Starting /dee2/code/volunteer_pipeline.sh SRR352143 current disk space = 1544212271104 free memory = 1603331824 SRR352143 SRAfilesize d9da4681db74e303adc9e02719408b17 SRR352143.sra SRR352143.sra file validated SRR352143 is single end SRR352143 is conventional basespace SRR352143 read1 length is 35 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR352143_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35 %GC 55 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.4245 36.0 2.0 39.0 2.0 40.0 2 28.69025 37.0 15.0 39.0 9.0 40.0 3 28.41875 36.0 15.0 39.0 9.0 40.0 4 28.81675 38.0 15.0 39.0 9.0 40.0 5 28.48475 37.0 14.0 39.0 8.0 40.0 6 30.30675 37.0 22.0 39.0 14.0 40.0 7 30.42 38.0 22.0 39.0 14.0 40.0 8 30.35125 38.0 22.0 39.0 14.0 40.0 9 30.20475 37.0 22.0 39.0 14.0 40.0 10 29.804 36.0 21.0 39.0 14.0 40.0 11 33.35475 36.0 31.0 39.0 25.0 40.0 12 33.30325 36.0 31.0 39.0 25.0 40.0 13 33.10925 36.0 31.0 39.0 25.0 40.0 14 33.199 36.0 31.0 39.0 25.0 40.0 15 32.99225 36.0 31.0 39.0 25.0 40.0 16 32.78875 36.0 31.0 39.0 23.0 40.0 17 32.70275 36.0 31.0 39.0 23.0 40.0 18 32.6925 36.0 31.0 39.0 23.0 40.0 19 32.513 35.0 31.0 39.0 23.0 40.0 20 32.33775 35.0 31.0 39.0 22.0 40.0 21 31.65025 35.0 31.0 39.0 17.0 40.0 22 31.40025 35.0 31.0 39.0 17.0 40.0 23 31.48025 35.0 31.0 39.0 17.0 40.0 24 31.445 35.0 31.0 39.0 17.0 40.0 25 31.5775 35.0 31.0 39.0 17.0 40.0 26 30.68825 34.0 31.0 39.0 2.0 40.0 27 30.868 35.0 31.0 39.0 2.0 40.0 28 30.5745 34.0 30.0 38.0 2.0 40.0 29 30.52025 34.0 30.0 38.0 2.0 40.0 30 30.46075 34.0 30.0 38.0 2.0 40.0 31 29.733 33.0 28.0 38.0 2.0 39.0 32 29.25075 33.0 27.0 38.0 2.0 39.0 33 29.4055 33.0 27.0 38.0 2.0 39.0 34 29.20825 33.0 27.0 38.0 2.0 39.0 35 29.005 33.0 27.0 38.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 226.0 3 0.0 4 1.0 5 1.0 6 0.0 7 1.0 8 18.0 9 6.0 10 9.0 11 5.0 12 20.0 13 18.0 14 9.0 15 11.0 16 21.0 17 14.0 18 19.0 19 21.0 20 46.0 21 56.0 22 67.0 23 89.0 24 133.0 25 190.0 26 207.0 27 209.0 28 94.0 29 56.0 30 54.0 31 75.0 32 96.0 33 123.0 34 146.0 35 206.0 36 270.0 37 406.0 38 518.0 39 559.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.32252119424991 8.73571691854036 17.065978621452267 48.87578326575747 2 28.925 17.925 26.674999999999997 26.474999999999998 3 29.299999999999997 22.825 21.6 26.275 4 30.025000000000002 26.575 16.7 26.700000000000003 5 31.225 29.7 17.424999999999997 21.65 6 22.875 32.85 17.375 26.900000000000002 7 22.025 13.475000000000001 36.55 27.950000000000003 8 24.425 20.974999999999998 20.599999999999998 34.0 9 24.05 19.475 27.025 29.45 10 25.55 33.5 17.775 23.175 11 29.575000000000003 18.875 18.475 33.074999999999996 12 26.025 18.6 24.525 30.85 13 26.35 22.3 24.975 26.375 14 27.575 21.2 23.05 28.175 15 25.324999999999996 24.224999999999998 23.325000000000003 27.125 16 26.75 22.125 22.400000000000002 28.725 17 29.525000000000002 21.55 20.275000000000002 28.65 18 25.3 24.375 23.575 26.75 19 27.400000000000002 21.975 21.75 28.875 20 26.35 21.375 22.725 29.549999999999997 21 27.325 22.725 23.025000000000002 26.924999999999997 22 27.325 20.45 22.925 29.299999999999997 23 26.400000000000002 22.45 22.45 28.7 24 25.8 24.125 23.200000000000003 26.875 25 27.575 21.525 20.674999999999997 30.225 26 28.525 23.45 20.599999999999998 27.425 27 26.588294147073537 24.73736868434217 20.635317658829415 28.039019509754876 28 26.21966474856142 21.74130597948461 21.56617463097323 30.472854640980735 29 28.035043804755944 21.97747183979975 22.02753441802253 27.95994993742178 30 26.546456298522415 22.940145254194842 23.240671174555473 27.27272727272727 31 27.197595792637113 23.29075882794891 22.03856749311295 27.473077886301027 32 27.930861723446892 22.52004008016032 21.367735470941884 28.181362725450903 33 25.225450901803608 24.649298597194388 22.26953907815631 27.85571142284569 34 27.473077886301027 21.91334835962935 22.489356373653894 28.12421738041573 35 29.536921151439298 21.752190237797247 19.72465581977472 28.986232790988737 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 2.0 20 3.0 21 3.5 22 4.0 23 4.0 24 11.5 25 19.0 26 19.0 27 30.5 28 42.0 29 42.0 30 53.5 31 65.0 32 65.0 33 81.5 34 98.0 35 98.0 36 124.0 37 150.0 38 150.0 39 188.5 40 227.0 41 239.0 42 251.0 43 251.0 44 285.0 45 319.0 46 319.0 47 317.0 48 315.0 49 315.0 50 325.5 51 336.0 52 336.0 53 326.5 54 317.0 55 317.0 56 297.0 57 277.0 58 277.0 59 288.5 60 300.0 61 304.0 62 308.0 63 308.0 64 287.5 65 267.0 66 267.0 67 234.5 68 202.0 69 202.0 70 185.0 71 168.0 72 168.0 73 145.0 74 122.0 75 122.0 76 106.5 77 91.0 78 91.0 79 73.5 80 56.0 81 45.0 82 34.0 83 34.0 84 25.0 85 16.0 86 16.0 87 11.0 88 6.0 89 6.0 90 4.0 91 2.0 92 2.0 93 2.0 94 2.0 95 2.0 96 1.5 97 1.0 98 1.0 99 1.0 100 1.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 32.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.05 28 0.075 29 0.125 30 0.17500000000000002 31 0.17500000000000002 32 0.2 33 0.2 34 0.17500000000000002 35 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 35 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34093789607098 97.975 2 0.532319391634981 1.05 3 0.025348542458808618 0.075 4 0.050697084917617236 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.050697084917617236 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATTATCAGATCGGAAGAGCGGTTCAGCAGGAATG 16 0.4 Illumina Paired End PCR Primer 2 (100% over 28bp) NATTATCAGATCGGAAGAGCGGTTCAGCAGGAATG 12 0.3 Illumina Paired End PCR Primer 2 (100% over 28bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 1.2 0.0 0.0 0.0 0.0 9 1.2 0.0 0.0 0.0 0.0 10 1.2 0.0 0.0 0.0 0.0 11 1.2 0.0 0.0 0.0 0.0 12 1.2 0.0 0.0 0.0 0.0 13 1.2 0.0 0.0 0.0 0.0 14 1.2 0.0 0.0 0.0 0.0 15 1.2 0.0 0.0 0.0 0.0 16 1.2 0.0 0.0 0.0 0.0 17 1.2 0.0 0.0 0.0 0.0 18 1.2 0.0 0.0 0.0 0.0 19 1.2 0.0 0.0 0.0 0.0 20 1.2 0.0 0.0 0.0 0.0 21 1.2 0.0 0.0 0.0 0.0 22 1.2 0.0 0.0 0.0 0.0 23 1.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1627260 spots for SRR352143.sra Written 1627260 spots for SRR352143.sra Read 1627260 spots for SRR352143.sra Written 1627260 spots for SRR352143.sra Read 1627260 spots for SRR352143.sra Written 1627260 spots for SRR352143.sra Read 1627260 spots for SRR352143.sra Written 1627260 spots for SRR352143.sra Read 1627260 spots for SRR352143.sra Written 1627260 spots for SRR352143.sra Read 1627260 spots for SRR352143.sra Written 1627260 spots for SRR352143.sra Read 1627260 spots for SRR352143.sra Written 1627260 spots for SRR352143.sra Read 1627261 spots for SRR352143.sra Written 1627261 spots for SRR352143.sra Read 1627260 spots for SRR352143.sra Written 1627260 spots for SRR352143.sra Read 1627260 spots for SRR352143.sra Written 1627260 spots for SRR352143.sra Read 1627260 spots for SRR352143.sra Written 1627260 spots for SRR352143.sra Read 1627260 spots for SRR352143.sra Written 1627260 spots for SRR352143.sra Read 1627260 spots for SRR352143.sra Written 1627260 spots for SRR352143.sra Read 1627260 spots for SRR352143.sra Written 1627260 spots for SRR352143.sra Read 1627260 spots for SRR352143.sra Written 1627260 spots for SRR352143.sra Read 1627260 spots for SRR352143.sra Written 1627260 spots for SRR352143.sra Read 1627260 spots for SRR352143.sra Written 1627260 spots for SRR352143.sra Read 1627260 spots for SRR352143.sra Written 1627260 spots for SRR352143.sra Read 1627260 spots for SRR352143.sra Written 1627260 spots for SRR352143.sra Read 1627260 spots for SRR352143.sra Written 1627260 spots for SRR352143.sra SRR ids: ['SRR352143.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a5fkp95p SRR352143.sra spots: 32545201 blocks: [[1, 1627260], [1627261, 3254520], [3254521, 4881780], [4881781, 6509040], [6509041, 8136300], [8136301, 9763560], [9763561, 11390820], [11390821, 13018080], [13018081, 14645340], [14645341, 16272600], [16272601, 17899860], [17899861, 19527120], [19527121, 21154380], [21154381, 22781640], [22781641, 24408900], [24408901, 26036160], [26036161, 27663420], [27663421, 29290680], [29290681, 30917940], [30917941, 32545201]] SRR352143 file size 4316825 SRR352143 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR352143 SRR352143_1.fastq Input file: SRR352143_1.fastq trimmed: SRR352143-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:28:06 2024 >> started Sat Dec 7 09:28:23 2024 >> done (16.950s) 32545201 reads processed; of these: 63986 ( 0.20%) short reads filtered out after trimming by size control 48574 ( 0.15%) empty reads filtered out after trimming by size control 32432641 (99.65%) reads available; of these: 1017006 ( 3.14%) trimmed reads available after processing 31415635 (96.86%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9955 0.03% 19 17648 0.05% 20 41631 0.13% 21 15384 0.05% 22 18361 0.06% 23 28227 0.09% 24 55174 0.17% 25 139126 0.43% 26 30411 0.09% 27 41689 0.13% 28 56260 0.17% 29 98545 0.30% 30 149925 0.46% 31 37530 0.12% 32 49596 0.15% 33 69545 0.21% 34 157999 0.49% 35 31415635 96.86% 32432641 reads passed initial QC criterion=sequence-density sequence-density=1.19 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=31 prefix-density=0.00 prefix-fanout=1.0 sequence=GATTATCAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=32.98 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.8 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG Started job on | Dec 07 09:28:34 Started mapping on | Dec 07 09:28:34 Finished on | Dec 07 09:29:02 Mapping speed, Million of reads per hour | 4169.91 Number of input reads | 32432641 Average input read length | 34 UNIQUE READS: Uniquely mapped reads number | 29838611 Uniquely mapped reads % | 92.00% Average mapped length | 34.69 Number of splices: Total | 2648202 Number of splices: Annotated (sjdb) | 2581668 Number of splices: GT/AG | 2613112 Number of splices: GC/AG | 33138 Number of splices: AT/AC | 628 Number of splices: Non-canonical | 1324 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.35 Insertion rate per base | 0.00% Insertion average length | 1.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1257205 % of reads mapped to multiple loci | 3.88% Number of reads mapped to too many loci | 407715 % of reads mapped to too many loci | 1.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.84% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1336825 1336825 1336825 N_multimapping 1257205 1257205 1257205 N_noFeature 831504 15299640 14981088 N_ambiguous 450942 44223 18482 UnstrandedReadsAssigned:28556165 PositiveStrandReadsAssigned:14494748 NegativeStrandReadsAssigned:14839041 Dataset is classified unstranded MeadianReadLen=35 20thPercentileLength=35 echo kmer=31 SRR352143 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR352143-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,432,641 reads, 28,098,429 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52973 SRR352143.ke.tsv 35125 SRR352143.se.tsv 88098 total ==> SRR352143.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 51.3596 3.03687 PNS24247 1044 945 17.8216 0.933352 PNS24249 1928 1829 172.485 4.66733 PNS24246 1044 945 17.8216 0.933352 PNS24248 1044 945 17.8216 0.933352 PNS24244 1471 1372 13.6902 0.493839 PNS24243 293 194 5 1.27555 KQK14069 1603 1504 99.8837 3.28683 KQK14071 474 375 97.8593 12.9152 ==> SRR352143.se.tsv <== BRADI_1g14170v3 232 BRADI_1g53295v3 396 BRADI_1g59795v3 467 BRADI_1g07683v3 0 BRADI_1g00485v3 28 BRADI_1g20270v3 233 BRADI_1g74790v3 275 BRADI_1g09890v3 1 BRADI_1g77505v3 226 BRADI_1g48960v3 0 SRR352143 completed mapping pipeline successfully