Starting /dee2/code/volunteer_pipeline.sh SRR349786 current disk space = 1544241025024 free memory = 1600959932 SRR349786 SRAfilesize fc26cefa92d5c1b11240e99974b7299d SRR349786.sra SRR349786.sra file validated SRR349786 is single end SRR349786 is conventional basespace SRR349786 read1 length is 35 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR349786_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3265 34.0 34.0 34.0 33.0 34.0 2 33.16325 34.0 34.0 34.0 32.0 34.0 3 33.25675 34.0 34.0 34.0 32.0 34.0 4 33.15025 34.0 34.0 34.0 32.0 34.0 5 33.09375 34.0 34.0 34.0 32.0 34.0 6 33.25575 34.0 34.0 34.0 32.0 34.0 7 33.247 34.0 34.0 34.0 32.0 34.0 8 33.23125 34.0 34.0 34.0 32.0 34.0 9 33.21925 34.0 34.0 34.0 32.0 34.0 10 33.15875 34.0 34.0 34.0 32.0 34.0 11 33.05425 34.0 34.0 34.0 32.0 34.0 12 32.93575 34.0 34.0 34.0 31.0 34.0 13 32.985 34.0 34.0 34.0 31.0 34.0 14 32.99575 34.0 34.0 34.0 31.0 34.0 15 32.828 34.0 34.0 34.0 31.0 34.0 16 32.379 34.0 33.0 34.0 29.0 34.0 17 32.2055 34.0 33.0 34.0 29.0 34.0 18 32.2965 34.0 33.0 34.0 30.0 34.0 19 32.07725 34.0 33.0 34.0 29.0 34.0 20 32.08875 34.0 33.0 34.0 29.0 34.0 21 31.6135 34.0 33.0 34.0 28.0 34.0 22 31.788 34.0 33.0 34.0 29.0 34.0 23 31.696 34.0 33.0 34.0 28.0 34.0 24 31.5475 34.0 32.0 34.0 28.0 34.0 25 31.42525 34.0 32.0 34.0 28.0 34.0 26 30.69075 34.0 32.0 34.0 24.0 34.0 27 30.869 34.0 32.0 34.0 25.0 34.0 28 30.7765 34.0 32.0 34.0 25.0 34.0 29 30.65875 34.0 32.0 34.0 24.0 34.0 30 30.147 34.0 31.0 34.0 22.0 34.0 31 29.46325 34.0 32.0 34.0 2.0 34.0 32 29.189 34.0 31.0 34.0 2.0 34.0 33 29.166 34.0 31.0 34.0 2.0 34.0 34 28.84275 34.0 31.0 34.0 2.0 34.0 35 28.69875 34.0 31.0 34.0 2.0 34.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 0.0 4 0.0 5 3.0 6 0.0 7 1.0 8 3.0 9 4.0 10 3.0 11 6.0 12 5.0 13 8.0 14 15.0 15 15.0 16 7.0 17 13.0 18 17.0 19 27.0 20 22.0 21 20.0 22 35.0 23 35.0 24 30.0 25 35.0 26 50.0 27 74.0 28 105.0 29 131.0 30 135.0 31 195.0 32 352.0 33 1988.0 34 656.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.599999999999998 12.7 14.224999999999998 43.475 2 29.65 20.875 28.625 20.849999999999998 3 27.075 24.65 23.35 24.925 4 28.775000000000002 28.749999999999996 18.5 23.974999999999998 5 28.95 31.924999999999997 18.525 20.599999999999998 6 22.1 36.975 18.45 22.475 7 20.7 16.475 37.475 25.35 8 22.075 21.975 24.55 31.4 9 22.75 19.925 28.525 28.799999999999997 10 23.474999999999998 34.825 21.224999999999998 20.474999999999998 11 28.599999999999998 23.7 17.875 29.825000000000003 12 23.775 22.05 26.650000000000002 27.525 13 23.25 25.85 26.150000000000002 24.75 14 25.374999999999996 25.374999999999996 25.525 23.724999999999998 15 24.88744372186093 25.012506253126567 23.961980990495245 26.138069034517258 16 24.575 26.174999999999997 23.875 25.374999999999996 17 26.125 24.75 23.599999999999998 25.525 18 24.275 25.85 24.099999999999998 25.775 19 26.575 25.05 23.225 25.15 20 24.625 24.85 23.275000000000002 27.250000000000004 21 24.30379746835443 25.240506329113927 25.39240506329114 25.063291139240505 22 26.206551637909474 23.680920230057513 23.080770192548137 27.031757939484873 23 25.724999999999998 25.25 23.45 25.575 24 25.025 26.25 24.349999999999998 24.375 25 26.05 25.650000000000002 23.375 24.925 26 26.0 25.474999999999998 23.225 25.3 27 24.75 26.075 24.7 24.474999999999998 28 26.325 25.025 22.275 26.375 29 25.900000000000002 24.85 24.25 25.0 30 23.88097024256064 24.356089022255563 24.831207801950487 26.93173293323331 31 25.704225352112676 24.823943661971832 24.899396378269618 24.572434607645878 32 24.887218045112782 25.86466165413534 24.210526315789473 25.03759398496241 33 22.88135593220339 27.324088341037495 24.319465844889574 25.475089881869543 34 25.02606882168926 25.62565172054223 23.61835245046924 25.72992700729927 35 27.14623260698346 25.09845103701759 22.578104489367288 25.17721186663166 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.0 19 2.0 20 4.0 21 7.0 22 10.0 23 10.0 24 18.5 25 27.0 26 27.0 27 37.5 28 48.0 29 48.0 30 70.0 31 92.0 32 92.0 33 119.0 34 146.0 35 146.0 36 192.5 37 239.0 38 239.0 39 263.5 40 288.0 41 330.5 42 373.0 43 373.0 44 389.0 45 405.0 46 405.0 47 406.5 48 408.0 49 408.0 50 373.0 51 338.0 52 338.0 53 337.0 54 336.0 55 336.0 56 302.0 57 268.0 58 268.0 59 252.5 60 237.0 61 218.5 62 200.0 63 200.0 64 187.0 65 174.0 66 174.0 67 141.5 68 109.0 69 109.0 70 107.0 71 105.0 72 105.0 73 92.0 74 79.0 75 79.0 76 67.5 77 56.0 78 56.0 79 42.5 80 29.0 81 21.5 82 14.0 83 14.0 84 11.0 85 8.0 86 8.0 87 6.0 88 4.0 89 4.0 90 2.5 91 1.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.05 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.25 22 0.025 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.025 31 0.6 32 0.25 33 2.65 34 4.1000000000000005 35 4.775 >>END_MODULE >>Sequence Length Distribution pass #Length Count 35 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49545913218971 98.6 2 0.479313824419778 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025227043390514632 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTAGCAGATCGGAAGAGCGGTTCAGCAGGAATG 18 0.44999999999999996 Illumina Paired End PCR Primer 2 (100% over 28bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.5 0.0 0.0 0.0 0.0 9 0.5 0.0 0.0 0.0 0.0 10 0.5 0.0 0.0 0.0 0.0 11 0.5 0.0 0.0 0.0 0.0 12 0.5 0.0 0.0 0.0 0.0 13 0.5 0.0 0.0 0.0 0.0 14 0.5 0.0 0.0 0.0 0.0 15 0.5 0.0 0.0 0.0 0.0 16 0.5 0.0 0.0 0.0 0.0 17 0.5 0.0 0.0 0.0 0.0 18 0.5 0.0 0.0 0.0 0.0 19 0.5 0.0 0.0 0.0 0.0 20 0.5 0.0 0.0 0.0 0.0 21 0.5 0.0 0.0 0.0 0.0 22 0.5 0.0 0.0 0.0 0.0 23 0.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 880061 spots for SRR349786.sra Written 880061 spots for SRR349786.sra Read 880061 spots for SRR349786.sra Written 880061 spots for SRR349786.sra Read 880061 spots for SRR349786.sra Written 880061 spots for SRR349786.sra Read 880061 spots for SRR349786.sra Written 880061 spots for SRR349786.sra Read 880061 spots for SRR349786.sra Written 880061 spots for SRR349786.sra Read 880061 spots for SRR349786.sra Written 880061 spots for SRR349786.sra Read 880061 spots for SRR349786.sra Written 880061 spots for SRR349786.sra Read 880061 spots for SRR349786.sra Written 880061 spots for SRR349786.sra Read 880061 spots for SRR349786.sra Written 880061 spots for SRR349786.sra Read 880061 spots for SRR349786.sra Written 880061 spots for SRR349786.sra Read 880061 spots for SRR349786.sra Written 880061 spots for SRR349786.sra Read 880062 spots for SRR349786.sra Written 880062 spots for SRR349786.sra Read 880061 spots for SRR349786.sra Written 880061 spots for SRR349786.sra Read 880061 spots for SRR349786.sra Written 880061 spots for SRR349786.sra Read 880061 spots for SRR349786.sra Written 880061 spots for SRR349786.sra Read 880061 spots for SRR349786.sra Written 880061 spots for SRR349786.sra Read 880061 spots for SRR349786.sra Written 880061 spots for SRR349786.sra Read 880061 spots for SRR349786.sra Written 880061 spots for SRR349786.sra Read 880061 spots for SRR349786.sra Written 880061 spots for SRR349786.sra Read 880061 spots for SRR349786.sra Written 880061 spots for SRR349786.sra SRR ids: ['SRR349786.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4r7ptjf7 SRR349786.sra spots: 17601221 blocks: [[1, 880061], [880062, 1760122], [1760123, 2640183], [2640184, 3520244], [3520245, 4400305], [4400306, 5280366], [5280367, 6160427], [6160428, 7040488], [7040489, 7920549], [7920550, 8800610], [8800611, 9680671], [9680672, 10560732], [10560733, 11440793], [11440794, 12320854], [12320855, 13200915], [13200916, 14080976], [14080977, 14961037], [14961038, 15841098], [15841099, 16721159], [16721160, 17601221]] SRR349786 file size 2329996 SRR349786 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR349786 SRR349786_1.fastq Input file: SRR349786_1.fastq trimmed: SRR349786-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:15:43 2024 >> started Sat Dec 7 09:15:52 2024 >> done (9.741s) 17601221 reads processed; of these: 94566 ( 0.54%) short reads filtered out after trimming by size control 68447 ( 0.39%) empty reads filtered out after trimming by size control 17438208 (99.07%) reads available; of these: 526541 ( 3.02%) trimmed reads available after processing 16911667 (96.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10709 0.06% 19 22590 0.13% 20 46281 0.27% 21 9937 0.06% 22 10717 0.06% 23 18824 0.11% 24 34665 0.20% 25 64635 0.37% 26 14518 0.08% 27 15522 0.09% 28 26770 0.15% 29 46708 0.27% 30 89811 0.52% 31 15424 0.09% 32 19013 0.11% 33 28624 0.16% 34 51793 0.30% 35 16911667 96.98% 17438208 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=25 prefix-density=0.00 prefix-fanout=1.0 sequence=GCTTAGCAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=17 fanout-score=179.63 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=15.7 sequence=CCGCCGCCGCCC Started job on | Dec 07 09:16:06 Started mapping on | Dec 07 09:16:08 Finished on | Dec 07 09:16:24 Mapping speed, Million of reads per hour | 3923.60 Number of input reads | 17438208 Average input read length | 34 UNIQUE READS: Uniquely mapped reads number | 15702803 Uniquely mapped reads % | 90.05% Average mapped length | 34.58 Number of splices: Total | 1357336 Number of splices: Annotated (sjdb) | 1314844 Number of splices: GT/AG | 1337682 Number of splices: GC/AG | 17179 Number of splices: AT/AC | 815 Number of splices: Non-canonical | 1660 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.31 Insertion rate per base | 0.00% Insertion average length | 1.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 843437 % of reads mapped to multiple loci | 4.84% Number of reads mapped to too many loci | 530461 % of reads mapped to too many loci | 3.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.04% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 891968 891968 891968 N_multimapping 843437 843437 843437 N_noFeature 478491 8371072 7608438 N_ambiguous 219161 8985 9459 UnstrandedReadsAssigned:15005151 PositiveStrandReadsAssigned:7322746 NegativeStrandReadsAssigned:8084906 Dataset is classified unstranded MeadianReadLen=35 20thPercentileLength=35 echo kmer=31 SRR349786 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR349786-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,438,208 reads, 15,004,529 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52973 SRR349786.ke.tsv 35125 SRR349786.se.tsv 88098 total ==> SRR349786.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 195.601 23.6633 PNS24247 1044 945 15.962 1.71035 PNS24249 1928 1829 297.64 16.4781 PNS24246 1044 945 15.962 1.71035 PNS24248 1044 945 15.962 1.71035 PNS24244 1471 1372 84.8726 6.26387 PNS24243 293 194 4 2.08779 KQK14069 1603 1504 19.9823 1.34532 KQK14071 474 375 0.133012 0.035916 ==> SRR349786.se.tsv <== BRADI_1g14170v3 20 BRADI_1g53295v3 36 BRADI_1g59795v3 168 BRADI_1g07683v3 0 BRADI_1g00485v3 27 BRADI_1g20270v3 1269 BRADI_1g74790v3 22 BRADI_1g09890v3 4 BRADI_1g77505v3 381 BRADI_1g48960v3 0 SRR349786 completed mapping pipeline successfully