Starting /dee2/code/volunteer_pipeline.sh SRR352144 current disk space = 1544192974848 free memory = 1597254256 SRR352144 SRAfilesize 5b954cbb7f83bfd2f9f84d01fec4ed91 SRR352144.sra SRR352144.sra file validated SRR352144 is single end SRR352144 is conventional basespace SRR352144 read1 length is 35 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR352144_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.35375 34.0 33.0 34.0 29.0 34.0 2 31.99 34.0 33.0 34.0 28.0 34.0 3 31.99075 34.0 33.0 34.0 28.0 34.0 4 31.91725 34.0 32.0 34.0 28.0 34.0 5 31.9335 34.0 32.0 34.0 28.0 34.0 6 32.15225 34.0 33.0 34.0 29.0 34.0 7 32.14325 34.0 33.0 34.0 29.0 34.0 8 32.11075 34.0 33.0 34.0 28.0 34.0 9 32.03225 34.0 33.0 34.0 28.0 34.0 10 31.905 34.0 32.0 34.0 28.0 34.0 11 31.84175 34.0 32.0 34.0 28.0 34.0 12 31.8065 34.0 32.0 34.0 28.0 34.0 13 31.573 34.0 32.0 34.0 27.0 34.0 14 31.5765 34.0 32.0 34.0 27.0 34.0 15 31.47275 34.0 32.0 34.0 27.0 34.0 16 31.15675 34.0 31.0 34.0 25.0 34.0 17 30.96 34.0 31.0 34.0 25.0 34.0 18 30.966 34.0 31.0 34.0 26.0 34.0 19 30.8845 34.0 31.0 34.0 25.0 34.0 20 30.633 34.0 31.0 34.0 24.0 34.0 21 30.25325 34.0 31.0 34.0 23.0 34.0 22 30.13825 34.0 31.0 34.0 23.0 34.0 23 29.935 33.0 30.0 34.0 22.0 34.0 24 29.66 33.0 30.0 34.0 20.0 34.0 25 29.51 33.0 30.0 34.0 19.0 34.0 26 28.8715 33.0 29.0 34.0 14.0 34.0 27 29.00375 33.0 30.0 34.0 14.0 34.0 28 28.976 33.0 30.0 34.0 14.0 34.0 29 28.74075 33.0 29.0 34.0 9.0 34.0 30 28.29625 33.0 29.0 34.0 2.0 34.0 31 27.692 33.0 28.0 34.0 2.0 34.0 32 27.66575 33.0 28.0 34.0 2.0 34.0 33 27.6075 33.0 28.0 34.0 2.0 34.0 34 27.286 33.0 27.0 34.0 2.0 34.0 35 26.7275 32.0 26.0 34.0 2.0 34.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 0.0 4 1.0 5 1.0 6 3.0 7 7.0 8 5.0 9 10.0 10 15.0 11 9.0 12 14.0 13 16.0 14 22.0 15 23.0 16 18.0 17 26.0 18 30.0 19 48.0 20 21.0 21 36.0 22 39.0 23 48.0 24 50.0 25 48.0 26 91.0 27 120.0 28 139.0 29 159.0 30 228.0 31 349.0 32 535.0 33 1627.0 34 225.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.89882294014525 13.122965189080894 17.731029301277236 41.24718256949662 2 27.800000000000004 21.349999999999998 29.875 20.974999999999998 3 28.15 25.5 22.2 24.15 4 27.0 32.25 17.325 23.425 5 27.900000000000002 31.95 18.875 21.275 6 19.775000000000002 37.65 18.75 23.825 7 18.525 13.875000000000002 40.525 27.075 8 22.675 21.6 23.3 32.425 9 23.325000000000003 19.2 27.650000000000002 29.825000000000003 10 22.650000000000002 36.55 20.8 20.0 11 27.900000000000002 23.724999999999998 18.575 29.799999999999997 12 25.650000000000002 21.05 25.75 27.55 13 23.275000000000002 25.624999999999996 28.050000000000004 23.05 14 24.567993989481593 24.34259954921112 25.344352617079892 25.7450538442274 15 24.65 25.275 23.95 26.125 16 24.875 26.075 24.375 24.675 17 25.324999999999996 26.25 24.075 24.349999999999998 18 25.374999999999996 25.650000000000002 24.25 24.725 19 25.1 24.474999999999998 24.375 26.05 20 24.775 24.575 24.6 26.05 21 24.575 26.674999999999997 23.150000000000002 25.6 22 25.3 24.875 24.15 25.674999999999997 23 26.75 24.55 22.625 26.075 24 25.674999999999997 25.275 24.15 24.9 25 25.0 25.8 24.349999999999998 24.85 26 26.5 25.224999999999998 23.825 24.45 27 25.074999999999996 25.6 24.425 24.9 28 25.650000000000002 24.4 23.724999999999998 26.224999999999998 29 27.025 25.275 22.900000000000002 24.8 30 24.7 25.85 23.724999999999998 25.724999999999998 31 24.349999999999998 25.35 23.775 26.525 32 26.775 25.324999999999996 23.674999999999997 24.224999999999998 33 25.874999999999996 25.575 22.625 25.924999999999997 34 25.424999999999997 24.975 23.799999999999997 25.8 35 26.125 24.925 22.650000000000002 26.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 2.0 19 2.5 20 3.0 21 6.0 22 9.0 23 9.0 24 12.5 25 16.0 26 16.0 27 35.0 28 54.0 29 54.0 30 60.5 31 67.0 32 67.0 33 108.5 34 150.0 35 150.0 36 185.5 37 221.0 38 221.0 39 256.5 40 292.0 41 320.0 42 348.0 43 348.0 44 384.5 45 421.0 46 421.0 47 412.0 48 403.0 49 403.0 50 384.5 51 366.0 52 366.0 53 356.5 54 347.0 55 347.0 56 329.5 57 312.0 58 312.0 59 287.5 60 263.0 61 234.0 62 205.0 63 205.0 64 179.0 65 153.0 66 153.0 67 135.0 68 117.0 69 117.0 70 103.0 71 89.0 72 89.0 73 78.0 74 67.0 75 67.0 76 55.5 77 44.0 78 44.0 79 33.5 80 23.0 81 19.0 82 15.0 83 15.0 84 11.0 85 7.0 86 7.0 87 5.0 88 3.0 89 3.0 90 2.0 91 1.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.17500000000000002 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 35 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.40221216691804923 0.8 3 0.07541478129713425 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1314093 spots for SRR352144.sra Written 1314093 spots for SRR352144.sra Read 1314093 spots for SRR352144.sra Written 1314093 spots for SRR352144.sra Read 1314093 spots for SRR352144.sra Written 1314093 spots for SRR352144.sra Read 1314093 spots for SRR352144.sra Written 1314093 spots for SRR352144.sra Read 1314093 spots for SRR352144.sra Written 1314093 spots for SRR352144.sra Read 1314093 spots for SRR352144.sra Written 1314093 spots for SRR352144.sra Read 1314093 spots for SRR352144.sra Written 1314093 spots for SRR352144.sra Read 1314098 spots for SRR352144.sra Written 1314098 spots for SRR352144.sra Read 1314093 spots for SRR352144.sra Written 1314093 spots for SRR352144.sra Read 1314093 spots for SRR352144.sra Written 1314093 spots for SRR352144.sra Read 1314093 spots for SRR352144.sra Written 1314093 spots for SRR352144.sra Read 1314093 spots for SRR352144.sra Written 1314093 spots for SRR352144.sra Read 1314093 spots for SRR352144.sra Written 1314093 spots for SRR352144.sra Read 1314093 spots for SRR352144.sra Written 1314093 spots for SRR352144.sra Read 1314093 spots for SRR352144.sra Written 1314093 spots for SRR352144.sra Read 1314093 spots for SRR352144.sra Written 1314093 spots for SRR352144.sra Read 1314093 spots for SRR352144.sra Written 1314093 spots for SRR352144.sra Read 1314093 spots for SRR352144.sra Written 1314093 spots for SRR352144.sra Read 1314093 spots for SRR352144.sra Written 1314093 spots for SRR352144.sra Read 1314093 spots for SRR352144.sra Written 1314093 spots for SRR352144.sra SRR ids: ['SRR352144.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wz4pbvho SRR352144.sra spots: 26281865 blocks: [[1, 1314093], [1314094, 2628186], [2628187, 3942279], [3942280, 5256372], [5256373, 6570465], [6570466, 7884558], [7884559, 9198651], [9198652, 10512744], [10512745, 11826837], [11826838, 13140930], [13140931, 14455023], [14455024, 15769116], [15769117, 17083209], [17083210, 18397302], [18397303, 19711395], [19711396, 21025488], [21025489, 22339581], [22339582, 23653674], [23653675, 24967767], [24967768, 26281865]] SRR352144 file size 3484664 SRR352144 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR352144 SRR352144_1.fastq Input file: SRR352144_1.fastq trimmed: SRR352144-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:29:39 2024 >> started Sat Dec 7 09:29:48 2024 >> done (9.366s) 26281865 reads processed; of these: 277819 ( 1.06%) short reads filtered out after trimming by size control 198053 ( 0.75%) empty reads filtered out after trimming by size control 25805993 (98.19%) reads available; of these: 1202776 ( 4.66%) trimmed reads available after processing 24603217 (95.34%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 26135 0.10% 19 49360 0.19% 20 105186 0.41% 21 21283 0.08% 22 28312 0.11% 23 43565 0.17% 24 76941 0.30% 25 137365 0.53% 26 30132 0.12% 27 39670 0.15% 28 60073 0.23% 29 105715 0.41% 30 179555 0.70% 31 39786 0.15% 32 50823 0.20% 33 72336 0.28% 34 136539 0.53% 35 24603217 95.34% 25805993 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.32 fanout-score-rank=17 prefix-density=0.08 prefix-fanout=2.8 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=22 fanout-score=45.12 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.0 sequence=CTGCTGCTGCTTCTCATCCTCCCGGCGGCCCTCACGCCCGGATGATGACCCCTCGCCGTGCCGTCCACGGCCCTCCTGTTCCTGCTGCTG Started job on | Dec 07 09:29:59 Started mapping on | Dec 07 09:29:59 Finished on | Dec 07 09:30:20 Mapping speed, Million of reads per hour | 4423.88 Number of input reads | 25805993 Average input read length | 34 UNIQUE READS: Uniquely mapped reads number | 23033067 Uniquely mapped reads % | 89.25% Average mapped length | 34.46 Number of splices: Total | 1772891 Number of splices: Annotated (sjdb) | 1711789 Number of splices: GT/AG | 1748843 Number of splices: GC/AG | 20302 Number of splices: AT/AC | 1030 Number of splices: Non-canonical | 2716 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.34 Insertion rate per base | 0.00% Insertion average length | 1.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1060224 % of reads mapped to multiple loci | 4.11% Number of reads mapped to too many loci | 706019 % of reads mapped to too many loci | 2.74% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.87% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1712702 1712702 1712702 N_multimapping 1060224 1060224 1060224 N_noFeature 574269 11656983 11728662 N_ambiguous 236890 7770 8145 UnstrandedReadsAssigned:22221908 PositiveStrandReadsAssigned:11368314 NegativeStrandReadsAssigned:11296260 Dataset is classified unstranded MeadianReadLen=35 20thPercentileLength=35 echo kmer=31 SRR352144 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR352144-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,805,993 reads, 21,592,852 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52973 SRR352144.ke.tsv 35125 SRR352144.se.tsv 88098 total ==> SRR352144.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 233.011 17.3633 PNS24247 1044 945 8.05038 0.53133 PNS24249 1928 1829 232.127 7.91574 PNS24246 1044 945 8.05038 0.53133 PNS24248 1044 945 8.05038 0.53133 PNS24244 1471 1372 113.711 5.16924 PNS24243 293 194 1 0.321498 KQK14069 1603 1504 145.36 6.02804 KQK14071 474 375 26.6582 4.43383 ==> SRR352144.se.tsv <== BRADI_1g14170v3 186 BRADI_1g53295v3 95 BRADI_1g59795v3 50 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 1001 BRADI_1g74790v3 7 BRADI_1g09890v3 0 BRADI_1g77505v3 295 BRADI_1g48960v3 2 SRR352144 completed mapping pipeline successfully