Starting /dee2/code/volunteer_pipeline.sh SRR352140 current disk space = 1544237006848 free memory = 1598124412 SRR352140 SRAfilesize f55381e0709b76a6c42c7256233380b7 SRR352140.sra SRR352140.sra file validated SRR352140 is single end SRR352140 is conventional basespace SRR352140 read1 length is 35 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR352140_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3075 34.0 33.0 34.0 29.0 34.0 2 31.92225 34.0 32.0 34.0 27.0 34.0 3 31.96875 34.0 32.0 34.0 27.0 34.0 4 31.9065 34.0 32.0 34.0 27.0 34.0 5 31.9355 34.0 32.0 34.0 27.0 34.0 6 32.05575 34.0 32.0 34.0 28.0 34.0 7 32.18775 34.0 33.0 34.0 29.0 34.0 8 32.09 34.0 33.0 34.0 29.0 34.0 9 31.9895 34.0 32.0 34.0 29.0 34.0 10 31.81325 34.0 32.0 34.0 28.0 34.0 11 31.71075 34.0 32.0 34.0 27.0 34.0 12 31.734 34.0 32.0 34.0 28.0 34.0 13 31.53275 34.0 32.0 34.0 27.0 34.0 14 31.45775 34.0 32.0 34.0 27.0 34.0 15 31.2265 34.0 31.0 34.0 26.0 34.0 16 30.72475 34.0 31.0 34.0 24.0 34.0 17 30.61625 34.0 31.0 34.0 24.0 34.0 18 30.5205 34.0 31.0 34.0 24.0 34.0 19 30.1395 34.0 31.0 34.0 22.0 34.0 20 29.9705 34.0 30.0 34.0 22.0 34.0 21 29.301 33.0 30.0 34.0 17.0 34.0 22 28.98 33.0 30.0 34.0 15.0 34.0 23 28.69725 33.0 29.0 34.0 12.0 34.0 24 28.301 33.0 29.0 34.0 2.0 34.0 25 27.88525 33.0 28.0 34.0 2.0 34.0 26 27.21425 33.0 27.0 34.0 2.0 34.0 27 27.05225 32.0 27.0 34.0 2.0 34.0 28 26.54675 32.0 25.0 34.0 2.0 34.0 29 26.4295 32.0 25.0 34.0 2.0 34.0 30 26.0775 32.0 25.0 34.0 2.0 34.0 31 25.04575 32.0 21.0 34.0 2.0 34.0 32 24.68675 32.0 20.0 34.0 2.0 34.0 33 24.4005 31.0 18.0 34.0 2.0 34.0 34 24.138 31.0 16.0 34.0 2.0 34.0 35 23.63375 31.0 2.0 34.0 2.0 34.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 0.0 4 3.0 5 4.0 6 4.0 7 7.0 8 7.0 9 12.0 10 20.0 11 4.0 12 16.0 13 27.0 14 32.0 15 34.0 16 39.0 17 52.0 18 60.0 19 52.0 20 42.0 21 59.0 22 64.0 23 60.0 24 77.0 25 109.0 26 109.0 27 127.0 28 154.0 29 163.0 30 239.0 31 326.0 32 583.0 33 1357.0 34 128.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.724999999999998 14.75 18.275 43.25 2 27.927927927927925 23.2982982982983 28.953953953953953 19.81981981981982 3 27.175 26.924999999999997 23.599999999999998 22.3 4 27.500000000000004 31.075000000000003 18.575 22.85 5 26.224999999999998 32.800000000000004 20.200000000000003 20.775 6 19.5 38.550000000000004 19.900000000000002 22.05 7 18.975 16.025 41.975 23.025000000000002 8 22.025 22.75 25.275 29.95 9 21.349999999999998 22.375 29.925 26.35 10 22.85 36.125 20.775 20.25 11 25.75 26.075 18.475 29.7 12 23.45 22.525000000000002 26.474999999999998 27.55 13 21.45 27.250000000000004 28.299999999999997 23.0 14 22.225 27.05 26.3 24.425 15 23.71185592796398 24.862431215607803 25.812906453226613 25.6128064032016 16 22.7 27.175 25.724999999999998 24.4 17 24.925 26.625 23.7 24.75 18 23.275000000000002 27.450000000000003 24.625 24.65 19 23.5 26.424999999999997 25.174999999999997 24.9 20 23.7 26.05 25.224999999999998 25.025 21 23.974999999999998 26.05 25.650000000000002 24.325 22 23.7 27.0 24.325 24.975 23 25.4 25.275 24.375 24.95 24 24.349999999999998 26.674999999999997 25.224999999999998 23.75 25 25.174999999999997 25.6 24.85 24.375 26 24.95 25.8 23.849999999999998 25.4 27 23.95 25.674999999999997 25.95 24.425 28 25.575 25.775 23.674999999999997 24.975 29 23.625 26.05 24.55 25.775 30 24.45 24.725 25.224999999999998 25.6 31 24.474999999999998 24.725 24.099999999999998 26.700000000000003 32 24.9 25.55 24.224999999999998 25.324999999999996 33 23.425 25.6 26.1 24.875 34 25.224999999999998 25.5 24.325 24.95 35 25.4 25.624999999999996 23.724999999999998 25.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 1.0 18 1.0 19 3.5 20 6.0 21 14.0 22 22.0 23 22.0 24 32.5 25 43.0 26 43.0 27 48.0 28 53.0 29 53.0 30 80.0 31 107.0 32 107.0 33 152.0 34 197.0 35 197.0 36 222.0 37 247.0 38 247.0 39 296.5 40 346.0 41 365.5 42 385.0 43 385.0 44 406.5 45 428.0 46 428.0 47 426.0 48 424.0 49 424.0 50 381.5 51 339.0 52 339.0 53 348.0 54 357.0 55 357.0 56 316.0 57 275.0 58 275.0 59 241.5 60 208.0 61 179.0 62 150.0 63 150.0 64 139.5 65 129.0 66 129.0 67 111.0 68 93.0 69 93.0 70 79.0 71 65.0 72 65.0 73 61.0 74 57.0 75 57.0 76 44.0 77 31.0 78 31.0 79 24.0 80 17.0 81 11.0 82 5.0 83 5.0 84 5.0 85 5.0 86 5.0 87 4.0 88 3.0 89 3.0 90 3.5 91 4.0 92 4.0 93 2.5 94 1.0 95 1.0 96 0.5 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.05 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 35 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1302992 spots for SRR352140.sra Written 1302992 spots for SRR352140.sra Read 1302992 spots for SRR352140.sra Written 1302992 spots for SRR352140.sra Read 1302992 spots for SRR352140.sra Written 1302992 spots for SRR352140.sra Read 1302992 spots for SRR352140.sra Written 1302992 spots for SRR352140.sra Read 1302992 spots for SRR352140.sra Written 1302992 spots for SRR352140.sra Read 1302992 spots for SRR352140.sra Written 1302992 spots for SRR352140.sra Read 1302992 spots for SRR352140.sra Written 1302992 spots for SRR352140.sra Read 1302992 spots for SRR352140.sra Written 1302992 spots for SRR352140.sra Read 1302992 spots for SRR352140.sra Written 1302992 spots for SRR352140.sra Read 1302992 spots for SRR352140.sra Read 1302992 spots for SRR352140.sra Written 1302992 spots for SRR352140.sra Read 1302992 spots for SRR352140.sra Written 1302992 spots for SRR352140.sra Written 1302992 spots for SRR352140.sra Read 1302992 spots for SRR352140.sra Written 1302992 spots for SRR352140.sra Read 1302992 spots for SRR352140.sra Written 1302992 spots for SRR352140.sra Read 1302992 spots for SRR352140.sra Written 1302992 spots for SRR352140.sra Read 1302992 spots for SRR352140.sra Written 1302992 spots for SRR352140.sra Read 1302992 spots for SRR352140.sra Written 1302992 spots for SRR352140.sra Read 1302992 spots for SRR352140.sra Written 1302992 spots for SRR352140.sra Read 1302992 spots for SRR352140.sra Written 1302992 spots for SRR352140.sra Read 1302992 spots for SRR352140.sra Written 1302992 spots for SRR352140.sra SRR ids: ['SRR352140.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_koqatg0_ SRR352140.sra spots: 26059840 blocks: [[1, 1302992], [1302993, 2605984], [2605985, 3908976], [3908977, 5211968], [5211969, 6514960], [6514961, 7817952], [7817953, 9120944], [9120945, 10423936], [10423937, 11726928], [11726929, 13029920], [13029921, 14332912], [14332913, 15635904], [15635905, 16938896], [16938897, 18241888], [18241889, 19544880], [19544881, 20847872], [20847873, 22150864], [22150865, 23453856], [23453857, 24756848], [24756849, 26059840]] SRR352140 file size 3455153 SRR352140 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR352140 SRR352140_1.fastq Input file: SRR352140_1.fastq trimmed: SRR352140-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:19:03 2024 >> started Sat Dec 7 09:19:20 2024 >> done (17.213s) 26059840 reads processed; of these: 399976 ( 1.53%) short reads filtered out after trimming by size control 174647 ( 0.67%) empty reads filtered out after trimming by size control 25485217 (97.79%) reads available; of these: 2204850 ( 8.65%) trimmed reads available after processing 23280367 (91.35%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 48679 0.19% 19 95226 0.37% 20 203459 0.80% 21 45358 0.18% 22 58643 0.23% 23 86310 0.34% 24 148285 0.58% 25 257493 1.01% 26 60378 0.24% 27 75632 0.30% 28 111615 0.44% 29 188587 0.74% 30 313676 1.23% 31 72938 0.29% 32 91470 0.36% 33 127648 0.50% 34 219453 0.86% 35 23280367 91.35% 25485217 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=8.58 fanout-score-rank=3 prefix-density=0.11 prefix-fanout=4.0 sequence=GAGAAGAAAGCCGAAGTCAAAGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=4 fanout-score=15.30 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.0 sequence=GAGAAGAAAGCTGAAGT Started job on | Dec 07 09:19:31 Started mapping on | Dec 07 09:19:31 Finished on | Dec 07 09:19:55 Mapping speed, Million of reads per hour | 3822.78 Number of input reads | 25485217 Average input read length | 34 UNIQUE READS: Uniquely mapped reads number | 22165281 Uniquely mapped reads % | 86.97% Average mapped length | 34.23 Number of splices: Total | 1967980 Number of splices: Annotated (sjdb) | 1910015 Number of splices: GT/AG | 1932556 Number of splices: GC/AG | 32829 Number of splices: AT/AC | 1497 Number of splices: Non-canonical | 1098 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.34 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 861378 % of reads mapped to multiple loci | 3.38% Number of reads mapped to too many loci | 1794833 % of reads mapped to too many loci | 7.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.55% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2458558 2458558 2458558 N_multimapping 861378 861378 861378 N_noFeature 1235745 11947194 10977803 N_ambiguous 498408 11359 12386 UnstrandedReadsAssigned:20431128 PositiveStrandReadsAssigned:10206728 NegativeStrandReadsAssigned:11175092 Dataset is classified unstranded MeadianReadLen=35 20thPercentileLength=35 echo kmer=31 SRR352140 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR352140-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,485,217 reads, 19,641,568 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52973 SRR352140.ke.tsv 35125 SRR352140.se.tsv 88098 total ==> SRR352140.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.132353 0.0143734 PNS24247 1044 945 19.8654 1.9108 PNS24249 1928 1829 82.3791 4.09405 PNS24246 1044 945 19.8654 1.9108 PNS24248 1044 945 19.8654 1.9108 PNS24244 1471 1372 28.8922 1.91415 PNS24243 293 194 2 0.937082 KQK14069 1603 1504 68.6969 4.15182 KQK14071 474 375 3.87145 0.938407 ==> SRR352140.se.tsv <== BRADI_1g14170v3 93 BRADI_1g53295v3 328 BRADI_1g59795v3 210 BRADI_1g07683v3 2 BRADI_1g00485v3 435 BRADI_1g20270v3 726 BRADI_1g74790v3 79 BRADI_1g09890v3 0 BRADI_1g77505v3 267 BRADI_1g48960v3 5 SRR352140 completed mapping pipeline successfully