Starting /dee2/code/volunteer_pipeline.sh SRR3420431 current disk space = 1523517685760 free memory = 1602088540 SRR3420431 SRAfilesize 13b210cc26a675a0db8145c615606ff0 SRR3420431.sra SRR3420431.sra file validated SRR3420431 is paired end SRR3420431 is conventional basespace SRR3420431 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3420431_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96025 34.0 33.0 34.0 31.0 34.0 2 32.652 34.0 33.0 34.0 31.0 34.0 3 32.893 34.0 33.0 34.0 31.0 34.0 4 36.37025 37.0 37.0 37.0 35.0 37.0 5 36.44375 37.0 37.0 37.0 35.0 37.0 6 36.447 37.0 37.0 37.0 35.0 37.0 7 36.478 37.0 37.0 37.0 35.0 37.0 8 36.46875 37.0 37.0 37.0 35.0 37.0 9 38.3205 39.0 39.0 39.0 37.0 39.0 10-14 38.6548 39.4 39.2 39.4 37.2 39.4 15-19 39.9379 41.0 40.0 41.0 38.0 41.0 20-24 39.85725 41.0 40.0 41.0 38.0 41.0 25-29 39.7347 41.0 40.0 41.0 37.0 41.0 30-34 39.4548 41.0 39.6 41.0 36.0 41.0 35-39 39.19375 41.0 39.0 41.0 35.0 41.0 40-44 38.86165 41.0 38.2 41.0 35.0 41.0 45-49 38.462199999999996 40.0 36.8 41.0 35.0 41.0 50-54 37.95395 39.8 35.2 41.0 34.2 41.0 55-59 37.41075000000001 38.8 35.0 41.0 33.8 41.0 60-64 36.767450000000004 37.2 35.0 40.6 33.0 41.0 65-69 36.1448 35.6 35.0 39.2 33.0 41.0 70-74 35.40385 35.0 35.0 37.6 33.0 40.0 75-79 34.717200000000005 35.0 35.0 36.2 33.0 38.2 80-84 34.2093 35.0 35.0 35.2 32.6 36.6 85-89 33.8979 35.0 35.0 35.0 32.2 36.0 90-94 33.674099999999996 35.0 35.0 35.0 32.0 35.2 95-99 33.55195 35.0 34.6 35.0 31.6 35.0 100-104 32.696299999999994 34.4 33.2 34.8 29.4 35.0 105-109 33.44825 35.0 34.8 35.0 31.6 35.0 110-114 33.44125 35.0 34.6 35.0 31.6 35.0 115-119 33.32955 35.0 34.8 35.0 31.2 35.0 120-124 33.228100000000005 35.0 34.2 35.0 31.0 35.0 125-129 33.144600000000004 35.0 34.0 35.0 31.0 35.0 130-134 33.0471 35.0 34.0 35.0 30.6 35.0 135-139 32.977199999999996 35.0 34.0 35.0 30.6 35.0 140-144 32.84179999999999 35.0 34.0 35.0 30.2 35.0 145-149 32.57619999999999 35.0 34.0 35.0 30.0 35.0 150-151 30.891624999999998 34.0 31.5 35.0 24.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 2.0 8 5.0 9 6.0 10 1.0 11 2.0 12 4.0 13 3.0 14 5.0 15 3.0 16 9.0 17 6.0 18 6.0 19 8.0 20 9.0 21 7.0 22 7.0 23 8.0 24 12.0 25 20.0 26 18.0 27 20.0 28 23.0 29 41.0 30 60.0 31 45.0 32 77.0 33 110.0 34 189.0 35 513.0 36 1336.0 37 1414.0 38 30.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.59079539769885 14.832416208104052 8.479239619809904 45.09754877438719 2 25.924987328940702 20.85656360871769 32.89406994424734 20.324379118094274 3 25.4 24.55 23.974999999999998 26.075 4 27.525 30.95 17.9 23.625 5 29.799999999999997 32.9 16.5 20.8 6 20.474999999999998 35.35 20.0 24.175 7 20.025000000000002 14.95 39.875 25.15 8 21.75 20.25 25.224999999999998 32.775 9 21.9 19.650000000000002 28.449999999999996 30.0 10-14 25.095 24.235 23.830000000000002 26.840000000000003 15-19 26.179999999999996 23.665 23.36 26.795 20-24 25.555 23.985 24.09 26.369999999999997 25-29 25.91 24.07 23.35 26.669999999999998 30-34 25.88 23.76 23.765 26.595000000000002 35-39 26.25 24.085 23.75 25.915 40-44 25.716285814290714 23.896194809740486 24.041202060103007 26.346317315865793 45-49 26.08 23.815 23.52 26.584999999999997 50-54 26.4063203160158 23.746187309365467 23.656182809140457 26.19130956547827 55-59 25.966298314915747 23.491174558727938 23.981199059953 26.561328066403323 60-64 26.450000000000003 23.49 23.165 26.895000000000003 65-69 26.642664266426642 24.2974297429743 23.567356735673567 25.492549254925496 70-74 26.68 23.455000000000002 23.669999999999998 26.195 75-79 25.77 24.295 23.45 26.484999999999996 80-84 26.82 23.98 23.655 25.545 85-89 26.185000000000002 23.93 23.885 26.0 90-94 26.851342567128356 23.816190809540476 23.76618830941547 25.566278313915696 95-99 26.35 23.674999999999997 23.655 26.32 100-104 26.540000000000003 23.96 23.435 26.064999999999998 105-109 26.43 24.435000000000002 23.735 25.4 110-114 26.51 24.9 22.97 25.619999999999997 115-119 26.695 25.040000000000003 22.56 25.705 120-124 26.715 24.735 22.835 25.715 125-129 26.35 24.990000000000002 22.97 25.69 130-134 26.650000000000002 25.09 22.06 26.200000000000003 135-139 26.79133956697835 25.946297314865742 21.51107555377769 25.751287564378217 140-144 26.795 25.47 21.959999999999997 25.775 145-149 25.935000000000002 26.0 21.605 26.46 150-151 25.887500000000003 25.3 22.4375 26.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.5 27 1.5 28 2.5 29 4.0 30 5.5 31 4.5 32 7.0 33 13.5 34 17.5 35 29.0 36 38.0 37 39.5 38 55.5 39 83.0 40 100.0 41 111.5 42 128.0 43 140.5 44 159.0 45 171.0 46 183.5 47 182.0 48 161.5 49 151.5 50 145.0 51 138.5 52 121.0 53 108.5 54 106.0 55 97.0 56 88.5 57 89.5 58 94.5 59 101.5 60 92.5 61 79.0 62 82.0 63 78.0 64 78.5 65 82.0 66 73.0 67 67.0 68 73.0 69 73.5 70 59.5 71 52.0 72 51.0 73 43.5 74 33.5 75 28.0 76 22.0 77 16.5 78 11.0 79 7.5 80 6.5 81 3.0 82 2.0 83 2.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 1.35 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.005 55-59 0.005 60-64 0.0 65-69 0.01 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4274578828262509 0.8500000000000001 3 0.07543374402816193 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.037500000000000006 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.0875 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1125 0.0 0.0 0.0 0.0 56-57 0.1375 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0125 68-69 0.225 0.0 0.0 0.0 0.025 70-71 0.25 0.0 0.0 0.0 0.025 72-73 0.25 0.0 0.0 0.0 0.025 74-75 0.25 0.0 0.0 0.0 0.025 76-77 0.25 0.0 0.0 0.0 0.025 78-79 0.3125 0.0 0.0 0.0 0.025 80-81 0.3875 0.0 0.0 0.0 0.025 82-83 0.42500000000000004 0.0 0.0 0.0 0.025 84-85 0.6000000000000001 0.0 0.0 0.0 0.025 86-87 0.725 0.0 0.0 0.0 0.025 88-89 0.9750000000000001 0.0 0.0 0.0 0.025 90-91 1.1875 0.0 0.0 0.0 0.025 92-93 1.3125 0.0 0.0 0.0 0.025 94-95 1.4874999999999998 0.0 0.0 0.0 0.025 96-97 1.725 0.0 0.0 0.0 0.025 98-99 2.2125 0.0 0.0 0.0 0.025 100-101 2.7875 0.0 0.0 0.0 0.025 102-103 3.4124999999999996 0.0 0.0 0.0 0.025 104-105 4.2 0.0 0.0 0.0 0.025 106-107 5.050000000000001 0.0 0.0 0.0 0.025 108-109 5.800000000000001 0.0 0.0 0.0 0.025 110-111 6.5625 0.0 0.0 0.0 0.025 112-113 7.35 0.0 0.0 0.0 0.025 114-115 8.2 0.0 0.0 0.0 0.025 116-117 9.25 0.0 0.0 0.0 0.025 118-119 10.2375 0.0 0.0 0.0 0.025 120-121 11.4125 0.0 0.0 0.0 0.025 122-123 12.850000000000001 0.0 0.0 0.0 0.025 124-125 14.2625 0.0 0.0 0.0 0.025 126-127 15.475 0.0 0.0 0.0 0.025 128-129 16.700000000000003 0.0 0.0 0.0 0.025 130-131 18.049999999999997 0.0 0.0 0.0 0.025 132-133 19.65 0.0 0.0 0.0 0.025 134-135 21.1625 0.0 0.0 0.0 0.025 136-137 22.8 0.0 0.0 0.0 0.025 138-139 24.575000000000003 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCAGGG 10 0.0065789125 146.81013 1 ACGGCTA 35 0.003540148 20.710714 135-139 CTACATC 35 0.003540148 20.710714 140-144 TACATCT 40 0.0076626483 18.121876 140-144 CACGGCT 40 0.0076626483 18.121876 135-139 >>END_MODULE SRR3420431 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3420431_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.14625 34.0 31.0 34.0 30.0 34.0 2 32.4225 34.0 31.0 34.0 31.0 34.0 3 32.51325 34.0 31.0 34.0 31.0 34.0 4 35.89425 37.0 37.0 37.0 35.0 37.0 5 35.8785 37.0 37.0 37.0 35.0 37.0 6 35.80825 37.0 37.0 37.0 35.0 37.0 7 35.81625 37.0 37.0 37.0 35.0 37.0 8 35.657 37.0 37.0 37.0 35.0 37.0 9 37.483 39.0 39.0 39.0 35.0 39.0 10-14 37.8437 39.4 39.0 39.4 35.4 39.4 15-19 38.99835 41.0 40.0 41.0 36.6 41.0 20-24 39.0281 41.0 40.0 41.0 36.6 41.0 25-29 38.8842 41.0 39.8 41.0 35.8 41.0 30-34 38.639149999999994 41.0 39.0 41.0 35.0 41.0 35-39 38.317699999999995 41.0 38.6 41.0 34.6 41.0 40-44 37.94635 40.0 37.6 41.0 33.8 41.0 45-49 37.50175 40.0 36.2 41.0 33.0 41.0 50-54 37.00064999999999 39.6 35.0 41.0 33.0 41.0 55-59 36.38915 38.6 35.0 41.0 32.2 41.0 60-64 35.75765 36.8 35.0 40.2 31.6 41.0 65-69 35.0725 35.6 35.0 39.2 30.8 41.0 70-74 34.342200000000005 35.0 35.0 37.4 31.0 39.8 75-79 33.66015 35.0 35.0 36.2 30.4 38.2 80-84 33.1192 35.0 34.0 35.2 30.0 36.6 85-89 32.75865 35.0 34.0 35.0 29.4 36.0 90-94 32.586600000000004 35.0 34.0 35.0 29.2 35.0 95-99 32.4295 35.0 34.0 35.0 29.0 35.0 100-104 31.421900000000004 34.2 32.4 34.8 26.2 35.0 105-109 32.24855 35.0 33.8 35.0 28.2 35.0 110-114 32.242200000000004 35.0 34.0 35.0 28.6 35.0 115-119 32.10445 35.0 34.0 35.0 27.0 35.0 120-124 31.968049999999998 35.0 33.2 35.0 27.0 35.0 125-129 31.851050000000004 35.0 33.0 35.0 26.6 35.0 130-134 31.58155 35.0 33.0 35.0 24.6 35.0 135-139 31.108250000000005 35.0 33.0 35.0 21.2 35.0 140-144 30.5988 35.0 33.0 35.0 14.4 35.0 145-149 29.725749999999998 35.0 32.0 35.0 2.0 35.0 150-151 26.998624999999997 33.0 25.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 46.0 3 7.0 4 4.0 5 4.0 6 7.0 7 7.0 8 8.0 9 9.0 10 15.0 11 7.0 12 9.0 13 4.0 14 12.0 15 13.0 16 2.0 17 8.0 18 10.0 19 5.0 20 8.0 21 11.0 22 7.0 23 14.0 24 16.0 25 21.0 26 25.0 27 24.0 28 25.0 29 53.0 30 58.0 31 87.0 32 103.0 33 161.0 34 232.0 35 596.0 36 1205.0 37 1166.0 38 11.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.411853340030138 14.289301858362633 7.734806629834254 47.56403817177298 2 24.736313410346558 19.688598694123556 34.93219487694626 20.642893018583628 3 24.44723618090452 23.618090452261306 24.824120603015075 27.110552763819097 4 27.535140562248994 29.668674698795183 17.796184738955823 25.0 5 27.48493975903614 32.93172690763052 18.97590361445783 20.6074297188755 6 20.949510173323286 33.76036171816126 19.61818638533032 25.67194172318513 7 20.81447963800905 15.987933634992457 38.96430367018603 24.233283056812468 8 20.758984669514955 19.50238753455642 25.634581553154057 34.104046242774565 9 21.59318637274549 18.286573146292582 29.63426853707415 30.485971943887773 10-14 25.16216623925177 24.905717302760596 23.2161713682305 26.715945089757128 15-19 25.675199919529245 23.985314087411354 23.43207765427752 26.907408338781874 20-24 25.731111894095736 23.667388131071625 23.934162178486936 26.6673377963457 25-29 25.18999446373748 24.28406059690976 23.559313503447584 26.96663143590518 30-34 25.47373711987937 23.598894194521236 24.14174415682332 26.785624528776076 35-39 26.042767295597486 24.654088050314467 23.149685534591192 26.15345911949686 40-44 25.716584531831437 24.318616111837475 23.80066378356633 26.164135572764756 45-49 25.841623957391217 23.726258667470606 23.726258667470606 26.705858707667574 50-54 25.73884197828709 24.055086449537598 23.89425010052272 26.311821471652593 55-59 26.050462404503417 23.86409328508243 23.94953759549658 26.135906714917574 60-64 26.21871544878882 23.766207659061212 23.037491205146246 26.977585687003717 65-69 25.93262946204123 24.278531925590748 23.433886375062844 26.35495223730518 70-74 26.407318053880175 23.94451145958987 23.416767189384803 26.231403297145157 75-79 25.710262985870163 24.221853472117463 23.64358626238246 26.42429727962991 80-84 26.249874258122922 24.122321698018308 23.438285886731716 26.18951815712705 85-89 25.401217487548422 23.479398299542183 24.10826583488454 27.01111837802485 90-94 26.411868242393766 23.862207694241892 23.92255468946442 25.803369373899926 95-99 26.39706252200594 23.690961219254564 24.032996328152507 25.878979930586993 100-104 26.766229194951475 24.5738422084779 23.070347463166893 25.589581133403733 105-109 27.248038624019312 24.341178837256088 23.214644940655806 25.196137598068795 110-114 27.42016722071119 24.775863805782212 22.720862294751687 25.083106678754913 115-119 27.942136722085486 24.802852981063843 22.88412275855141 24.370887538299264 120-124 28.29228987258901 24.057007604371254 23.019590068993303 24.631112454046434 125-129 28.759124087591243 25.119557009816262 22.949911905361187 23.171406997231312 130-134 29.533209124326504 25.42424089833325 21.854071201973916 23.188478775366335 135-139 29.726054990432065 25.01258938463088 22.237889011985093 23.02346661295196 140-144 30.021152296535053 25.775584206285252 21.76672038678485 22.436543110394844 145-149 31.040048421265006 25.09331181277111 21.905578533239183 21.961061232724706 150-151 31.60419033194497 25.709958349110185 20.850687870756026 21.83516344818882 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 1.5 3 2.5 4 3.0 5 3.0 6 3.0 7 3.5 8 2.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 1.0 27 1.5 28 2.5 29 3.5 30 7.0 31 8.5 32 7.0 33 12.0 34 17.5 35 27.0 36 39.0 37 51.0 38 69.0 39 74.5 40 93.5 41 129.5 42 150.0 43 149.5 44 154.5 45 159.5 46 158.5 47 168.5 48 154.0 49 146.0 50 147.5 51 141.0 52 122.5 53 101.0 54 99.5 55 94.0 56 92.0 57 93.0 58 93.5 59 90.5 60 91.5 61 87.0 62 83.5 63 78.5 64 68.5 65 75.5 66 76.0 67 66.5 68 68.0 69 71.0 70 58.5 71 50.5 72 43.0 73 39.5 74 38.0 75 31.0 76 23.5 77 20.0 78 18.5 79 10.0 80 5.0 81 3.5 82 2.0 83 1.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.44999999999999996 3 0.5 4 0.4 5 0.4 6 0.475 7 0.5499999999999999 8 0.525 9 0.2 10-14 0.565 15-19 0.585 20-24 0.6649999999999999 25-29 0.655 30-34 0.525 35-39 0.625 40-44 0.5700000000000001 45-49 0.49 50-54 0.52 55-59 0.52 60-64 0.51 65-69 0.5499999999999999 70-74 0.52 75-79 0.565 80-84 0.59 85-89 0.615 90-94 0.575 95-99 0.5950000000000001 100-104 0.565 105-109 0.58 110-114 0.73 115-119 0.455 120-124 0.715 125-129 0.675 130-134 0.705 135-139 0.7100000000000001 140-144 0.72 145-149 0.8699999999999999 150-151 0.9625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.0625 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.1375 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.44999999999999996 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 1.0 0.0 0.0 0.0 0.0 90-91 1.2375 0.0 0.0 0.0 0.0 92-93 1.3875000000000002 0.0 0.0 0.0 0.0 94-95 1.5625 0.0 0.0 0.0 0.0 96-97 1.7999999999999998 0.0 0.0 0.0 0.0 98-99 2.25 0.0 0.0 0.0 0.0 100-101 2.8125 0.0 0.0 0.0 0.0 102-103 3.4 0.0 0.0 0.0 0.0 104-105 4.2 0.0 0.0 0.0 0.0 106-107 5.0375 0.0 0.0 0.0 0.0 108-109 5.775 0.0 0.0 0.0 0.0 110-111 6.525 0.0 0.0 0.0 0.0 112-113 7.300000000000001 0.0 0.0 0.0 0.0 114-115 8.162500000000001 0.0 0.0 0.0 0.0 116-117 9.2625 0.0 0.0 0.0 0.0 118-119 10.287500000000001 0.0 0.0 0.0 0.0 120-121 11.475 0.0 0.0 0.0 0.0 122-123 12.899999999999999 0.0 0.0 0.0 0.0 124-125 14.35 0.0 0.0 0.0 0.0 126-127 15.6125 0.0 0.0 0.0 0.0 128-129 16.8125 0.0 0.0 0.0 0.0 130-131 18.125 0.0 0.0 0.0 0.0 132-133 19.674999999999997 0.0 0.0 0.0 0.0 134-135 21.137500000000003 0.0 0.0 0.0 0.0 136-137 22.7125 0.0 0.0 0.0 0.0 138-139 24.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGCCCG 10 0.006606125 146.6076 5 CCGCCAG 10 0.006862618 144.77501 9 CTCGGTG 35 0.0034657787 20.786074 140-144 >>END_MODULE Read 1878335 spots for SRR3420431.sra Written 1878335 spots for SRR3420431.sra Read 1878335 spots for SRR3420431.sra Written 1878335 spots for SRR3420431.sra Read 1878335 spots for SRR3420431.sra Written 1878335 spots for SRR3420431.sra Read 1878335 spots for SRR3420431.sra Written 1878335 spots for SRR3420431.sra Read 1878335 spots for SRR3420431.sra Written 1878335 spots for SRR3420431.sra Read 1878335 spots for SRR3420431.sra Written 1878335 spots for SRR3420431.sra Read 1878335 spots for SRR3420431.sra Written 1878335 spots for SRR3420431.sra Read 1878335 spots for SRR3420431.sra Written 1878335 spots for SRR3420431.sra Read 1878335 spots for SRR3420431.sra Written 1878335 spots for SRR3420431.sra Read 1878335 spots for SRR3420431.sra Written 1878335 spots for SRR3420431.sra Read 1878335 spots for SRR3420431.sra Written 1878335 spots for SRR3420431.sra Read 1878335 spots for SRR3420431.sra Written 1878335 spots for SRR3420431.sra Read 1878335 spots for SRR3420431.sra Written 1878335 spots for SRR3420431.sra Read 1878346 spots for SRR3420431.sra Written 1878346 spots for SRR3420431.sra Read 1878335 spots for SRR3420431.sra Written 1878335 spots for SRR3420431.sra Read 1878335 spots for SRR3420431.sra Written 1878335 spots for SRR3420431.sra Read 1878335 spots for SRR3420431.sra Written 1878335 spots for SRR3420431.sra Read 1878335 spots for SRR3420431.sra Written 1878335 spots for SRR3420431.sra Read 1878335 spots for SRR3420431.sra Written 1878335 spots for SRR3420431.sra Read 1878335 spots for SRR3420431.sra Written 1878335 spots for SRR3420431.sra SRR ids: ['SRR3420431.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_exwe6ts6 SRR3420431.sra spots: 37566711 blocks: [[1, 1878335], [1878336, 3756670], [3756671, 5635005], [5635006, 7513340], [7513341, 9391675], [9391676, 11270010], [11270011, 13148345], [13148346, 15026680], [15026681, 16905015], [16905016, 18783350], [18783351, 20661685], [20661686, 22540020], [22540021, 24418355], [24418356, 26296690], [26296691, 28175025], [28175026, 30053360], [30053361, 31931695], [31931696, 33810030], [33810031, 35688365], [35688366, 37566711]] SRR3420431 file size 12708425 SRR3420431 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3420431 SRR3420431_1.fastq SRR3420431_2.fastq Input file: SRR3420431_1.fastq Paired file: SRR3420431_2.fastq trimmed: SRR3420431-trimmed-pair1.fastq, SRR3420431-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:21:05 2024 >> started Tue Dec 10 00:21:49 2024 >> done (44.116s) 37566711 read pairs processed; of these: 202291 ( 0.54%) short read pairs filtered out after trimming by size control 364812 ( 0.97%) empty read pairs filtered out after trimming by size control 36999608 (98.49%) read pairs available; of these: 16860866 (45.57%) trimmed read pairs available after processing 20138742 (54.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 619 0.00% 19 568 0.00% 20 651 0.00% 21 707 0.00% 22 750 0.00% 23 749 0.00% 24 786 0.00% 25 842 0.00% 26 930 0.00% 27 927 0.00% 28 992 0.00% 29 1152 0.00% 30 1161 0.00% 31 1202 0.00% 32 1227 0.00% 33 1250 0.00% 34 1389 0.00% 35 1422 0.00% 36 1391 0.00% 37 1501 0.00% 38 1531 0.00% 39 1663 0.00% 40 1694 0.00% 41 1840 0.00% 42 1761 0.00% 43 1790 0.00% 44 1877 0.01% 45 1854 0.01% 46 2028 0.01% 47 1994 0.01% 48 2154 0.01% 49 2222 0.01% 50 2329 0.01% 51 2363 0.01% 52 2437 0.01% 53 2564 0.01% 54 2623 0.01% 55 2673 0.01% 56 2804 0.01% 57 3040 0.01% 58 3260 0.01% 59 3574 0.01% 60 3838 0.01% 61 4027 0.01% 62 4356 0.01% 63 4661 0.01% 64 5047 0.01% 65 5252 0.01% 66 5982 0.02% 67 6444 0.02% 68 6923 0.02% 69 7649 0.02% 70 8814 0.02% 71 9806 0.03% 72 10925 0.03% 73 11998 0.03% 74 13147 0.04% 75 14265 0.04% 76 15526 0.04% 77 17276 0.05% 78 18986 0.05% 79 21653 0.06% 80 24281 0.07% 81 27223 0.07% 82 31381 0.08% 83 35600 0.10% 84 45579 0.12% 85 52584 0.14% 86 58251 0.16% 87 60742 0.16% 88 65929 0.18% 89 72300 0.20% 90 77256 0.21% 91 84114 0.23% 92 89475 0.24% 93 97702 0.26% 94 104411 0.28% 95 110171 0.30% 96 112823 0.30% 97 118031 0.32% 98 121447 0.33% 99 126962 0.34% 100 134585 0.36% 101 144444 0.39% 102 154029 0.42% 103 163502 0.44% 104 171303 0.46% 105 176078 0.48% 106 181421 0.49% 107 184315 0.50% 108 188136 0.51% 109 194488 0.53% 110 200547 0.54% 111 209590 0.57% 112 220165 0.60% 113 230404 0.62% 114 239450 0.65% 115 247848 0.67% 116 247319 0.67% 117 247206 0.67% 118 247810 0.67% 119 250989 0.68% 120 254560 0.69% 121 263232 0.71% 122 272798 0.74% 123 281715 0.76% 124 291986 0.79% 125 298570 0.81% 126 290695 0.79% 127 285606 0.77% 128 288277 0.78% 129 288185 0.78% 130 291974 0.79% 131 298388 0.81% 132 305945 0.83% 133 312532 0.84% 134 320324 0.87% 135 325874 0.88% 136 339456 0.92% 137 325691 0.88% 138 323927 0.88% 139 325488 0.88% 140 323196 0.87% 141 327915 0.89% 142 335175 0.91% 143 344669 0.93% 144 357743 0.97% 145 372857 1.01% 146 389407 1.05% 147 418462 1.13% 148 485357 1.31% 149 573535 1.55% 150 1130570 3.06% 151 20138742 54.43% 36999608 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=16 prefix-density=0.54 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=29 fanout-score=6.30 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=1.8 sequence=CTGGAGGAGGTGAAGAAGGAGTA criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=16 prefix-density=0.53 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.25 sequence-density-rank=19 fanout-score=5.18 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=2.9 sequence=GGCAGGTACTGGACAATGTGGAAGCTGCCCATGTTCGGGTGCACCGACGCCACGCAGGTGCT SRR3420431 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:22:37 Started mapping on | Dec 10 00:22:37 Finished on | Dec 10 00:25:15 Mapping speed, Million of reads per hour | 843.03 Number of input reads | 36999608 Average input read length | 279 UNIQUE READS: Uniquely mapped reads number | 35163435 Uniquely mapped reads % | 95.04% Average mapped length | 278.09 Number of splices: Total | 35132453 Number of splices: Annotated (sjdb) | 33217698 Number of splices: GT/AG | 34640692 Number of splices: GC/AG | 433513 Number of splices: AT/AC | 18556 Number of splices: Non-canonical | 39692 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.00% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 594324 % of reads mapped to multiple loci | 1.61% Number of reads mapped to too many loci | 129721 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.34% % of reads unmapped: other | 1.67% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1285173 1285173 1285173 N_multimapping 594324 594324 594324 N_noFeature 1234597 17803339 17978973 N_ambiguous 732331 60527 61825 UnstrandedReadsAssigned:33196507 PositiveStrandReadsAssigned:17299569 NegativeStrandReadsAssigned:17122637 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=129 echo kmer=125 SRR3420431 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3420431-trimmed-pair1.fastq SRR3420431-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,999,608 reads, 34,382,449 reads pseudoaligned [quant] estimated average fragment length: 186.439 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,310 rounds 52973 SRR3420431.ke.tsv 35125 SRR3420431.se.tsv 88098 total ==> SRR3420431.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 750.7 0 0 PNS24247 1044 858.561 56.9881 2.73999 PNS24249 1928 1742.56 275.015 6.51484 PNS24246 1044 858.561 56.9881 2.73999 PNS24248 1044 858.561 56.9881 2.73999 PNS24244 1471 1285.56 55.0208 1.76673 PNS24243 293 125.962 20 6.55428 KQK14069 1603 1417.56 1985.66 57.8227 KQK14071 474 293.61 127.917 17.9843 ==> SRR3420431.se.tsv <== BRADI_1g14170v3 2215 BRADI_1g53295v3 103 BRADI_1g59795v3 582 BRADI_1g07683v3 0 BRADI_1g00485v3 120 BRADI_1g20270v3 5870 BRADI_1g74790v3 531 BRADI_1g09890v3 13 BRADI_1g77505v3 640 BRADI_1g48960v3 2 SRR3420431 completed mapping pipeline successfully