Starting /dee2/code/volunteer_pipeline.sh SRR352138 current disk space = 1544240066560 free memory = 1597882320 SRR352138 SRAfilesize 3d4e8e6b515698d1c9134e4f62081ae3 SRR352138.sra SRR352138.sra file validated SRR352138 is single end SRR352138 is conventional basespace SRR352138 read1 length is 35 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR352138_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92625 34.0 34.0 34.0 30.0 34.0 2 32.55025 34.0 33.0 34.0 30.0 34.0 3 32.579 34.0 33.0 34.0 30.0 34.0 4 32.573 34.0 33.0 34.0 30.0 34.0 5 32.41175 34.0 33.0 34.0 29.0 34.0 6 32.68575 34.0 34.0 34.0 30.0 34.0 7 32.71775 34.0 34.0 34.0 30.0 34.0 8 32.5925 34.0 33.0 34.0 30.0 34.0 9 32.63525 34.0 33.0 34.0 30.0 34.0 10 32.50725 34.0 33.0 34.0 30.0 34.0 11 32.516 34.0 33.0 34.0 30.0 34.0 12 32.28175 34.0 33.0 34.0 29.0 34.0 13 32.38525 34.0 33.0 34.0 29.0 34.0 14 32.31125 34.0 33.0 34.0 29.0 34.0 15 32.418 34.0 33.0 34.0 30.0 34.0 16 31.908 34.0 33.0 34.0 28.0 34.0 17 31.96625 34.0 33.0 34.0 29.0 34.0 18 31.91925 34.0 33.0 34.0 28.0 34.0 19 31.548 34.0 32.0 34.0 27.0 34.0 20 31.6995 34.0 32.0 34.0 27.0 34.0 21 31.3225 34.0 32.0 34.0 27.0 34.0 22 30.9925 34.0 31.0 34.0 25.0 34.0 23 31.07125 34.0 31.0 34.0 26.0 34.0 24 30.9555 34.0 31.0 34.0 25.0 34.0 25 30.99275 34.0 31.0 34.0 26.0 34.0 26 30.4885 34.0 31.0 34.0 24.0 34.0 27 30.52925 34.0 31.0 34.0 24.0 34.0 28 30.2195 34.0 31.0 34.0 23.0 34.0 29 30.20475 34.0 31.0 34.0 23.0 34.0 30 30.0245 34.0 31.0 34.0 22.0 34.0 31 29.5005 34.0 31.0 34.0 15.0 34.0 32 29.1835 34.0 30.0 34.0 12.0 34.0 33 29.29625 34.0 31.0 34.0 10.0 34.0 34 29.14575 34.0 30.0 34.0 2.0 34.0 35 28.99025 34.0 31.0 34.0 2.0 34.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 0.0 4 1.0 5 2.0 6 0.0 7 1.0 8 4.0 9 6.0 10 4.0 11 4.0 12 6.0 13 9.0 14 14.0 15 14.0 16 11.0 17 12.0 18 17.0 19 23.0 20 21.0 21 21.0 22 37.0 23 38.0 24 39.0 25 54.0 26 53.0 27 82.0 28 135.0 29 152.0 30 202.0 31 247.0 32 434.0 33 1886.0 34 447.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.849999999999998 11.600000000000001 14.149999999999999 44.4 2 28.725 20.025000000000002 29.625 21.625 3 26.825 24.325 23.425 25.424999999999997 4 29.575000000000003 29.225 17.474999999999998 23.724999999999998 5 29.725 31.674999999999997 18.5 20.1 6 20.349999999999998 36.65 20.1 22.900000000000002 7 21.075 16.45 37.675 24.8 8 22.5 20.549999999999997 23.875 33.074999999999996 9 22.400000000000002 19.725 28.199999999999996 29.675 10 23.3 36.325 19.05 21.325 11 28.525 23.95 17.925 29.599999999999998 12 24.0 21.3 24.55 30.15 13 23.655913978494624 24.88122030507627 27.631907976994246 23.830957739434858 14 24.075 24.5 25.874999999999996 25.55 15 25.424999999999997 24.325 24.625 25.624999999999996 16 24.6 24.075 25.074999999999996 26.25 17 25.7 25.924999999999997 22.75 25.624999999999996 18 24.349999999999998 26.474999999999998 23.25 25.924999999999997 19 25.3 24.7 23.025000000000002 26.974999999999998 20 25.68784392196098 23.936968484242122 22.736368184092047 27.63881940970485 21 25.324999999999996 25.2 24.325 25.15 22 24.825 25.374999999999996 24.3 25.5 23 26.44773126096766 25.294560040110305 23.013286537979443 25.24442216094259 24 25.900000000000002 25.674999999999997 24.525 23.9 25 25.275 25.724999999999998 23.599999999999998 25.4 26 25.825 26.450000000000003 22.55 25.174999999999997 27 25.8 24.675 24.125 25.4 28 25.6 24.85 23.35 26.200000000000003 29 25.624999999999996 24.875 23.075000000000003 26.424999999999997 30 24.81240620310155 25.437718859429715 23.461730865432717 26.28814407203602 31 26.34625062908908 25.817815802717664 23.125314544539506 24.71061902365375 32 26.107634543178975 25.3566958698373 23.329161451814766 25.20650813516896 33 26.044039483675018 23.614274867122248 24.01923563654771 26.322450012655025 34 25.18461930226636 25.617519735166795 23.427552839317546 25.770308123249297 35 26.46604938271605 27.00617283950617 22.325102880658438 24.20267489711934 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 2.0 17 3.0 18 3.0 19 2.5 20 2.0 21 5.0 22 8.0 23 8.0 24 14.5 25 21.0 26 21.0 27 39.5 28 58.0 29 58.0 30 78.5 31 99.0 32 99.0 33 127.5 34 156.0 35 156.0 36 186.5 37 217.0 38 217.0 39 245.0 40 273.0 41 312.5 42 352.0 43 352.0 44 363.0 45 374.0 46 374.0 47 391.5 48 409.0 49 409.0 50 378.5 51 348.0 52 348.0 53 335.5 54 323.0 55 323.0 56 306.5 57 290.0 58 290.0 59 252.0 60 214.0 61 211.0 62 208.0 63 208.0 64 188.5 65 169.0 66 169.0 67 143.0 68 117.0 69 117.0 70 123.5 71 130.0 72 130.0 73 108.5 74 87.0 75 87.0 76 74.0 77 61.0 78 61.0 79 49.5 80 38.0 81 26.5 82 15.0 83 15.0 84 15.0 85 15.0 86 15.0 87 11.5 88 8.0 89 8.0 90 5.5 91 3.0 92 3.0 93 1.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.025 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.05 21 0.0 22 0.0 23 0.27499999999999997 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.05 31 0.65 32 0.125 33 1.225 34 1.825 35 2.8000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 35 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.44823200203511 96.75 2 1.4245738997710506 2.8000000000000003 3 0.10175527855507505 0.3 4 0.0 0.0 5 0.0 0.0 6 0.02543881963876876 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTAGCAGATCGGAAGAGCGGTTCAGCAGGAATG 6 0.15 Illumina Paired End PCR Primer 2 (100% over 28bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.25 0.0 0.0 0.0 0.0 9 0.25 0.0 0.0 0.0 0.0 10 0.25 0.0 0.0 0.0 0.0 11 0.25 0.0 0.0 0.0 0.0 12 0.25 0.0 0.0 0.0 0.0 13 0.25 0.0 0.0 0.0 0.0 14 0.25 0.0 0.0 0.0 0.0 15 0.25 0.0 0.0 0.0 0.0 16 0.25 0.0 0.0 0.0 0.0 17 0.25 0.0 0.0 0.0 0.0 18 0.25 0.0 0.0 0.0 0.0 19 0.25 0.0 0.0 0.0 0.0 20 0.25 0.0 0.0 0.0 0.0 21 0.25 0.0 0.0 0.0 0.0 22 0.25 0.0 0.0 0.0 0.0 23 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1119959 spots for SRR352138.sra Written 1119959 spots for SRR352138.sra Read 1119959 spots for SRR352138.sra Written 1119959 spots for SRR352138.sra Read 1119959 spots for SRR352138.sra Written 1119959 spots for SRR352138.sra Read 1119959 spots for SRR352138.sra Written 1119959 spots for SRR352138.sra Read 1119959 spots for SRR352138.sra Written 1119959 spots for SRR352138.sra Read 1119959 spots for SRR352138.sra Written 1119959 spots for SRR352138.sra Read 1119959 spots for SRR352138.sra Written 1119959 spots for SRR352138.sra Read 1119959 spots for SRR352138.sra Written 1119959 spots for SRR352138.sra Read 1119959 spots for SRR352138.sra Written 1119959 spots for SRR352138.sra Read 1119959 spots for SRR352138.sra Written 1119959 spots for SRR352138.sra Read 1119972 spots for SRR352138.sra Written 1119972 spots for SRR352138.sra Read 1119959 spots for SRR352138.sra Written 1119959 spots for SRR352138.sra Read 1119959 spots for SRR352138.sra Written 1119959 spots for SRR352138.sra Read 1119959 spots for SRR352138.sra Written 1119959 spots for SRR352138.sra Read 1119959 spots for SRR352138.sra Written 1119959 spots for SRR352138.sra Read 1119959 spots for SRR352138.sra Written 1119959 spots for SRR352138.sra Read 1119959 spots for SRR352138.sra Written 1119959 spots for SRR352138.sra Read 1119959 spots for SRR352138.sra Written 1119959 spots for SRR352138.sra Read 1119959 spots for SRR352138.sra Written 1119959 spots for SRR352138.sra Read 1119959 spots for SRR352138.sra Written 1119959 spots for SRR352138.sra SRR ids: ['SRR352138.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mlm3_2de SRR352138.sra spots: 22399193 blocks: [[1, 1119959], [1119960, 2239918], [2239919, 3359877], [3359878, 4479836], [4479837, 5599795], [5599796, 6719754], [6719755, 7839713], [7839714, 8959672], [8959673, 10079631], [10079632, 11199590], [11199591, 12319549], [12319550, 13439508], [13439509, 14559467], [14559468, 15679426], [15679427, 16799385], [16799386, 17919344], [17919345, 19039303], [19039304, 20159262], [20159263, 21279221], [21279222, 22399193]] SRR352138 file size 2968048 SRR352138 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR352138 SRR352138_1.fastq Input file: SRR352138_1.fastq trimmed: SRR352138-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:19:34 2024 >> started Sat Dec 7 09:19:49 2024 >> done (15.315s) 22399193 reads processed; of these: 165658 ( 0.74%) short reads filtered out after trimming by size control 125522 ( 0.56%) empty reads filtered out after trimming by size control 22108013 (98.70%) reads available; of these: 761395 ( 3.44%) trimmed reads available after processing 21346618 (96.56%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 17422 0.08% 19 35343 0.16% 20 72164 0.33% 21 12595 0.06% 22 15686 0.07% 23 25242 0.11% 24 49420 0.22% 25 90846 0.41% 26 17482 0.08% 27 21678 0.10% 28 37188 0.17% 29 67529 0.31% 30 129669 0.59% 31 22434 0.10% 32 29373 0.13% 33 40763 0.18% 34 76561 0.35% 35 21346618 96.56% 22108013 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=28 prefix-density=0.00 prefix-fanout=1.0 sequence=GCTTAGCAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=16 fanout-score=105.87 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=8.8 sequence=GCGGCGGCGACGACAACAACAACCTCCAGATCGCCTGCTTCGAGATCCGCGCCGAGAAGAACGACAGGGTGTACCTCGCCGGAGCCAACAACGTGTTCAGCCAGCTCGACAGGATCTCCAAGGACCTGGCCTTCGGCGACGCCAGGGCCGTGGACGAGATGGTCAGGGGCAACCAGAAGAAAAAAGGCTTCCTCCCCGGGCCCGAGCAGCAGCAG Started job on | Dec 07 09:20:03 Started mapping on | Dec 07 09:20:03 Finished on | Dec 07 09:20:26 Mapping speed, Million of reads per hour | 3460.38 Number of input reads | 22108013 Average input read length | 34 UNIQUE READS: Uniquely mapped reads number | 17683417 Uniquely mapped reads % | 79.99% Average mapped length | 34.59 Number of splices: Total | 1220157 Number of splices: Annotated (sjdb) | 1180670 Number of splices: GT/AG | 1202718 Number of splices: GC/AG | 15084 Number of splices: AT/AC | 799 Number of splices: Non-canonical | 1556 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.31 Insertion rate per base | 0.00% Insertion average length | 1.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 805764 % of reads mapped to multiple loci | 3.64% Number of reads mapped to too many loci | 3085053 % of reads mapped to too many loci | 13.95% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.31% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3618832 3618832 3618832 N_multimapping 805764 805764 805764 N_noFeature 725362 9403878 8823740 N_ambiguous 196109 7538 8179 UnstrandedReadsAssigned:16761946 PositiveStrandReadsAssigned:8272001 NegativeStrandReadsAssigned:8851498 Dataset is classified unstranded MeadianReadLen=35 20thPercentileLength=35 echo kmer=31 SRR352138 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR352138-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,108,013 reads, 16,684,155 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,262 rounds 52973 SRR352138.ke.tsv 35125 SRR352138.se.tsv 88098 total ==> SRR352138.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 205.212 20.1697 PNS24247 1044 945 0 0 PNS24249 1928 1829 196.64 8.84463 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 170.148 10.2022 PNS24243 293 194 5 2.12027 KQK14069 1603 1504 89.5842 4.90011 KQK14071 474 375 44.0815 9.67046 ==> SRR352138.se.tsv <== BRADI_1g14170v3 149 BRADI_1g53295v3 772 BRADI_1g59795v3 176 BRADI_1g07683v3 1 BRADI_1g00485v3 12 BRADI_1g20270v3 783 BRADI_1g74790v3 7 BRADI_1g09890v3 1 BRADI_1g77505v3 285 BRADI_1g48960v3 2 SRR352138 completed mapping pipeline successfully