Starting /dee2/code/volunteer_pipeline.sh SRR352142 current disk space = 1544241635328 free memory = 1602567124 SRR352142 SRAfilesize a817317a3e683685a6c8a9fcd94efe87 SRR352142.sra SRR352142.sra file validated SRR352142 is single end SRR352142 is conventional basespace SRR352142 read1 length is 35 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR352142_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.33025 34.0 33.0 34.0 29.0 34.0 2 31.941 34.0 33.0 34.0 28.0 34.0 3 32.0235 34.0 33.0 34.0 28.0 34.0 4 31.9175 34.0 33.0 34.0 28.0 34.0 5 31.97475 34.0 33.0 34.0 28.0 34.0 6 31.985 34.0 33.0 34.0 28.0 34.0 7 31.96675 34.0 33.0 34.0 28.0 34.0 8 31.9045 34.0 33.0 34.0 27.0 34.0 9 31.891 34.0 32.0 34.0 28.0 34.0 10 31.75575 34.0 32.0 34.0 27.0 34.0 11 31.78825 34.0 32.0 34.0 28.0 34.0 12 31.692 34.0 32.0 34.0 28.0 34.0 13 31.53275 34.0 32.0 34.0 27.0 34.0 14 31.45325 34.0 32.0 34.0 27.0 34.0 15 31.36 34.0 32.0 34.0 27.0 34.0 16 30.9255 34.0 31.0 34.0 25.0 34.0 17 30.969 34.0 31.0 34.0 25.0 34.0 18 30.61775 34.0 31.0 34.0 24.0 34.0 19 30.708 34.0 31.0 34.0 24.0 34.0 20 30.64125 34.0 31.0 34.0 24.0 34.0 21 30.352 34.0 31.0 34.0 23.0 34.0 22 30.18025 34.0 31.0 34.0 23.0 34.0 23 29.883 33.0 30.0 34.0 22.0 34.0 24 29.65925 33.0 30.0 34.0 20.0 34.0 25 29.5365 33.0 30.0 34.0 20.0 34.0 26 28.9965 33.0 30.0 34.0 15.0 34.0 27 28.703 33.0 29.0 34.0 11.0 34.0 28 28.6615 33.0 29.0 34.0 11.0 34.0 29 28.42775 33.0 29.0 34.0 2.0 34.0 30 28.06925 33.0 28.0 34.0 2.0 34.0 31 27.5735 33.0 28.0 34.0 2.0 34.0 32 27.5415 33.0 28.0 34.0 2.0 34.0 33 27.3145 33.0 27.0 34.0 2.0 34.0 34 26.96425 33.0 27.0 34.0 2.0 34.0 35 26.55875 32.0 26.0 34.0 2.0 34.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 40.0 3 0.0 4 2.0 5 5.0 6 6.0 7 6.0 8 4.0 9 15.0 10 6.0 11 5.0 12 13.0 13 19.0 14 15.0 15 24.0 16 23.0 17 20.0 18 29.0 19 43.0 20 39.0 21 31.0 22 48.0 23 53.0 24 60.0 25 62.0 26 94.0 27 103.0 28 140.0 29 189.0 30 224.0 31 328.0 32 552.0 33 1603.0 34 199.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.82193839218633 13.749060856498874 19.183571249686953 40.24542950162785 2 27.200000000000003 23.575 29.65 19.575 3 27.55 26.174999999999997 22.900000000000002 23.375 4 27.325 32.4 17.299999999999997 22.975 5 27.025 34.300000000000004 19.3 19.375 6 19.85 37.675 19.900000000000002 22.575 7 17.05 15.174999999999999 41.699999999999996 26.075 8 22.8 22.400000000000002 23.674999999999997 31.125000000000004 9 21.55 19.875 28.275 30.3 10 22.675 37.974999999999994 20.674999999999997 18.675 11 26.400000000000002 24.9 19.275000000000002 29.425 12 22.25 22.8 25.650000000000002 29.299999999999997 13 21.525 25.624999999999996 28.125 24.725 14 23.65 26.0 26.325 24.025 15 23.99598393574297 25.903614457831324 25.426706827309236 24.673694779116463 16 22.7 27.200000000000003 25.25 24.85 17 23.849999999999998 26.174999999999997 24.224999999999998 25.75 18 24.975 26.75 23.425 24.85 19 24.224999999999998 24.45 24.975 26.35 20 25.650000000000002 25.874999999999996 25.124999999999996 23.35 21 25.650000000000002 25.45 23.674999999999997 25.224999999999998 22 23.275000000000002 26.1 25.3 25.324999999999996 23 23.474999999999998 25.624999999999996 25.25 25.650000000000002 24 25.124999999999996 26.075 24.45 24.349999999999998 25 25.15 25.0 24.875 24.975 26 25.2 25.2 24.025 25.575 27 26.200000000000003 25.15 23.775 24.875 28 23.875 24.875 24.55 26.700000000000003 29 26.05 23.95 24.224999999999998 25.775 30 24.65 24.8 24.7 25.85 31 24.95 25.374999999999996 23.724999999999998 25.95 32 25.7 24.375 25.7 24.224999999999998 33 25.05 24.75 23.575 26.625 34 24.45 25.624999999999996 25.324999999999996 24.6 35 24.675 25.1 26.0 24.224999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 2.0 14 4.0 15 4.0 16 3.0 17 2.0 18 2.0 19 4.0 20 6.0 21 6.0 22 6.0 23 6.0 24 21.5 25 37.0 26 37.0 27 44.0 28 51.0 29 51.0 30 69.0 31 87.0 32 87.0 33 124.5 34 162.0 35 162.0 36 190.0 37 218.0 38 218.0 39 263.0 40 308.0 41 355.5 42 403.0 43 403.0 44 410.5 45 418.0 46 418.0 47 421.0 48 424.0 49 424.0 50 421.5 51 419.0 52 419.0 53 377.5 54 336.0 55 336.0 56 314.5 57 293.0 58 293.0 59 256.0 60 219.0 61 194.0 62 169.0 63 169.0 64 156.5 65 144.0 66 144.0 67 124.5 68 105.0 69 105.0 70 96.0 71 87.0 72 87.0 73 67.0 74 47.0 75 47.0 76 37.5 77 28.0 78 28.0 79 20.0 80 12.0 81 7.5 82 3.0 83 3.0 84 3.5 85 4.0 86 4.0 87 3.0 88 2.0 89 2.0 90 1.0 91 0.0 92 0.0 93 1.0 94 2.0 95 2.0 96 1.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.4 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 35 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.175 #Duplication Level Percentage of deduplicated Percentage of total 1 97.9933110367893 95.22500000000001 2 1.4921533316182145 2.9000000000000004 3 0.2315410342166195 0.675 4 0.20581425263699513 0.8 5 0.05145356315924878 0.25 6 0.02572678157962439 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCCCGAGGAAAAGAAATCAACCGAGATTCCCCCA 6 0.15 No Hit CGAAGATGAATCCACGTCTCCGATCGGGTAACTCT 5 0.125 No Hit GGAAATTCGGAGTCAACACACCAATCTCTTCTCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1368275 spots for SRR352142.sra Written 1368275 spots for SRR352142.sra Read 1368275 spots for SRR352142.sra Written 1368275 spots for SRR352142.sra Read 1368275 spots for SRR352142.sra Written 1368275 spots for SRR352142.sra Read 1368275 spots for SRR352142.sra Written 1368275 spots for SRR352142.sra Read 1368275 spots for SRR352142.sra Written 1368275 spots for SRR352142.sra Read 1368275 spots for SRR352142.sra Written 1368275 spots for SRR352142.sra Read 1368275 spots for SRR352142.sra Written 1368275 spots for SRR352142.sra Read 1368275 spots for SRR352142.sra Written 1368275 spots for SRR352142.sra Read 1368275 spots for SRR352142.sra Written 1368275 spots for SRR352142.sra Read 1368275 spots for SRR352142.sra Written 1368275 spots for SRR352142.sra Read 1368275 spots for SRR352142.sra Written 1368275 spots for SRR352142.sra Read 1368275 spots for SRR352142.sra Written 1368275 spots for SRR352142.sra Read 1368275 spots for SRR352142.sra Written 1368275 spots for SRR352142.sra Read 1368275 spots for SRR352142.sra Written 1368275 spots for SRR352142.sra Read 1368275 spots for SRR352142.sra Written 1368275 spots for SRR352142.sra Read 1368286 spots for SRR352142.sra Written 1368286 spots for SRR352142.sra Read 1368275 spots for SRR352142.sra Written 1368275 spots for SRR352142.sra Read 1368275 spots for SRR352142.sra Written 1368275 spots for SRR352142.sra Read 1368275 spots for SRR352142.sra Written 1368275 spots for SRR352142.sra Read 1368275 spots for SRR352142.sra Written 1368275 spots for SRR352142.sra SRR ids: ['SRR352142.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pjnysxkx SRR352142.sra spots: 27365511 blocks: [[1, 1368275], [1368276, 2736550], [2736551, 4104825], [4104826, 5473100], [5473101, 6841375], [6841376, 8209650], [8209651, 9577925], [9577926, 10946200], [10946201, 12314475], [12314476, 13682750], [13682751, 15051025], [15051026, 16419300], [16419301, 17787575], [17787576, 19155850], [19155851, 20524125], [20524126, 21892400], [21892401, 23260675], [23260676, 24628950], [24628951, 25997225], [25997226, 27365511]] SRR352142 file size 3628787 SRR352142 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR352142 SRR352142_1.fastq Input file: SRR352142_1.fastq trimmed: SRR352142-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:26:03 2024 >> started Sat Dec 7 09:26:22 2024 >> done (18.545s) 27365511 reads processed; of these: 343234 ( 1.25%) short reads filtered out after trimming by size control 231385 ( 0.85%) empty reads filtered out after trimming by size control 26790892 (97.90%) reads available; of these: 1448579 ( 5.41%) trimmed reads available after processing 25342313 (94.59%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 31832 0.12% 19 61676 0.23% 20 129143 0.48% 21 27130 0.10% 22 35189 0.13% 23 53980 0.20% 24 93690 0.35% 25 169319 0.63% 26 36385 0.14% 27 47597 0.18% 28 71514 0.27% 29 124511 0.46% 30 217758 0.81% 31 46701 0.17% 32 60386 0.23% 33 88311 0.33% 34 153457 0.57% 35 25342313 94.59% 26790892 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=32 prefix-density=0.00 prefix-fanout=1.0 sequence=ACCCCGAGGAAAAGAAATCAACCGAGATTCCCCCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=8.23 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=1.8 sequence=TTTTATTCCAAATCAGTTCCAACAACTATAGTAAGGGCCGGTGTCACACATGAAGAGCCATGACACTTTTATTTGTCACCGCTGCATCGGTCAGTCGATCGACCAAAA Started job on | Dec 07 09:26:33 Started mapping on | Dec 07 09:26:33 Finished on | Dec 07 09:26:55 Mapping speed, Million of reads per hour | 4383.96 Number of input reads | 26790892 Average input read length | 34 UNIQUE READS: Uniquely mapped reads number | 20921764 Uniquely mapped reads % | 78.09% Average mapped length | 34.41 Number of splices: Total | 1558719 Number of splices: Annotated (sjdb) | 1507109 Number of splices: GT/AG | 1539063 Number of splices: GC/AG | 16049 Number of splices: AT/AC | 668 Number of splices: Non-canonical | 2939 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.27 Insertion rate per base | 0.00% Insertion average length | 1.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 4445438 % of reads mapped to multiple loci | 16.59% Number of reads mapped to too many loci | 578993 % of reads mapped to too many loci | 2.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.13% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1423690 1423690 1423690 N_multimapping 4445438 4445438 4445438 N_noFeature 628083 10514501 10727752 N_ambiguous 331084 12721 11977 UnstrandedReadsAssigned:19962597 PositiveStrandReadsAssigned:10394542 NegativeStrandReadsAssigned:10182035 Dataset is classified unstranded MeadianReadLen=35 20thPercentileLength=35 echo kmer=31 SRR352142 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR352142-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,790,892 reads, 22,585,899 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52973 SRR352142.ke.tsv 35125 SRR352142.se.tsv 88098 total ==> SRR352142.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 46.3646 3.14094 PNS24247 1044 945 4.05205 0.243132 PNS24249 1928 1829 51.132 1.58518 PNS24246 1044 945 4.05205 0.243132 PNS24248 1044 945 4.05205 0.243132 PNS24244 1471 1372 125.347 5.18035 PNS24243 293 194 1 0.292279 KQK14069 1603 1504 3142.58 118.478 KQK14071 474 375 888.68 134.373 ==> SRR352142.se.tsv <== BRADI_1g14170v3 4375 BRADI_1g53295v3 42 BRADI_1g59795v3 49 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 256 BRADI_1g74790v3 64 BRADI_1g09890v3 6 BRADI_1g77505v3 415 BRADI_1g48960v3 2 SRR352142 completed mapping pipeline successfully