Starting /dee2/code/volunteer_pipeline.sh SRR349785 current disk space = 1544240295936 free memory = 1602398196 SRR349785 SRAfilesize f61d583e746e303ea62e042dbf88fd2f SRR349785.sra SRR349785.sra file validated SRR349785 is single end SRR349785 is conventional basespace SRR349785 read1 length is 40 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR349785_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 40 %GC 56 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.34725 34.0 32.0 34.0 30.0 34.0 2 32.271 34.0 32.0 34.0 30.0 34.0 3 32.2465 34.0 32.0 34.0 30.0 34.0 4 32.23125 34.0 32.0 34.0 30.0 34.0 5 32.1895 34.0 32.0 34.0 30.0 34.0 6 32.29925 34.0 32.0 34.0 31.0 34.0 7 32.32325 34.0 32.0 34.0 31.0 34.0 8 32.368 34.0 33.0 34.0 31.0 34.0 9 32.27175 34.0 32.0 34.0 30.0 34.0 10 32.253 34.0 32.0 34.0 31.0 34.0 11 32.11075 34.0 32.0 34.0 30.0 34.0 12 31.9565 33.0 32.0 34.0 30.0 34.0 13 31.83725 33.0 32.0 34.0 29.0 34.0 14 31.719 33.0 32.0 34.0 29.0 34.0 15 31.17075 33.0 32.0 34.0 28.0 34.0 16 30.514 33.0 32.0 34.0 25.0 34.0 17 30.107 33.0 31.0 34.0 23.0 34.0 18 29.80225 33.0 31.0 34.0 21.0 34.0 19 28.1415 33.0 29.0 34.0 2.0 34.0 20 26.6905 32.0 26.0 34.0 2.0 34.0 21 25.36225 32.0 24.0 34.0 2.0 34.0 22 24.30975 31.0 18.0 34.0 2.0 34.0 23 22.464 30.0 2.0 33.0 2.0 34.0 24 21.25675 29.0 2.0 33.0 2.0 34.0 25 18.92275 26.0 2.0 32.0 2.0 34.0 26 12.7005 2.0 2.0 26.0 2.0 32.0 27 11.84775 2.0 2.0 24.0 2.0 31.0 28 11.24425 2.0 2.0 22.0 2.0 31.0 29 10.9875 2.0 2.0 21.0 2.0 30.0 30 10.03275 2.0 2.0 17.0 2.0 30.0 31 8.6695 2.0 2.0 15.0 2.0 26.0 32 8.16875 2.0 2.0 14.0 2.0 24.0 33 8.33175 2.0 2.0 14.0 2.0 25.0 34 8.45 2.0 2.0 15.0 2.0 25.0 35 8.54 2.0 2.0 15.0 2.0 25.0 36 12.08 2.0 2.0 29.0 2.0 33.0 37 12.5295 2.0 2.0 30.0 2.0 33.0 38 12.7065 2.0 2.0 31.0 2.0 33.0 39 12.772 2.0 2.0 31.0 2.0 34.0 40 12.71125 2.0 2.0 31.0 2.0 34.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 >>END_MODULE >>Per sequence quality scores warn #Quality Count 2 42.0 3 0.0 4 4.0 5 9.0 6 2.0 7 9.0 8 19.0 9 21.0 10 15.0 11 41.0 12 62.0 13 82.0 14 80.0 15 159.0 16 242.0 17 194.0 18 191.0 19 260.0 20 315.0 21 404.0 22 77.0 23 115.0 24 118.0 25 98.0 26 104.0 27 181.0 28 303.0 29 337.0 30 267.0 31 148.0 32 80.0 33 21.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.989994997498748 8.379189594797399 12.956478239119559 48.674337168584294 2 26.150000000000002 21.175 30.875000000000004 21.8 3 27.900000000000002 24.224999999999998 21.0 26.875 4 29.45 29.65 16.275000000000002 24.625 5 29.075 29.5 18.8 22.625 6 22.075 35.875 20.0 22.05 7 18.775 15.125 41.175 24.925 8 23.5 19.075 24.025 33.4 9 23.25 17.349999999999998 29.599999999999998 29.799999999999997 10 23.674999999999997 34.849999999999994 21.224999999999998 20.25 11 28.575 23.05 18.375 30.0 12 23.225 20.925 25.900000000000002 29.95 13 22.6 24.6 27.175 25.624999999999996 14 24.775 24.775 24.175 26.275 15 25.85 24.125 23.599999999999998 26.424999999999997 16 25.45 23.200000000000003 24.25 27.1 17 25.75 23.1 24.675 26.474999999999998 18 24.85 24.525 23.799999999999997 26.825 19 26.724999999999998 19.375 25.5 28.4 20 27.125 19.25 24.375 29.25 21 24.075 24.45 24.925 26.55 22 24.474999999999998 22.7 25.8 27.025 23 26.974999999999998 18.6 25.374999999999996 29.049999999999997 24 28.025 17.1 24.375 30.5 25 27.434292866082604 13.441802252816021 22.95369211514393 36.17021276595745 26 24.575 14.85 21.725 38.85 27 25.625625625625624 19.294294294294296 21.996996996996998 33.08308308308308 28 26.097930338213022 10.045431600201917 22.21100454316002 41.64563351842504 29 26.34367903103709 12.843805198082261 21.44839767852637 39.364118092354275 30 25.516372795969772 13.551637279596978 22.115869017632242 38.816120906801004 31 24.87437185929648 12.060301507537687 21.582914572864322 41.48241206030151 32 27.434738955823295 12.098393574297189 19.477911646586346 40.988955823293175 33 25.252016129032256 12.14717741935484 21.900201612903224 40.70060483870967 34 24.540649383337527 15.051598288447018 22.401208155046564 38.00654417316889 35 27.48671222475323 13.059984813971145 20.045558086560362 39.40774487471526 36 26.037735849056602 18.89308176100629 22.742138364779873 32.32704402515723 37 25.55 24.474999999999998 23.0 26.974999999999998 38 28.119463426980513 24.3482662617059 21.741331308529485 25.790939002784107 39 26.22703246916688 23.710042788824566 22.678077019884217 27.384847722124338 40 25.888580791530124 23.191328459793294 23.367784219813462 27.55230652886312 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 2.0 24 6.5 25 11.0 26 11.0 27 11.0 28 11.0 29 18.0 30 25.0 31 31.5 32 38.0 33 38.0 34 53.5 35 69.0 36 85.0 37 101.0 38 101.0 39 115.0 40 129.0 41 173.5 42 218.0 43 218.0 44 236.5 45 255.0 46 260.0 47 265.0 48 265.0 49 276.5 50 288.0 51 296.5 52 305.0 53 305.0 54 309.0 55 313.0 56 308.0 57 303.0 58 303.0 59 291.0 60 279.0 61 267.5 62 256.0 63 256.0 64 250.0 65 244.0 66 228.0 67 212.0 68 212.0 69 211.0 70 210.0 71 179.5 72 149.0 73 149.0 74 131.0 75 113.0 76 94.5 77 76.0 78 76.0 79 66.0 80 56.0 81 45.0 82 34.0 83 34.0 84 24.0 85 14.0 86 11.5 87 9.0 88 9.0 89 7.5 90 6.0 91 5.0 92 4.0 93 4.0 94 2.5 95 1.0 96 1.0 97 1.0 98 1.0 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.125 26 0.0 27 0.1 28 0.95 29 0.9249999999999999 30 0.75 31 0.5 32 0.4 33 0.8 34 0.675 35 1.225 36 0.625 37 0.0 38 1.225 39 0.675 40 0.8250000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 40 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1206409 spots for SRR349785.sra Written 1206409 spots for SRR349785.sra Read 1206409 spots for SRR349785.sra Written 1206409 spots for SRR349785.sra Read 1206409 spots for SRR349785.sra Written 1206409 spots for SRR349785.sra Read 1206409 spots for SRR349785.sra Written 1206409 spots for SRR349785.sra Read 1206409 spots for SRR349785.sra Written 1206409 spots for SRR349785.sra Read 1206409 spots for SRR349785.sra Written 1206409 spots for SRR349785.sra Read 1206409 spots for SRR349785.sra Written 1206409 spots for SRR349785.sra Read 1206409 spots for SRR349785.sra Written 1206409 spots for SRR349785.sra Read 1206409 spots for SRR349785.sra Written 1206409 spots for SRR349785.sra Read 1206409 spots for SRR349785.sra Written 1206409 spots for SRR349785.sra Read 1206409 spots for SRR349785.sra Written 1206409 spots for SRR349785.sra Read 1206409 spots for SRR349785.sra Written 1206409 spots for SRR349785.sra Read 1206409 spots for SRR349785.sra Written 1206409 spots for SRR349785.sra Read 1206422 spots for SRR349785.sra Written 1206422 spots for SRR349785.sra Read 1206409 spots for SRR349785.sra Written 1206409 spots for SRR349785.sra Read 1206409 spots for SRR349785.sra Written 1206409 spots for SRR349785.sra Read 1206409 spots for SRR349785.sra Written 1206409 spots for SRR349785.sra Read 1206409 spots for SRR349785.sra Written 1206409 spots for SRR349785.sra Read 1206409 spots for SRR349785.sra Written 1206409 spots for SRR349785.sra Read 1206409 spots for SRR349785.sra Written 1206409 spots for SRR349785.sra SRR ids: ['SRR349785.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tovn4amc SRR349785.sra spots: 24128193 blocks: [[1, 1206409], [1206410, 2412818], [2412819, 3619227], [3619228, 4825636], [4825637, 6032045], [6032046, 7238454], [7238455, 8444863], [8444864, 9651272], [9651273, 10857681], [10857682, 12064090], [12064091, 13270499], [13270500, 14476908], [14476909, 15683317], [15683318, 16889726], [16889727, 18096135], [18096136, 19302544], [19302545, 20508953], [20508954, 21715362], [21715363, 22921771], [22921772, 24128193]] SRR349785 file size 3433210 SRR349785 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR349785 SRR349785_1.fastq Input file: SRR349785_1.fastq trimmed: SRR349785-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:13:53 2024 >> started Sat Dec 7 09:14:10 2024 >> done (17.442s) 24128193 reads processed; of these: 240918 ( 1.00%) short reads filtered out after trimming by size control 182326 ( 0.76%) empty reads filtered out after trimming by size control 23704949 (98.25%) reads available; of these: 2119549 ( 8.94%) trimmed reads available after processing 21585400 (91.06%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 30719 0.13% 19 58220 0.25% 20 107754 0.45% 21 25285 0.11% 22 35169 0.15% 23 54309 0.23% 24 101619 0.43% 25 197321 0.83% 26 36553 0.15% 27 48209 0.20% 28 75474 0.32% 29 136495 0.58% 30 233351 0.98% 31 46947 0.20% 32 65252 0.28% 33 97864 0.41% 34 174212 0.73% 35 309266 1.30% 36 49170 0.21% 37 54337 0.23% 38 69984 0.30% 39 112039 0.47% 40 21585400 91.06% 23704949 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=1.91 fanout-score-rank=24 prefix-density=0.17 prefix-fanout=1.9 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=7.08 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=1.7 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCC Started job on | Dec 07 09:14:21 Started mapping on | Dec 07 09:14:21 Finished on | Dec 07 09:14:44 Mapping speed, Million of reads per hour | 3710.34 Number of input reads | 23704949 Average input read length | 39 UNIQUE READS: Uniquely mapped reads number | 22400585 Uniquely mapped reads % | 94.50% Average mapped length | 39.01 Number of splices: Total | 2366832 Number of splices: Annotated (sjdb) | 2299110 Number of splices: GT/AG | 2337723 Number of splices: GC/AG | 27032 Number of splices: AT/AC | 669 Number of splices: Non-canonical | 1408 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.30 Insertion rate per base | 0.00% Insertion average length | 1.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 924390 % of reads mapped to multiple loci | 3.90% Number of reads mapped to too many loci | 171171 % of reads mapped to too many loci | 0.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.86% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 379974 379974 379974 N_multimapping 924390 924390 924390 N_noFeature 616884 11479703 11241562 N_ambiguous 371005 62637 14614 UnstrandedReadsAssigned:21412696 PositiveStrandReadsAssigned:10858245 NegativeStrandReadsAssigned:11144409 Dataset is classified unstranded MeadianReadLen=40 20thPercentileLength=40 echo kmer=35 SRR349785 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR349785-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,704,949 reads, 20,883,932 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52973 SRR349785.ke.tsv 35125 SRR349785.se.tsv 88098 total ==> SRR349785.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 34.5134 2.85935 PNS24247 1044 945 18.1494 1.33179 PNS24249 1928 1829 73.0767 2.77058 PNS24246 1044 945 18.1494 1.33179 PNS24248 1044 945 18.1494 1.33179 PNS24244 1471 1372 43.9618 2.22191 PNS24243 293 194 3 1.07232 KQK14069 1603 1504 1867.19 86.0887 KQK14071 474 375 1173.79 217.053 ==> SRR349785.se.tsv <== BRADI_1g14170v3 3734 BRADI_1g53295v3 56 BRADI_1g59795v3 375 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 405 BRADI_1g74790v3 143 BRADI_1g09890v3 3 BRADI_1g77505v3 268 BRADI_1g48960v3 0 SRR349785 completed mapping pipeline successfully