Starting /dee2/code/volunteer_pipeline.sh SRR352137 current disk space = 1544236834816 free memory = 1598127636 SRR352137 SRAfilesize 2a7fd655f04e04cb4ddec6f11cf50272 SRR352137.sra SRR352137.sra file validated SRR352137 is single end SRR352137 is conventional basespace SRR352137 read1 length is 35 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR352137_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.4215 34.0 34.0 34.0 33.0 34.0 2 33.279 34.0 34.0 34.0 32.0 34.0 3 33.229 34.0 34.0 34.0 32.0 34.0 4 33.206 34.0 34.0 34.0 32.0 34.0 5 33.20925 34.0 34.0 34.0 32.0 34.0 6 33.277 34.0 34.0 34.0 32.0 34.0 7 33.3095 34.0 34.0 34.0 32.0 34.0 8 33.3035 34.0 34.0 34.0 32.0 34.0 9 33.221 34.0 34.0 34.0 32.0 34.0 10 33.28775 34.0 34.0 34.0 32.0 34.0 11 33.1385 34.0 34.0 34.0 32.0 34.0 12 33.104 34.0 34.0 34.0 31.0 34.0 13 33.10025 34.0 34.0 34.0 32.0 34.0 14 33.088 34.0 34.0 34.0 31.0 34.0 15 32.93975 34.0 34.0 34.0 31.0 34.0 16 32.68875 34.0 34.0 34.0 31.0 34.0 17 32.65675 34.0 33.0 34.0 30.0 34.0 18 32.65225 34.0 33.0 34.0 30.0 34.0 19 32.4875 34.0 33.0 34.0 30.0 34.0 20 32.27725 34.0 33.0 34.0 29.0 34.0 21 32.1745 34.0 33.0 34.0 29.0 34.0 22 32.07775 34.0 33.0 34.0 29.0 34.0 23 32.21225 34.0 33.0 34.0 30.0 34.0 24 31.952 34.0 33.0 34.0 29.0 34.0 25 31.88475 34.0 33.0 34.0 29.0 34.0 26 31.4855 34.0 33.0 34.0 28.0 34.0 27 31.63225 34.0 33.0 34.0 28.0 34.0 28 31.445 34.0 32.0 34.0 28.0 34.0 29 31.34925 34.0 32.0 34.0 27.0 34.0 30 31.0375 34.0 32.0 34.0 26.0 34.0 31 29.93875 34.0 32.0 34.0 20.0 34.0 32 30.09725 34.0 32.0 34.0 21.0 34.0 33 29.80375 34.0 31.0 34.0 18.0 34.0 34 29.803 34.0 32.0 34.0 18.0 34.0 35 29.66525 34.0 31.0 34.0 10.0 34.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 0.0 5 3.0 6 0.0 7 0.0 8 2.0 9 2.0 10 6.0 11 2.0 12 5.0 13 5.0 14 9.0 15 13.0 16 6.0 17 7.0 18 11.0 19 19.0 20 12.0 21 14.0 22 21.0 23 34.0 24 24.0 25 24.0 26 45.0 27 53.0 28 108.0 29 146.0 30 117.0 31 204.0 32 319.0 33 1978.0 34 803.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.374999999999996 11.525 14.774999999999999 42.325 2 31.0 20.025000000000002 27.800000000000004 21.175 3 28.65 24.8 22.275 24.275 4 28.4 30.15 18.0 23.45 5 28.999999999999996 32.625 18.3 20.075000000000003 6 21.925 36.275 19.1 22.7 7 19.900000000000002 15.475 39.050000000000004 25.575 8 22.95 22.225 23.825 31.0 9 23.724999999999998 20.075000000000003 26.474999999999998 29.725 10 22.575 36.375 21.9 19.15 11 28.575 23.35 19.175 28.9 12 24.15 21.05 24.725 30.075000000000003 13 23.5 25.174999999999997 27.825 23.5 14 26.6 24.85 24.25 24.3 15 24.075 25.650000000000002 24.375 25.900000000000002 16 25.4 25.7 24.0 24.9 17 26.85 24.224999999999998 23.25 25.674999999999997 18 24.224999999999998 27.200000000000003 23.05 25.525 19 25.924999999999997 24.8 23.549999999999997 25.724999999999998 20 25.8 25.275 23.474999999999998 25.45 21 25.445867872393872 25.295151971866364 23.43632253202713 25.822657623712637 22 26.02053593789131 24.61808164287503 23.94189832206361 25.41948409717005 23 26.025 25.55 24.5 23.925 24 24.75 25.374999999999996 24.3 25.575 25 25.174999999999997 26.474999999999998 22.55 25.8 26 26.0 26.700000000000003 22.05 25.25 27 26.400000000000002 26.174999999999997 22.7 24.725 28 25.4 25.3 22.75 26.55 29 26.85 26.075 22.225 24.85 30 25.812906453226613 26.28814407203602 21.860930465232617 26.038019009504755 31 25.427565392354122 26.006036217303823 23.088531187122737 25.47786720321932 32 25.962264150943398 26.490566037735846 22.968553459119498 24.57861635220126 33 24.652956298200515 28.174807197943448 21.876606683804628 25.295629820051413 34 24.284971398855955 24.20696827873115 25.117004680187204 26.39105564222569 35 27.826993225638354 24.64825429911412 23.501823866597185 24.022928608650336 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.5 17 2.0 18 2.0 19 3.0 20 4.0 21 8.5 22 13.0 23 13.0 24 22.0 25 31.0 26 31.0 27 44.0 28 57.0 29 57.0 30 78.5 31 100.0 32 100.0 33 122.0 34 144.0 35 144.0 36 191.0 37 238.0 38 238.0 39 265.0 40 292.0 41 311.5 42 331.0 43 331.0 44 355.0 45 379.0 46 379.0 47 370.5 48 362.0 49 362.0 50 364.5 51 367.0 52 367.0 53 350.5 54 334.0 55 334.0 56 323.5 57 313.0 58 313.0 59 272.0 60 231.0 61 206.5 62 182.0 63 182.0 64 167.0 65 152.0 66 152.0 67 144.0 68 136.0 69 136.0 70 116.5 71 97.0 72 97.0 73 95.0 74 93.0 75 93.0 76 81.0 77 69.0 78 69.0 79 54.5 80 40.0 81 29.0 82 18.0 83 18.0 84 13.0 85 8.0 86 8.0 87 5.0 88 2.0 89 2.0 90 1.5 91 1.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.5 97 1.0 98 1.0 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.475 22 0.17500000000000002 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.05 31 0.6 32 0.625 33 2.75 34 3.85 35 4.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 35 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5448798988622 98.425 2 0.35398230088495575 0.7000000000000001 3 0.025284450063211124 0.075 4 0.0 0.0 5 0.025284450063211124 0.125 6 0.025284450063211124 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025284450063211124 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTAGCAGATCGGAAGAGCGGTTCAGCAGGAATG 21 0.525 Illumina Paired End PCR Primer 2 (100% over 28bp) ATATTATAGATCGGAAGAGCGGTTCAGCAGGAATG 6 0.15 Illumina Paired End PCR Primer 2 (100% over 28bp) CGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGT 5 0.125 Illumina Paired End PCR Primer 2 (96% over 25bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.9 0.0 0.0 0.0 0.0 9 0.9 0.0 0.0 0.0 0.0 10 0.9 0.0 0.0 0.0 0.0 11 0.9 0.0 0.0 0.0 0.0 12 0.9 0.0 0.0 0.0 0.0 13 0.9 0.0 0.0 0.0 0.0 14 0.9 0.0 0.0 0.0 0.0 15 0.9 0.0 0.0 0.0 0.0 16 0.9 0.0 0.0 0.0 0.0 17 0.9 0.0 0.0 0.0 0.0 18 0.9 0.0 0.0 0.0 0.0 19 0.9 0.0 0.0 0.0 0.0 20 1.025 0.0 0.0 0.0 0.0 21 1.025 0.0 0.0 0.0 0.0 22 1.025 0.0 0.0 0.0 0.0 23 1.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 885641 spots for SRR352137.sra Written 885641 spots for SRR352137.sra Read 885641 spots for SRR352137.sra Written 885641 spots for SRR352137.sra Read 885641 spots for SRR352137.sra Written 885641 spots for SRR352137.sra Read 885650 spots for SRR352137.sra Written 885650 spots for SRR352137.sra Read 885641 spots for SRR352137.sra Written 885641 spots for SRR352137.sra Read 885641 spots for SRR352137.sra Written 885641 spots for SRR352137.sra Read 885641 spots for SRR352137.sra Written 885641 spots for SRR352137.sra Read 885641 spots for SRR352137.sra Written 885641 spots for SRR352137.sra Read 885641 spots for SRR352137.sra Written 885641 spots for SRR352137.sra Read 885641 spots for SRR352137.sra Written 885641 spots for SRR352137.sra Read 885641 spots for SRR352137.sra Written 885641 spots for SRR352137.sra Read 885641 spots for SRR352137.sra Written 885641 spots for SRR352137.sra Read 885641 spots for SRR352137.sra Written 885641 spots for SRR352137.sra Read 885641 spots for SRR352137.sra Written 885641 spots for SRR352137.sra Read 885641 spots for SRR352137.sra Written 885641 spots for SRR352137.sra Read 885641 spots for SRR352137.sra Written 885641 spots for SRR352137.sra Read 885641 spots for SRR352137.sra Written 885641 spots for SRR352137.sra Read 885641 spots for SRR352137.sra Written 885641 spots for SRR352137.sra Read 885641 spots for SRR352137.sra Written 885641 spots for SRR352137.sra Read 885641 spots for SRR352137.sra Written 885641 spots for SRR352137.sra SRR ids: ['SRR352137.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__mnc71od SRR352137.sra spots: 17712829 blocks: [[1, 885641], [885642, 1771282], [1771283, 2656923], [2656924, 3542564], [3542565, 4428205], [4428206, 5313846], [5313847, 6199487], [6199488, 7085128], [7085129, 7970769], [7970770, 8856410], [8856411, 9742051], [9742052, 10627692], [10627693, 11513333], [11513334, 12398974], [12398975, 13284615], [13284616, 14170256], [14170257, 15055897], [15055898, 15941538], [15941539, 16827179], [16827180, 17712829]] SRR352137 file size 2344924 SRR352137 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR352137 SRR352137_1.fastq Input file: SRR352137_1.fastq trimmed: SRR352137-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:18:34 2024 >> started Sat Dec 7 09:18:43 2024 >> done (8.995s) 17712829 reads processed; of these: 116508 ( 0.66%) short reads filtered out after trimming by size control 106054 ( 0.60%) empty reads filtered out after trimming by size control 17490267 (98.74%) reads available; of these: 447447 ( 2.56%) trimmed reads available after processing 17042820 (97.44%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9827 0.06% 19 20778 0.12% 20 40612 0.23% 21 8373 0.05% 22 9881 0.06% 23 15471 0.09% 24 28439 0.16% 25 51454 0.29% 26 11635 0.07% 27 13289 0.08% 28 21370 0.12% 29 38557 0.22% 30 80014 0.46% 31 13044 0.07% 32 16469 0.09% 33 23891 0.14% 34 44343 0.25% 35 17042820 97.44% 17490267 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=28 prefix-density=0.00 prefix-fanout=1.0 sequence=GCTTAGCAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=22 fanout-score=175.74 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.6 sequence=GCGGCGGCGGCAAAGAGCTCCGCCGACAAGAAGGCGGCGTGC Started job on | Dec 07 09:19:04 Started mapping on | Dec 07 09:19:04 Finished on | Dec 07 09:19:19 Mapping speed, Million of reads per hour | 4197.66 Number of input reads | 17490267 Average input read length | 34 UNIQUE READS: Uniquely mapped reads number | 15674605 Uniquely mapped reads % | 89.62% Average mapped length | 34.60 Number of splices: Total | 1310669 Number of splices: Annotated (sjdb) | 1267814 Number of splices: GT/AG | 1291869 Number of splices: GC/AG | 16291 Number of splices: AT/AC | 785 Number of splices: Non-canonical | 1724 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.30 Insertion rate per base | 0.00% Insertion average length | 1.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 715616 % of reads mapped to multiple loci | 4.09% Number of reads mapped to too many loci | 302300 % of reads mapped to too many loci | 1.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.53% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1100046 1100046 1100046 N_multimapping 715616 715616 715616 N_noFeature 443531 8332642 7431884 N_ambiguous 385308 15324 17348 UnstrandedReadsAssigned:14845766 PositiveStrandReadsAssigned:7326639 NegativeStrandReadsAssigned:8225373 Dataset is classified unstranded MeadianReadLen=35 20thPercentileLength=35 echo kmer=31 SRR352137 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR352137-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,490,267 reads, 14,909,073 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52973 SRR352137.ke.tsv 35125 SRR352137.se.tsv 88098 total ==> SRR352137.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 161.6 19.6334 PNS24247 1044 945 0 0 PNS24249 1928 1829 292.16 16.2438 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 55.2403 4.09432 PNS24243 293 194 2 1.04835 KQK14069 1603 1504 2266.55 153.249 KQK14071 474 375 1349.1 365.84 ==> SRR352137.se.tsv <== BRADI_1g14170v3 3834 BRADI_1g53295v3 73 BRADI_1g59795v3 126 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 588 BRADI_1g74790v3 139 BRADI_1g09890v3 1 BRADI_1g77505v3 368 BRADI_1g48960v3 3 SRR352137 completed mapping pipeline successfully