 2446 0.01% 56 2524 0.01% 57 2698 0.01% 58 2792 0.01% 59 2933 0.01% 60 2939 0.01% 61 3181 0.01% 62 3250 0.01% 63 3485 0.01% 64 3498 0.01% 65 3763 0.01% 66 3921 0.01% 67 4246 0.01% 68 4593 0.01% 69 4792 0.01% 70 5275 0.01% 71 5769 0.02% 72 6162 0.02% 73 6797 0.02% 74 7571 0.02% 75 8019 0.02% 76 8694 0.02% 77 9667 0.03% 78 10436 0.03% 79 11605 0.03% 80 12968 0.03% 81 14428 0.04% 82 16093 0.04% 83 18104 0.05% 84 26824 0.07% 85 32444 0.08% 86 36862 0.10% 87 37911 0.10% 88 41323 0.11% 89 45325 0.12% 90 47277 0.12% 91 50534 0.13% 92 51919 0.14% 93 55492 0.14% 94 60015 0.16% 95 62540 0.16% 96 65144 0.17% 97 66746 0.17% 98 68793 0.18% 99 71862 0.19% 100 76885 0.20% 101 82461 0.21% 102 86793 0.23% 103 91916 0.24% 104 97829 0.25% 105 101170 0.26% 106 105409 0.27% 107 109407 0.28% 108 114539 0.30% 109 120375 0.31% 110 125122 0.33% 111 133651 0.35% 112 141667 0.37% 113 149756 0.39% 114 158896 0.41% 115 167961 0.44% 116 170448 0.44% 117 175411 0.46% 118 180635 0.47% 119 185806 0.48% 120 192474 0.50% 121 202354 0.53% 122 212810 0.55% 123 224932 0.59% 124 236556 0.62% 125 248208 0.65% 126 243291 0.63% 127 243985 0.64% 128 251871 0.66% 129 258302 0.67% 130 267544 0.70% 131 276208 0.72% 132 289127 0.75% 133 300959 0.78% 134 311914 0.81% 135 321215 0.84% 136 341434 0.89% 137 329461 0.86% 138 332127 0.86% 139 340574 0.89% 140 344495 0.90% 141 349071 0.91% 142 363143 0.95% 143 374698 0.98% 144 391451 1.02% 145 412699 1.07% 146 436453 1.14% 147 469533 1.22% 148 550063 1.43% 149 650814 1.69% 150 1298555 3.38% 151 23711448 61.72% 38419886 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.65 fanout-score-rank=4 prefix-density=0.59 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.18 sequence-density-rank=27 fanout-score=4.56 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=3.4 sequence=CATATATATATG criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=16 prefix-density=0.60 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.18 sequence-density-rank=32 fanout-score=4.44 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=2.2 sequence=TGCTCACGGAAGACGAAACCGACCTTGCT SRR3420430 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:21:31 Started mapping on | Dec 10 00:21:31 Finished on | Dec 10 00:25:00 Mapping speed, Million of reads per hour | 661.78 Number of input reads | 38419886 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 37059921 Uniquely mapped reads % | 96.46% Average mapped length | 284.72 Number of splices: Total | 38355529 Number of splices: Annotated (sjdb) | 36225657 Number of splices: GT/AG | 37760190 Number of splices: GC/AG | 490481 Number of splices: AT/AC | 19044 Number of splices: Non-canonical | 85814 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 2.38 Insertion rate per base | 0.02% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 434245 % of reads mapped to multiple loci | 1.13% Number of reads mapped to too many loci | 27753 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.97% % of reads unmapped: other | 0.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 968418 968418 968418 N_multimapping 434245 434245 434245 N_noFeature 1210302 18708788 18869892 N_ambiguous 829904 71404 73405 UnstrandedReadsAssigned:35019715 PositiveStrandReadsAssigned:18279729 NegativeStrandReadsAssigned:18116624 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=140 echo kmer=135 SRR3420430 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3420430-trimmed-pair1.fastq SRR3420430-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,419,886 reads, 36,004,154 reads pseudoaligned [quant] estimated average fragment length: 192.896 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52973 SRR3420430.ke.tsv 35125 SRR3420430.se.tsv 88098 total ==> SRR3420430.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 744.213 0 0 PNS24247 1044 852.104 46.9431 2.15538 PNS24249 1928 1736.1 294.118 6.62813 PNS24246 1044 852.104 46.9431 2.15538 PNS24248 1044 852.104 46.9431 2.15538 PNS24244 1471 1279.1 57.0524 1.74507 PNS24243 293 118.278 15 4.96171 KQK14069 1603 1411.1 2112.7 58.5765 KQK14071 474 286.613 151.106 20.6268 ==> SRR3420430.se.tsv <== BRADI_1g14170v3 2367 BRADI_1g53295v3 277 BRADI_1g59795v3 745 BRADI_1g07683v3 0 BRADI_1g00485v3 130 BRADI_1g20270v3 5579 BRADI_1g74790v3 509 BRADI_1g09890v3 16 BRADI_1g77505v3 523 BRADI_1g48960v3 0 SRR3420430 completed mapping pipeline successfully