Starting /dee2/code/volunteer_pipeline.sh SRR352139 current disk space = 1544240578560 free memory = 1601364300 SRR352139 SRAfilesize 728963eb5e33f32172bd2d69aa7369f8 SRR352139.sra SRR352139.sra file validated SRR352139 is single end SRR352139 is conventional basespace SRR352139 read1 length is 35 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR352139_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.98725 33.0 28.0 34.0 15.0 34.0 2 23.18875 25.0 14.0 33.0 7.0 34.0 3 23.8225 29.0 15.0 34.0 7.0 34.0 4 25.01225 31.0 16.0 34.0 7.0 34.0 5 26.603 33.0 22.0 34.0 8.0 34.0 6 26.632 32.0 23.0 34.0 8.0 34.0 7 27.11925 32.0 24.0 34.0 11.0 34.0 8 26.54025 31.0 23.0 34.0 9.0 34.0 9 26.838 31.0 24.0 34.0 10.0 34.0 10 26.68425 31.0 23.0 34.0 10.0 34.0 11 27.345 32.0 25.0 34.0 9.0 34.0 12 27.32975 32.0 25.0 34.0 10.0 34.0 13 27.03025 32.0 25.0 34.0 9.0 34.0 14 26.94025 32.0 24.0 34.0 8.0 34.0 15 26.566 31.0 24.0 34.0 7.0 34.0 16 27.1615 32.0 25.0 34.0 2.0 34.0 17 27.4245 32.0 26.0 34.0 2.0 34.0 18 27.4375 32.0 26.0 34.0 2.0 34.0 19 27.44975 32.0 27.0 34.0 2.0 34.0 20 27.32275 32.0 26.0 34.0 2.0 34.0 21 27.40525 32.0 28.0 34.0 2.0 34.0 22 27.3525 33.0 27.0 34.0 2.0 34.0 23 27.285 33.0 27.0 34.0 2.0 34.0 24 26.735 32.0 26.0 34.0 2.0 34.0 25 26.66375 32.0 26.0 34.0 2.0 34.0 26 25.478 32.0 23.0 34.0 2.0 34.0 27 25.088 32.0 22.0 34.0 2.0 34.0 28 24.4725 31.0 18.0 34.0 2.0 34.0 29 23.51275 30.0 13.0 34.0 2.0 34.0 30 22.61125 30.0 8.0 33.0 2.0 34.0 31 23.33325 31.0 2.0 34.0 2.0 34.0 32 23.192 31.0 2.0 34.0 2.0 34.0 33 23.186 31.0 2.0 34.0 2.0 34.0 34 22.675 31.0 2.0 34.0 2.0 34.0 35 21.619 30.0 2.0 34.0 2.0 34.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 269.0 3 2.0 4 8.0 5 15.0 6 11.0 7 11.0 8 12.0 9 20.0 10 27.0 11 8.0 12 23.0 13 29.0 14 37.0 15 34.0 16 36.0 17 51.0 18 66.0 19 92.0 20 77.0 21 109.0 22 89.0 23 116.0 24 128.0 25 158.0 26 169.0 27 211.0 28 206.0 29 238.0 30 265.0 31 368.0 32 452.0 33 651.0 34 12.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.8 14.7 18.6 44.9 2 25.903614457831324 22.23895582329317 29.543172690763054 22.31425702811245 3 27.425 26.6 23.724999999999998 22.25 4 27.224999999999998 31.175000000000004 20.05 21.55 5 28.175 32.45 20.1 19.275000000000002 6 19.35 38.7 20.5 21.45 7 16.825000000000003 17.724999999999998 40.825 24.625 8 21.325 25.15 24.875 28.65 9 20.599999999999998 22.825 29.575000000000003 27.0 10 20.599999999999998 38.4 21.625 19.375 11 25.25 26.724999999999998 19.425 28.599999999999998 12 21.375 25.3 26.174999999999997 27.150000000000002 13 20.674999999999997 27.275 28.849999999999998 23.200000000000003 14 21.349999999999998 28.249999999999996 26.474999999999998 23.925 15 21.9 26.75 26.3 25.05 16 22.575 27.55 25.025 24.85 17 21.775 28.299999999999997 25.424999999999997 24.5 18 23.025000000000002 28.375 24.875 23.724999999999998 19 24.075 27.05 24.4 24.474999999999998 20 23.150000000000002 27.474999999999998 25.124999999999996 24.25 21 22.975 28.849999999999998 25.1 23.075000000000003 22 23.175 28.1 25.35 23.375 23 22.525000000000002 27.474999999999998 25.35 24.65 24 22.675 27.900000000000002 24.6 24.825 25 23.225 28.125 23.849999999999998 24.8 26 23.625 28.549999999999997 24.099999999999998 23.724999999999998 27 23.425 27.35 25.45 23.775 28 23.375 26.525 23.875 26.224999999999998 29 24.175 25.525 25.6 24.7 30 23.525 26.325 25.8 24.349999999999998 31 23.724999999999998 25.7 25.45 25.124999999999996 32 23.05 26.650000000000002 25.25 25.05 33 23.325000000000003 25.474999999999998 26.575 24.625 34 23.549999999999997 27.150000000000002 24.349999999999998 24.95 35 24.625 25.924999999999997 24.275 25.174999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 2.0 3 2.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.5 17 2.0 18 2.0 19 2.0 20 2.0 21 9.0 22 16.0 23 16.0 24 24.0 25 32.0 26 32.0 27 46.0 28 60.0 29 60.0 30 94.5 31 129.0 32 129.0 33 171.0 34 213.0 35 213.0 36 257.5 37 302.0 38 302.0 39 331.0 40 360.0 41 403.5 42 447.0 43 447.0 44 429.5 45 412.0 46 412.0 47 440.0 48 468.0 49 468.0 50 438.0 51 408.0 52 408.0 53 358.0 54 308.0 55 308.0 56 281.5 57 255.0 58 255.0 59 215.0 60 175.0 61 146.0 62 117.0 63 117.0 64 105.0 65 93.0 66 93.0 67 84.5 68 76.0 69 76.0 70 62.0 71 48.0 72 48.0 73 39.5 74 31.0 75 31.0 76 25.0 77 19.0 78 19.0 79 14.0 80 9.0 81 7.0 82 5.0 83 5.0 84 4.0 85 3.0 86 3.0 87 2.5 88 2.0 89 2.0 90 1.5 91 1.0 92 1.0 93 1.0 94 1.0 95 1.0 96 1.0 97 1.0 98 1.0 99 1.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 35 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1296127 spots for SRR352139.sra Written 1296127 spots for SRR352139.sra Read 1296127 spots for SRR352139.sra Written 1296127 spots for SRR352139.sra Read 1296127 spots for SRR352139.sra Written 1296127 spots for SRR352139.sra Read 1296127 spots for SRR352139.sra Written 1296127 spots for SRR352139.sra Read 1296127 spots for SRR352139.sra Written 1296127 spots for SRR352139.sra Read 1296127 spots for SRR352139.sra Written 1296127 spots for SRR352139.sra Read 1296127 spots for SRR352139.sra Written 1296127 spots for SRR352139.sra Read 1296127 spots for SRR352139.sra Written 1296127 spots for SRR352139.sra Read 1296127 spots for SRR352139.sra Written 1296127 spots for SRR352139.sra Read 1296127 spots for SRR352139.sra Written 1296127 spots for SRR352139.sra Read 1296127 spots for SRR352139.sra Written 1296127 spots for SRR352139.sra Read 1296127 spots for SRR352139.sra Written 1296127 spots for SRR352139.sra Read 1296127 spots for SRR352139.sra Written 1296127 spots for SRR352139.sra Read 1296127 spots for SRR352139.sra Written 1296127 spots for SRR352139.sra Read 1296127 spots for SRR352139.sra Written 1296127 spots for SRR352139.sra Read 1296127 spots for SRR352139.sra Written 1296127 spots for SRR352139.sra Read 1296127 spots for SRR352139.sra Written 1296127 spots for SRR352139.sra Read 1296127 spots for SRR352139.sra Written 1296127 spots for SRR352139.sra Read 1296127 spots for SRR352139.sra Written 1296127 spots for SRR352139.sra Read 1296142 spots for SRR352139.sra Written 1296142 spots for SRR352139.sra SRR ids: ['SRR352139.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i85e4mvv SRR352139.sra spots: 25922555 blocks: [[1, 1296127], [1296128, 2592254], [2592255, 3888381], [3888382, 5184508], [5184509, 6480635], [6480636, 7776762], [7776763, 9072889], [9072890, 10369016], [10369017, 11665143], [11665144, 12961270], [12961271, 14257397], [14257398, 15553524], [15553525, 16849651], [16849652, 18145778], [18145779, 19441905], [19441906, 20738032], [20738033, 22034159], [22034160, 23330286], [23330287, 24626413], [24626414, 25922555]] SRR352139 file size 3437056 SRR352139 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR352139 SRR352139_1.fastq Input file: SRR352139_1.fastq trimmed: SRR352139-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:19:41 2024 >> started Sat Dec 7 09:20:03 2024 >> done (21.615s) 25922555 reads processed; of these: 442750 ( 1.71%) short reads filtered out after trimming by size control 200865 ( 0.77%) empty reads filtered out after trimming by size control 25278940 (97.52%) reads available; of these: 2426024 ( 9.60%) trimmed reads available after processing 22852916 (90.40%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 51043 0.20% 19 98488 0.39% 20 217921 0.86% 21 45346 0.18% 22 58125 0.23% 23 87312 0.35% 24 150376 0.59% 25 273442 1.08% 26 58020 0.23% 27 78199 0.31% 28 115416 0.46% 29 200350 0.79% 30 407146 1.61% 31 74512 0.29% 32 99640 0.39% 33 144844 0.57% 34 265844 1.05% 35 22852916 90.40% 25278940 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=7 prefix-density=0.04 prefix-fanout=2.7 sequence=GCTGACTACAACATCCAGAAGGAGTCCACCCTCCACCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=10 fanout-score=7.83 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.9 sequence=CTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGGAAGCCGGGTTACGGTGCCCAACTGCGCGCTAACCTAGAACCCACAAAGGGTGTTGGTCGATTAAGACAGCAGGACGGTGGTCATGGAAGTCGAAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCCGAAAATGGATGGCGCTAAAGCGCGCGACCCACACCCGGCCATCTGGGCGAGCGCCATGCCCCGATGAGTAGGAGGGCGCGG Started job on | Dec 07 09:20:15 Started mapping on | Dec 07 09:20:15 Finished on | Dec 07 09:20:39 Mapping speed, Million of reads per hour | 3791.84 Number of input reads | 25278940 Average input read length | 34 UNIQUE READS: Uniquely mapped reads number | 21357930 Uniquely mapped reads % | 84.49% Average mapped length | 34.16 Number of splices: Total | 1898604 Number of splices: Annotated (sjdb) | 1858375 Number of splices: GT/AG | 1876117 Number of splices: GC/AG | 20182 Number of splices: AT/AC | 1105 Number of splices: Non-canonical | 1200 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.00% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1387751 % of reads mapped to multiple loci | 5.49% Number of reads mapped to too many loci | 2111041 % of reads mapped to too many loci | 8.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.52% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2533259 2533259 2533259 N_multimapping 1387751 1387751 1387751 N_noFeature 602788 11226873 10196435 N_ambiguous 569764 14324 19518 UnstrandedReadsAssigned:20185378 PositiveStrandReadsAssigned:10116733 NegativeStrandReadsAssigned:11141977 Dataset is classified unstranded MeadianReadLen=35 20thPercentileLength=35 echo kmer=31 SRR352139 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR352139-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,278,940 reads, 19,111,114 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52973 SRR352139.ke.tsv 35125 SRR352139.se.tsv 88098 total ==> SRR352139.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 137.909 13.7732 PNS24247 1044 945 6.02893 0.533303 PNS24249 1928 1829 120.066 5.48745 PNS24246 1044 945 6.02893 0.533303 PNS24248 1044 945 6.02893 0.533303 PNS24244 1471 1372 55.9381 3.40815 PNS24243 293 194 0 0 KQK14069 1603 1504 1030.59 57.2804 KQK14071 474 375 57.173 12.7446 ==> SRR352139.se.tsv <== BRADI_1g14170v3 1312 BRADI_1g53295v3 51 BRADI_1g59795v3 72 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 1640 BRADI_1g74790v3 35 BRADI_1g09890v3 20 BRADI_1g77505v3 344 BRADI_1g48960v3 4 SRR352139 completed mapping pipeline successfully