Starting /dee2/code/volunteer_pipeline.sh SRR352141 current disk space = 1544233279488 free memory = 1605964228 SRR352141 SRAfilesize 1d420ddfdf61f7d71b509fda64a51bee SRR352141.sra SRR352141.sra file validated SRR352141 is single end SRR352141 is conventional basespace SRR352141 read1 length is 35 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR352141_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.11175 34.0 32.0 34.0 28.0 34.0 2 31.84075 34.0 32.0 34.0 27.0 34.0 3 31.741 34.0 32.0 34.0 27.0 34.0 4 31.60875 34.0 32.0 34.0 26.0 34.0 5 31.69025 34.0 32.0 34.0 27.0 34.0 6 31.77875 34.0 32.0 34.0 27.0 34.0 7 31.7135 34.0 31.0 34.0 27.0 34.0 8 31.52975 34.0 31.0 34.0 26.0 34.0 9 31.39575 34.0 31.0 34.0 26.0 34.0 10 31.364 34.0 31.0 34.0 26.0 34.0 11 31.18575 34.0 31.0 34.0 25.0 34.0 12 31.204 34.0 31.0 34.0 25.0 34.0 13 31.2555 34.0 31.0 34.0 26.0 34.0 14 31.0605 34.0 31.0 34.0 25.0 34.0 15 31.10225 34.0 31.0 34.0 25.0 34.0 16 30.75 34.0 31.0 34.0 24.0 34.0 17 30.56275 33.0 30.0 34.0 24.0 34.0 18 30.385 33.0 30.0 34.0 23.0 34.0 19 30.28425 33.0 30.0 34.0 23.0 34.0 20 30.12925 33.0 30.0 34.0 23.0 34.0 21 30.06225 33.0 30.0 34.0 22.0 34.0 22 29.92325 33.0 30.0 34.0 22.0 34.0 23 29.85275 33.0 30.0 34.0 22.0 34.0 24 29.65775 33.0 30.0 34.0 21.0 34.0 25 29.52675 33.0 30.0 34.0 20.0 34.0 26 29.14475 33.0 30.0 34.0 17.0 34.0 27 29.05225 33.0 29.0 34.0 16.0 34.0 28 28.76675 33.0 29.0 34.0 14.0 34.0 29 28.73225 33.0 29.0 34.0 14.0 34.0 30 28.57075 33.0 29.0 34.0 8.0 34.0 31 28.08425 33.0 29.0 34.0 2.0 34.0 32 27.67425 32.0 28.0 34.0 2.0 34.0 33 27.60925 33.0 28.0 34.0 2.0 34.0 34 27.255 32.0 27.0 34.0 2.0 34.0 35 26.988 32.0 27.0 34.0 2.0 34.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 1.0 4 0.0 5 2.0 6 4.0 7 2.0 8 6.0 9 12.0 10 10.0 11 7.0 12 15.0 13 22.0 14 22.0 15 20.0 16 34.0 17 22.0 18 29.0 19 33.0 20 32.0 21 48.0 22 35.0 23 56.0 24 66.0 25 80.0 26 99.0 27 117.0 28 152.0 29 205.0 30 265.0 31 367.0 32 567.0 33 1491.0 34 149.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.60690172543136 14.778694673668417 16.90422605651413 40.71017754438609 2 29.075 21.575 27.650000000000002 21.7 3 28.925 24.175 21.9 25.0 4 26.150000000000002 30.55 19.7 23.599999999999998 5 28.375 31.55 19.425 20.65 6 21.6 35.075 20.3 23.025000000000002 7 19.925 17.1 39.925 23.05 8 22.025 22.15 24.825 31.0 9 21.475 21.825 27.825 28.875 10 23.05 35.099999999999994 22.15 19.7 11 29.475 22.900000000000002 18.275 29.349999999999998 12 23.799999999999997 20.974999999999998 26.0 29.225 13 23.65 24.825 27.325 24.2 14 23.275000000000002 26.625 24.5 25.6 15 24.55 25.825 24.474999999999998 25.15 16 23.474999999999998 25.3 24.625 26.6 17 26.625 24.625 23.75 25.0 18 23.775 27.075 23.525 25.624999999999996 19 23.724999999999998 26.575 24.3 25.4 20 25.3 24.7 23.5 26.5 21 24.0 25.5 24.625 25.874999999999996 22 25.0 25.474999999999998 24.975 24.55 23 25.124999999999996 25.2 23.724999999999998 25.95 24 25.45 25.95 22.825 25.775 25 25.15 26.150000000000002 23.150000000000002 25.55 26 26.85 24.95 22.15 26.05 27 25.825 26.125 21.475 26.575 28 26.25 25.124999999999996 22.325 26.3 29 26.400000000000002 25.924999999999997 23.35 24.325 30 25.374999999999996 26.674999999999997 23.35 24.6 31 25.75 26.174999999999997 23.425 24.65 32 26.05 26.25 22.85 24.85 33 24.6 26.25 23.35 25.8 34 25.6064016004001 25.531382845711427 23.48087021755439 25.381345336334082 35 26.525 24.349999999999998 22.75 26.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 1.5 11 2.0 12 2.0 13 2.5 14 3.0 15 3.0 16 3.0 17 3.0 18 3.0 19 3.0 20 3.0 21 6.5 22 10.0 23 10.0 24 15.5 25 21.0 26 21.0 27 31.5 28 42.0 29 42.0 30 68.0 31 94.0 32 94.0 33 122.5 34 151.0 35 151.0 36 180.5 37 210.0 38 210.0 39 241.5 40 273.0 41 320.0 42 367.0 43 367.0 44 392.0 45 417.0 46 417.0 47 409.0 48 401.0 49 401.0 50 400.0 51 399.0 52 399.0 53 374.5 54 350.0 55 350.0 56 323.5 57 297.0 58 297.0 59 268.0 60 239.0 61 205.0 62 171.0 63 171.0 64 162.5 65 154.0 66 154.0 67 132.0 68 110.0 69 110.0 70 106.5 71 103.0 72 103.0 73 87.5 74 72.0 75 72.0 76 58.5 77 45.0 78 45.0 79 40.0 80 35.0 81 25.0 82 15.0 83 15.0 84 11.5 85 8.0 86 8.0 87 4.5 88 1.0 89 1.0 90 1.0 91 1.0 92 1.0 93 1.0 94 1.0 95 1.0 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.025 35 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 35 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01415571284126 97.925 2 0.8847320525783621 1.7500000000000002 3 0.07583417593528817 0.22499999999999998 4 0.02527805864509606 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1288325 spots for SRR352141.sra Written 1288325 spots for SRR352141.sra Read 1288325 spots for SRR352141.sra Written 1288325 spots for SRR352141.sra Read 1288325 spots for SRR352141.sra Written 1288325 spots for SRR352141.sra Read 1288325 spots for SRR352141.sra Written 1288325 spots for SRR352141.sra Read 1288325 spots for SRR352141.sra Written 1288325 spots for SRR352141.sra Read 1288325 spots for SRR352141.sra Written 1288325 spots for SRR352141.sra Read 1288325 spots for SRR352141.sra Written 1288325 spots for SRR352141.sra Read 1288325 spots for SRR352141.sra Written 1288325 spots for SRR352141.sra Read 1288325 spots for SRR352141.sra Written 1288325 spots for SRR352141.sra Read 1288325 spots for SRR352141.sra Written 1288325 spots for SRR352141.sra Read 1288325 spots for SRR352141.sra Written 1288325 spots for SRR352141.sra Read 1288325 spots for SRR352141.sra Written 1288325 spots for SRR352141.sra Read 1288325 spots for SRR352141.sra Written 1288325 spots for SRR352141.sra Read 1288325 spots for SRR352141.sra Read 1288342 spots for SRR352141.sra Written 1288342 spots for SRR352141.sra Read 1288325 spots for SRR352141.sra Written 1288325 spots for SRR352141.sra Written 1288325 spots for SRR352141.sra Read 1288325 spots for SRR352141.sra Written 1288325 spots for SRR352141.sra Read 1288325 spots for SRR352141.sra Written 1288325 spots for SRR352141.sra Read 1288325 spots for SRR352141.sra Written 1288325 spots for SRR352141.sra Read 1288325 spots for SRR352141.sra Written 1288325 spots for SRR352141.sra SRR ids: ['SRR352141.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oigrpgwk SRR352141.sra spots: 25766517 blocks: [[1, 1288325], [1288326, 2576650], [2576651, 3864975], [3864976, 5153300], [5153301, 6441625], [6441626, 7729950], [7729951, 9018275], [9018276, 10306600], [10306601, 11594925], [11594926, 12883250], [12883251, 14171575], [14171576, 15459900], [15459901, 16748225], [16748226, 18036550], [18036551, 19324875], [19324876, 20613200], [20613201, 21901525], [21901526, 23189850], [23189851, 24478175], [24478176, 25766517]] SRR352141 file size 3491748 SRR352141 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR352141 SRR352141_1.fastq Input file: SRR352141_1.fastq trimmed: SRR352141-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:23:26 2024 >> started Sat Dec 7 09:23:40 2024 >> done (14.239s) 25766517 reads processed; of these: 150374 ( 0.58%) short reads filtered out after trimming by size control 108756 ( 0.42%) empty reads filtered out after trimming by size control 25507387 (98.99%) reads available; of these: 707487 ( 2.77%) trimmed reads available after processing 24799900 (97.23%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 13572 0.05% 19 26342 0.10% 20 58487 0.23% 21 11359 0.04% 22 15053 0.06% 23 25192 0.10% 24 46119 0.18% 25 94234 0.37% 26 17617 0.07% 27 21888 0.09% 28 35418 0.14% 29 61435 0.24% 30 111191 0.44% 31 22491 0.09% 32 28404 0.11% 33 43026 0.17% 34 75659 0.30% 35 24799900 97.23% 25507387 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=14 prefix-density=0.06 prefix-fanout=2.0 sequence=GACATGGCGAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=20 fanout-score=56.98 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=1.0 sequence=CTCGCACACTCTCTCACCAAGACAGAGGAAGCAGAGCATAGTAAAATCCAAGTAGCAGTCGACATGGCGAG Started job on | Dec 07 09:23:55 Started mapping on | Dec 07 09:23:55 Finished on | Dec 07 09:24:31 Mapping speed, Million of reads per hour | 2550.74 Number of input reads | 25507387 Average input read length | 34 UNIQUE READS: Uniquely mapped reads number | 19348522 Uniquely mapped reads % | 75.85% Average mapped length | 34.65 Number of splices: Total | 1534560 Number of splices: Annotated (sjdb) | 1488109 Number of splices: GT/AG | 1515075 Number of splices: GC/AG | 16198 Number of splices: AT/AC | 798 Number of splices: Non-canonical | 2489 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.28 Insertion rate per base | 0.00% Insertion average length | 1.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2074291 % of reads mapped to multiple loci | 8.13% Number of reads mapped to too many loci | 1747100 % of reads mapped to too many loci | 6.85% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.09% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4084574 4084574 4084574 N_multimapping 2074291 2074291 2074291 N_noFeature 449629 10026273 9394220 N_ambiguous 408500 15497 16277 UnstrandedReadsAssigned:18490393 PositiveStrandReadsAssigned:9306752 NegativeStrandReadsAssigned:9938025 Dataset is classified unstranded MeadianReadLen=35 20thPercentileLength=35 echo kmer=31 SRR352141 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR352141-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,507,387 reads, 19,702,954 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,328 rounds 52973 SRR352141.ke.tsv 35125 SRR352141.se.tsv 88098 total ==> SRR352141.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 144.813 11.5236 PNS24247 1044 945 0 0 PNS24249 1928 1829 328.187 11.9513 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 0 0 PNS24243 293 194 0 0 KQK14069 1603 1504 1294.97 57.3483 KQK14071 474 375 212.919 37.8174 ==> SRR352141.se.tsv <== BRADI_1g14170v3 1544 BRADI_1g53295v3 25 BRADI_1g59795v3 41 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 1666 BRADI_1g74790v3 111 BRADI_1g09890v3 47 BRADI_1g77505v3 604 BRADI_1g48960v3 0 SRR352141 completed mapping pipeline successfully