Starting /dee2/code/volunteer_pipeline.sh SRR349787 current disk space = 1544237203456 free memory = 1605010232 SRR349787 SRAfilesize 2918fce02414911727d48f3aa39135f5 SRR349787.sra SRR349787.sra file validated SRR349787 is single end SRR349787 is conventional basespace SRR349787 read1 length is 35 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR349787_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16125 34.0 34.0 34.0 32.0 34.0 2 32.917 34.0 34.0 34.0 31.0 34.0 3 32.97275 34.0 34.0 34.0 31.0 34.0 4 32.86325 34.0 34.0 34.0 31.0 34.0 5 32.8865 34.0 34.0 34.0 31.0 34.0 6 33.05675 34.0 34.0 34.0 31.0 34.0 7 33.0375 34.0 34.0 34.0 31.0 34.0 8 32.99725 34.0 34.0 34.0 31.0 34.0 9 32.9575 34.0 34.0 34.0 31.0 34.0 10 32.87675 34.0 33.0 34.0 31.0 34.0 11 32.818 34.0 33.0 34.0 31.0 34.0 12 32.54975 34.0 33.0 34.0 30.0 34.0 13 32.667 34.0 33.0 34.0 30.0 34.0 14 32.60375 34.0 33.0 34.0 30.0 34.0 15 32.69675 34.0 33.0 34.0 30.0 34.0 16 32.0535 34.0 33.0 34.0 29.0 34.0 17 32.2395 34.0 33.0 34.0 29.0 34.0 18 32.1795 34.0 33.0 34.0 29.0 34.0 19 31.70275 34.0 32.0 34.0 27.0 34.0 20 31.77525 34.0 32.0 34.0 28.0 34.0 21 31.54525 34.0 32.0 34.0 27.0 34.0 22 31.41525 34.0 32.0 34.0 27.0 34.0 23 31.568 34.0 32.0 34.0 27.0 34.0 24 30.8905 34.0 31.0 34.0 25.0 34.0 25 31.238 34.0 32.0 34.0 27.0 34.0 26 30.75125 34.0 32.0 34.0 25.0 34.0 27 30.7345 34.0 32.0 34.0 25.0 34.0 28 30.35725 34.0 31.0 34.0 23.0 34.0 29 30.4885 34.0 31.0 34.0 24.0 34.0 30 29.6615 33.0 30.0 34.0 20.0 34.0 31 29.09325 34.0 31.0 34.0 2.0 34.0 32 28.84125 34.0 30.0 34.0 2.0 34.0 33 28.97825 34.0 31.0 34.0 2.0 34.0 34 28.5835 33.0 30.0 34.0 2.0 34.0 35 28.39075 33.0 30.0 34.0 2.0 34.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 0.0 4 0.0 5 0.0 6 3.0 7 1.0 8 2.0 9 5.0 10 6.0 11 1.0 12 8.0 13 6.0 14 14.0 15 13.0 16 11.0 17 10.0 18 22.0 19 25.0 20 24.0 21 18.0 22 27.0 23 36.0 24 33.0 25 41.0 26 50.0 27 87.0 28 125.0 29 159.0 30 179.0 31 256.0 32 421.0 33 2007.0 34 392.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.7 12.975 15.950000000000001 42.375 2 28.4 21.575 28.875 21.15 3 27.650000000000002 25.974999999999998 23.974999999999998 22.400000000000002 4 28.225 30.599999999999998 17.2 23.974999999999998 5 28.4 31.35 19.225 21.025 6 19.7 38.175 19.675 22.45 7 20.225 15.475 40.2 24.099999999999998 8 22.5 21.9 24.099999999999998 31.5 9 22.400000000000002 19.85 28.549999999999997 29.2 10 22.400000000000002 37.175000000000004 20.549999999999997 19.875 11 27.425 23.875 19.175 29.525000000000002 12 23.525 21.625 26.150000000000002 28.7 13 23.25 25.1 28.875 22.775000000000002 14 25.05 25.025 26.025 23.9 15 23.474999999999998 26.875 23.925 25.724999999999998 16 24.375 25.924999999999997 24.625 25.074999999999996 17 26.325 25.825 22.8 25.05 18 24.975 26.200000000000003 23.400000000000002 25.424999999999997 19 25.174999999999997 25.775 23.625 25.424999999999997 20 24.975 25.575 23.375 26.075 21 25.374999999999996 25.124999999999996 24.125 25.374999999999996 22 24.81240620310155 25.41270635317659 24.637318659329665 25.137568784392194 23 24.511767651477214 25.56334501752629 24.511767651477214 25.41311967951928 24 25.25 25.575 24.825 24.349999999999998 25 24.4 26.625 24.275 24.7 26 23.080770192548137 26.406601650412604 24.306076519129782 26.206551637909474 27 25.525 26.674999999999997 22.825 24.975 28 24.474999999999998 25.275 23.875 26.375 29 25.900000000000002 25.75 24.125 24.224999999999998 30 24.93116395494368 27.284105131414265 23.62953692115144 24.155193992490613 31 24.843161856963615 25.545796737766622 24.868255959849435 24.742785445420328 32 25.050200803212853 25.552208835341368 23.895582329317268 25.502008032128515 33 25.179487179487182 26.923076923076923 24.846153846153847 23.05128205128205 34 23.84157390629045 26.76676158426094 23.945120372767278 25.446544136681336 35 26.313025210084035 24.92121848739496 23.686974789915965 25.07878151260504 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 2.5 17 4.0 18 4.0 19 4.0 20 4.0 21 8.0 22 12.0 23 12.0 24 19.0 25 26.0 26 26.0 27 39.5 28 53.0 29 53.0 30 79.5 31 106.0 32 106.0 33 143.5 34 181.0 35 181.0 36 208.0 37 235.0 38 235.0 39 275.0 40 315.0 41 356.5 42 398.0 43 398.0 44 400.5 45 403.0 46 403.0 47 385.0 48 367.0 49 367.0 50 375.5 51 384.0 52 384.0 53 351.5 54 319.0 55 319.0 56 300.0 57 281.0 58 281.0 59 254.0 60 227.0 61 209.0 62 191.0 63 191.0 64 162.5 65 134.0 66 134.0 67 127.5 68 121.0 69 121.0 70 100.0 71 79.0 72 79.0 73 69.5 74 60.0 75 60.0 76 50.5 77 41.0 78 41.0 79 36.5 80 32.0 81 25.5 82 19.0 83 19.0 84 9.5 85 0.0 86 0.0 87 1.5 88 3.0 89 3.0 90 2.0 91 1.0 92 1.0 93 1.0 94 1.0 95 1.0 96 0.5 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.05 23 0.15 24 0.0 25 0.0 26 0.025 27 0.0 28 0.0 29 0.0 30 0.125 31 0.375 32 0.4 33 2.5 34 3.4250000000000003 35 4.8 >>END_MODULE >>Sequence Length Distribution pass #Length Count 35 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59778783308195 99.05000000000001 2 0.35193564605329314 0.7000000000000001 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025138260432378077 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTAGCAGATCGGAAGAGCGGTTCAGCAGGAATG 7 0.17500000000000002 Illumina Paired End PCR Primer 2 (100% over 28bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.175 0.0 0.0 0.0 0.0 9 0.175 0.0 0.0 0.0 0.0 10 0.175 0.0 0.0 0.0 0.0 11 0.175 0.0 0.0 0.0 0.0 12 0.175 0.0 0.0 0.0 0.0 13 0.175 0.0 0.0 0.0 0.0 14 0.175 0.0 0.0 0.0 0.0 15 0.175 0.0 0.0 0.0 0.0 16 0.175 0.0 0.0 0.0 0.0 17 0.175 0.0 0.0 0.0 0.0 18 0.175 0.0 0.0 0.0 0.0 19 0.175 0.0 0.0 0.0 0.0 20 0.175 0.0 0.0 0.0 0.0 21 0.175 0.0 0.0 0.0 0.0 22 0.175 0.0 0.0 0.0 0.0 23 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1156858 spots for SRR349787.sra Written 1156858 spots for SRR349787.sra Read 1156858 spots for SRR349787.sra Written 1156858 spots for SRR349787.sra Read 1156858 spots for SRR349787.sra Written 1156858 spots for SRR349787.sra Read 1156858 spots for SRR349787.sra Written 1156858 spots for SRR349787.sra Read 1156858 spots for SRR349787.sra Written 1156858 spots for SRR349787.sra Read 1156858 spots for SRR349787.sra Written 1156858 spots for SRR349787.sra Read 1156858 spots for SRR349787.sra Written 1156858 spots for SRR349787.sra Read 1156858 spots for SRR349787.sra Written 1156858 spots for SRR349787.sra Read 1156858 spots for SRR349787.sra Written 1156858 spots for SRR349787.sra Read 1156858 spots for SRR349787.sra Written 1156858 spots for SRR349787.sra Read 1156858 spots for SRR349787.sra Written 1156858 spots for SRR349787.sra Read 1156858 spots for SRR349787.sra Written 1156858 spots for SRR349787.sra Read 1156858 spots for SRR349787.sra Written 1156858 spots for SRR349787.sra Read 1156858 spots for SRR349787.sra Written 1156858 spots for SRR349787.sra Read 1156858 spots for SRR349787.sra Written 1156858 spots for SRR349787.sra Read 1156858 spots for SRR349787.sra Written 1156858 spots for SRR349787.sra Read 1156858 spots for SRR349787.sra Written 1156858 spots for SRR349787.sra Read 1156858 spots for SRR349787.sra Written 1156858 spots for SRR349787.sra Read 1156858 spots for SRR349787.sra Written 1156858 spots for SRR349787.sra Read 1156863 spots for SRR349787.sra Written 1156863 spots for SRR349787.sra SRR ids: ['SRR349787.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m_uz11wd SRR349787.sra spots: 23137165 blocks: [[1, 1156858], [1156859, 2313716], [2313717, 3470574], [3470575, 4627432], [4627433, 5784290], [5784291, 6941148], [6941149, 8098006], [8098007, 9254864], [9254865, 10411722], [10411723, 11568580], [11568581, 12725438], [12725439, 13882296], [13882297, 15039154], [15039155, 16196012], [16196013, 17352870], [17352871, 18509728], [18509729, 19666586], [19666587, 20823444], [20823445, 21980302], [21980303, 23137165]] SRR349787 file size 3066220 SRR349787 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR349787 SRR349787_1.fastq Input file: SRR349787_1.fastq trimmed: SRR349787-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:18:51 2024 >> started Sat Dec 7 09:19:04 2024 >> done (13.286s) 23137165 reads processed; of these: 155493 ( 0.67%) short reads filtered out after trimming by size control 108309 ( 0.47%) empty reads filtered out after trimming by size control 22873363 (98.86%) reads available; of these: 754497 ( 3.30%) trimmed reads available after processing 22118866 (96.70%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 16444 0.07% 19 34032 0.15% 20 67445 0.29% 21 13226 0.06% 22 15786 0.07% 23 26267 0.11% 24 48802 0.21% 25 88247 0.39% 26 18891 0.08% 27 22122 0.10% 28 37552 0.16% 29 65828 0.29% 30 133322 0.58% 31 21242 0.09% 32 27944 0.12% 33 41288 0.18% 34 76059 0.33% 35 22118866 96.70% 22873363 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=23 prefix-density=0.00 prefix-fanout=1.0 sequence=GCTTAGCAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=13 fanout-score=96.57 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=12.5 sequence=GCCGCCGCCACC Started job on | Dec 07 09:19:17 Started mapping on | Dec 07 09:19:17 Finished on | Dec 07 09:19:33 Mapping speed, Million of reads per hour | 5146.51 Number of input reads | 22873363 Average input read length | 34 UNIQUE READS: Uniquely mapped reads number | 20558264 Uniquely mapped reads % | 89.88% Average mapped length | 34.62 Number of splices: Total | 1768394 Number of splices: Annotated (sjdb) | 1721422 Number of splices: GT/AG | 1744805 Number of splices: GC/AG | 21113 Number of splices: AT/AC | 963 Number of splices: Non-canonical | 1513 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.00% Deletion average length | 1.30 Insertion rate per base | 0.00% Insertion average length | 1.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1034847 % of reads mapped to multiple loci | 4.52% Number of reads mapped to too many loci | 923795 % of reads mapped to too many loci | 4.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.52% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1280252 1280252 1280252 N_multimapping 1034847 1034847 1034847 N_noFeature 585598 10773712 10098543 N_ambiguous 299821 15751 13756 UnstrandedReadsAssigned:19672845 PositiveStrandReadsAssigned:9768801 NegativeStrandReadsAssigned:10445965 Dataset is classified unstranded MeadianReadLen=35 20thPercentileLength=35 echo kmer=31 SRR349787 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR349787-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,873,363 reads, 19,721,850 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52973 SRR349787.ke.tsv 35125 SRR349787.se.tsv 88098 total ==> SRR349787.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 85.8439 7.9871 PNS24247 1044 945 11.6583 0.960745 PNS24249 1928 1829 240.131 10.2245 PNS24246 1044 945 11.6583 0.960745 PNS24248 1044 945 11.6583 0.960745 PNS24244 1471 1372 125.05 7.09797 PNS24243 293 194 2 0.802848 KQK14069 1603 1504 42.4548 2.19829 KQK14071 474 375 25.3008 5.25421 ==> SRR349787.se.tsv <== BRADI_1g14170v3 70 BRADI_1g53295v3 4 BRADI_1g59795v3 160 BRADI_1g07683v3 0 BRADI_1g00485v3 42 BRADI_1g20270v3 5340 BRADI_1g74790v3 97 BRADI_1g09890v3 18 BRADI_1g77505v3 389 BRADI_1g48960v3 4 SRR349787 completed mapping pipeline successfully