Starting /dee2/code/volunteer_pipeline.sh SRR3691898 current disk space = 1523349647360 free memory = 1562626960 SRR3691898 SRAfilesize 97ac60c4f110cc5f91e3a8dc2c30bb48 SRR3691898.sra SRR3691898.sra file validated SRR3691898 is paired end SRR3691898 is conventional basespace SRR3691898 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691898_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.001 33.0 33.0 34.0 32.0 34.0 2 33.11275 34.0 33.0 34.0 32.0 34.0 3 33.059 34.0 33.0 34.0 32.0 34.0 4 33.063 34.0 33.0 34.0 32.0 34.0 5 33.039 34.0 33.0 34.0 32.0 34.0 6 37.203 38.0 38.0 38.0 37.0 38.0 7 37.195 38.0 38.0 38.0 37.0 38.0 8 37.19725 38.0 38.0 38.0 37.0 38.0 9 37.12475 38.0 38.0 38.0 37.0 38.0 10-11 37.2395 38.0 38.0 38.0 37.0 38.0 12-13 37.197 38.0 38.0 38.0 37.0 38.0 14-15 37.1215 38.0 38.0 38.0 37.0 38.0 16-17 37.198875 38.0 38.0 38.0 37.0 38.0 18-19 37.19225 38.0 38.0 38.0 37.0 38.0 20-21 37.246624999999995 38.0 38.0 38.0 37.0 38.0 22-23 37.255375 38.0 38.0 38.0 37.0 38.0 24-25 37.283875 38.0 38.0 38.0 37.0 38.0 26-27 37.268375 38.0 38.0 38.0 37.0 38.0 28-29 37.22225 38.0 38.0 38.0 37.0 38.0 30-31 37.287375 38.0 38.0 38.0 37.0 38.0 32-33 37.271 38.0 38.0 38.0 37.0 38.0 34-35 37.239625000000004 38.0 38.0 38.0 37.0 38.0 36-37 37.300375 38.0 38.0 38.0 37.0 38.0 38-39 37.27075 38.0 38.0 38.0 37.0 38.0 40-41 37.291875000000005 38.0 38.0 38.0 37.0 38.0 42-43 37.2945 38.0 38.0 38.0 37.0 38.0 44-45 37.249875 38.0 38.0 38.0 37.0 38.0 46-47 37.247749999999996 38.0 38.0 38.0 37.0 38.0 48-49 37.193 38.0 38.0 38.0 37.0 38.0 50-51 37.137375000000006 38.0 38.0 38.0 37.0 38.0 52-53 37.152625 38.0 38.0 38.0 37.0 38.0 54-55 37.20025 38.0 38.0 38.0 37.0 38.0 56-57 37.13075 38.0 38.0 38.0 37.0 38.0 58-59 37.105000000000004 38.0 38.0 38.0 37.0 38.0 60-61 37.167 38.0 38.0 38.0 36.5 38.0 62-63 37.13175 38.0 38.0 38.0 37.0 38.0 64-65 37.222875 38.0 38.0 38.0 37.0 38.0 66-67 37.179 38.0 38.0 38.0 37.0 38.0 68-69 37.190875 38.0 38.0 38.0 37.0 38.0 70-71 37.102000000000004 38.0 38.0 38.0 36.0 38.0 72-73 37.101875 38.0 38.0 38.0 36.5 38.0 74-75 37.14125 38.0 38.0 38.0 37.0 38.0 76-77 37.091875 38.0 38.0 38.0 36.5 38.0 78-79 37.110749999999996 38.0 38.0 38.0 37.0 38.0 80-81 37.106 38.0 38.0 38.0 36.0 38.0 82-83 37.01675 38.0 38.0 38.0 36.0 38.0 84-85 36.966875 38.0 38.0 38.0 36.0 38.0 86-87 36.991125 38.0 38.0 38.0 36.0 38.0 88-89 36.91 38.0 38.0 38.0 36.0 38.0 90-91 37.004125 38.0 38.0 38.0 36.0 38.0 92-93 36.890375000000006 38.0 38.0 38.0 35.5 38.0 94-95 36.955 38.0 38.0 38.0 36.0 38.0 96-97 36.97025 38.0 38.0 38.0 36.0 38.0 98-99 36.9725 38.0 38.0 38.0 36.0 38.0 100-101 36.873374999999996 38.0 38.0 38.0 35.5 38.0 102-103 36.868375 38.0 38.0 38.0 35.0 38.0 104-105 36.74825 38.0 38.0 38.0 35.0 38.0 106-107 36.668 38.0 38.0 38.0 34.5 38.0 108-109 36.691125 38.0 38.0 38.0 35.0 38.0 110-111 36.596500000000006 38.0 38.0 38.0 34.0 38.0 112-113 36.411625 38.0 38.0 38.0 34.0 38.0 114-115 36.445750000000004 38.0 38.0 38.0 33.0 38.0 116-117 36.31525 38.0 38.0 38.0 33.0 38.0 118-119 36.200874999999996 38.0 38.0 38.0 32.5 38.0 120-121 36.13875 38.0 38.0 38.0 32.5 38.0 122-123 35.9955 38.0 38.0 38.0 31.5 38.0 124-125 35.8585 38.0 38.0 38.0 31.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10-11 0.0 2309 12-13 0.0 2309 14-15 0.0 2309 16-17 0.0 2309 18-19 0.0 2309 20-21 0.0 2309 22-23 0.0 2309 24-25 0.0 2309 26-27 0.0 2309 28-29 0.0 2309 30-31 0.0 2309 32-33 0.0 2309 34-35 0.0 2309 36-37 0.0 2309 38-39 0.0 2309 40-41 0.0 2309 42-43 0.0 2309 44-45 0.0 2309 46-47 0.0 2309 48-49 0.0 2309 50-51 0.0 2309 52-53 0.0 2309 54-55 0.0 2309 56-57 0.0 2309 58-59 0.0 2309 60-61 0.0 2309 62-63 0.0 2309 64-65 0.0 2309 66-67 0.0 2309 68-69 0.0 2309 70-71 0.0 2309 72-73 0.0 2309 74-75 0.0 2309 76-77 0.0 2309 78-79 0.0 2309 80-81 0.0 2309 82-83 0.0 2309 84-85 0.0 2309 86-87 0.0 2309 88-89 0.0 2309 90-91 0.0 2309 92-93 0.0 2309 94-95 0.0 2309 96-97 0.0 2309 98-99 0.0 2309 100-101 0.0 2309 102-103 0.0 2309 104-105 0.0 2309 106-107 0.0 2309 108-109 0.0 2309 110-111 0.0 2309 112-113 0.0 2309 114-115 0.0 2309 116-117 0.0 2309 118-119 0.0 2309 120-121 0.0 2309 122-123 0.0 2309 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 3.0 18 0.0 19 2.0 20 2.0 21 4.0 22 4.0 23 5.0 24 11.0 25 11.0 26 13.0 27 17.0 28 21.0 29 20.0 30 37.0 31 42.0 32 50.0 33 71.0 34 88.0 35 138.0 36 316.0 37 3143.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.475 19.3 8.375 29.849999999999998 2 28.732183045761438 23.655913978494624 29.307326831707925 18.30457614403601 3 23.025000000000002 24.925 29.549999999999997 22.5 4 26.775 30.049999999999997 20.875 22.3 5 26.700000000000003 33.550000000000004 19.0 20.75 6 22.05 36.475 20.05 21.425 7 23.1807951987997 18.554638659664917 35.408852213053265 22.85571392848212 8 22.1055263815954 23.380845211302827 25.381345336334082 29.132283070767688 9 23.755938984746187 22.755688922230558 27.731932983245812 25.756439109777446 10-11 25.481370342585645 28.907226806701676 21.042760690172543 24.568642160540136 12-13 25.609603601350507 23.571339252219584 25.422033262473427 25.397023883956482 14-15 24.65924721770664 25.159434788045516 26.2348380642741 23.94647992997374 16-17 25.206301575393848 24.406101525381345 25.481370342585645 24.90622655663916 18-19 25.6064016004001 25.381345336334082 24.981245311327832 24.031007751937985 20-21 25.76894223555889 24.76869217304326 25.79394848712178 23.668417104276067 22-23 24.37804725590699 25.740717589698715 25.765720715089387 24.115514439304913 24-25 25.2 26.150000000000002 24.725 23.925 26-27 25.131282820705174 24.85621405351338 25.70642660665166 24.306076519129782 28-29 25.09377344336084 26.39409852463116 25.131282820705174 23.380845211302827 30-31 26.231557889472366 25.09377344336084 24.8062015503876 23.868467116779193 32-33 24.356089022255563 25.98149537384346 25.84396099024756 23.818454613653415 34-35 25.837500000000002 25.337500000000002 24.9375 23.8875 36-37 24.65 25.7625 25.624999999999996 23.962500000000002 38-39 24.925 24.6625 26.0125 24.4 40-41 26.337500000000002 24.875 24.975 23.8125 42-43 25.1 25.05 26.3625 23.4875 44-45 24.25 26.075 25.575 24.099999999999998 46-47 25.95324415551944 25.065633204150515 25.29066133266658 23.69046130766346 48-49 25.49387346836709 25.381345336334082 26.106526631657918 23.018254563640912 50-51 24.81870467616904 26.25656414103526 24.81870467616904 24.10602650662666 52-53 25.35633908477119 24.731182795698924 25.456364091022753 24.456114028507127 54-55 25.09691134175316 25.146930098787045 25.909716143553833 23.846442415905962 56-57 24.509190946604978 25.422033262473427 26.697511566837562 23.371264224084033 58-59 25.78144536134033 24.431107776944234 25.656414103525883 24.131032758189548 60-61 25.618904726181547 25.18129532383096 26.694173543385848 22.50562640660165 62-63 25.406351587896975 24.793698424606152 26.03150787696924 23.768442110527634 64-65 26.056514128532132 24.85621405351338 25.93148287071768 23.15578894723681 66-67 25.340667583447928 25.21565195649456 26.215776972121514 23.22790348793599 68-69 25.5125 25.275 25.337500000000002 23.875 70-71 25.86573321665208 24.965620702587824 25.678209776222026 23.49043630453807 72-73 24.7375 25.124999999999996 26.787499999999998 23.35 74-75 24.953119139892486 25.51568946118265 26.065758219777475 23.465433179147393 76-77 24.8 26.325 25.387500000000003 23.4875 78-79 25.9875 25.3 26.25 22.4625 80-81 24.72809101137642 25.26565820727591 26.52831603950494 23.47793474184273 82-83 24.706176544136035 26.9567391847962 25.44386096524131 22.893223305826456 84-85 25.256314078519633 25.63140785196299 25.36884221055264 23.74343585896474 86-87 25.71285642821411 25.52526263131566 25.812906453226613 22.948974487243625 88-89 26.153846153846157 25.753595997498437 25.878674171357098 22.213883677298313 90-91 26.100550275137568 26.038019009504755 24.83741870935468 23.024012006003 92-93 25.76894223555889 26.79419854963741 24.85621405351338 22.58064516129032 94-95 26.488244122061033 25.72536268134067 24.862431215607803 22.923961980990494 96-97 25.631723792844635 25.66925193895422 25.01876407305479 23.68026019514636 98-99 26.194645984488368 26.745058794095574 24.59344508381286 22.466850137603203 100-101 26.691682301438398 27.292057535959973 24.815509693558475 21.200750469043154 102-103 26.40400250156348 26.6541588492808 24.315196998123827 22.626641651031896 104-105 27.60690172543136 26.669167291822955 23.393348337084273 22.330582645661416 106-107 27.556889222305575 27.206801700425103 24.456114028507127 20.78019504876219 108-109 28.35708927231808 26.70667666916729 24.06851712928232 20.86771692923231 110-111 28.048018006752535 26.835063148680753 24.559209703638864 20.557709140927848 112-113 28.98586970113793 28.048018006752535 22.37088908340628 20.595223208703263 114-115 28.901950975487743 27.48874437218609 22.823911955977987 20.785392696348172 116-117 29.37718859429715 28.289144572286144 22.623811905952977 19.70985492746373 118-119 30.735551663747813 27.820865649236925 21.441080810607957 20.002501876407305 120-121 30.522892169126848 27.09532149111834 22.416812609457093 19.96497373029772 122-123 31.22341756317238 27.358018513885412 22.75456592444333 18.663997998498875 124-125 31.698774080560423 28.358769076807604 21.641230923192396 18.301225919439577 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 1.5 23 2.5 24 1.0 25 1.0 26 2.5 27 1.5 28 1.0 29 3.5 30 8.5 31 15.0 32 17.5 33 18.0 34 33.5 35 49.0 36 56.0 37 79.5 38 98.5 39 117.0 40 129.0 41 127.5 42 163.0 43 195.5 44 198.0 45 190.0 46 187.5 47 188.0 48 179.5 49 172.5 50 154.0 51 153.0 52 152.5 53 113.0 54 99.5 55 103.5 56 87.5 57 76.5 58 74.0 59 81.5 60 76.0 61 67.5 62 66.0 63 61.0 64 57.0 65 50.5 66 42.0 67 41.0 68 34.5 69 28.0 70 32.0 71 25.5 72 17.5 73 21.0 74 17.5 75 8.0 76 6.0 77 4.5 78 4.0 79 2.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.0375 14-15 0.0375 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.0125 24-25 0.0 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0125 48-49 0.025 50-51 0.025 52-53 0.025 54-55 0.0375 56-57 0.0375 58-59 0.025 60-61 0.025 62-63 0.025 64-65 0.025 66-67 0.0125 68-69 0.0 70-71 0.0125 72-73 0.0 74-75 0.0125 76-77 0.0 78-79 0.0 80-81 0.0125 82-83 0.025 84-85 0.025 86-87 0.05 88-89 0.0625 90-91 0.05 92-93 0.025 94-95 0.05 96-97 0.075 98-99 0.075 100-101 0.0625 102-103 0.0625 104-105 0.025 106-107 0.025 108-109 0.025 110-111 0.0375 112-113 0.0375 114-115 0.05 116-117 0.05 118-119 0.075 120-121 0.075 122-123 0.075 124-125 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.07500000000000001 0.0 0.0 0.0 0.0 58-59 0.1125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.2375 0.0 0.0 0.0 0.0 68-69 0.2875 0.0 0.0 0.0 0.0 70-71 0.325 0.0 0.0 0.0 0.0 72-73 0.375 0.0 0.0 0.0 0.0 74-75 0.5125 0.0 0.0 0.0 0.0 76-77 0.75 0.0 0.0 0.0 0.0 78-79 0.975 0.0 0.0 0.0 0.0 80-81 1.2000000000000002 0.0 0.0 0.0 0.0 82-83 1.6625 0.0 0.0 0.0 0.0 84-85 2.3125 0.0 0.0 0.0 0.0 86-87 2.8625 0.0 0.0 0.0 0.0 88-89 3.6125 0.0 0.0 0.0 0.0 90-91 4.55 0.0 0.0 0.0 0.0 92-93 5.574999999999999 0.0 0.0 0.0 0.0 94-95 6.775 0.0 0.0 0.0 0.0 96-97 7.85 0.0 0.0 0.0 0.0 98-99 9.1 0.0 0.0 0.0 0.0 100-101 10.7125 0.0 0.0 0.0 0.0 102-103 12.287500000000001 0.0 0.0 0.0 0.0 104-105 14.425 0.0 0.0 0.0 0.0 106-107 16.875 0.0 0.0 0.0 0.0 108-109 19.225 0.0 0.0 0.0 0.0 110-111 21.4625 0.0 0.0 0.0 0.0 112-113 24.075000000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGAG 90 5.124962E-4 19.833332 118-119 TCGGAAG 110 0.0019741473 16.227272 116-117 GATCGGA 125 0.0046316762 14.28 114-115 >>END_MODULE SRR3691898 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691898_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.706 34.0 33.0 34.0 32.0 34.0 2 33.19775 34.0 33.0 34.0 32.0 34.0 3 33.2545 34.0 33.0 34.0 32.0 34.0 4 33.3025 34.0 33.0 34.0 33.0 34.0 5 33.2765 34.0 33.0 34.0 33.0 34.0 6 36.84825 38.0 37.0 38.0 35.0 38.0 7 37.2255 38.0 38.0 38.0 36.0 38.0 8 37.417 38.0 38.0 38.0 37.0 38.0 9 37.44125 38.0 38.0 38.0 37.0 38.0 10-11 37.424625 38.0 38.0 38.0 37.0 38.0 12-13 37.347624999999994 38.0 38.0 38.0 37.0 38.0 14-15 37.38725 38.0 38.0 38.0 37.0 38.0 16-17 37.45425 38.0 38.0 38.0 37.0 38.0 18-19 37.452125 38.0 38.0 38.0 37.0 38.0 20-21 37.477374999999995 38.0 38.0 38.0 37.0 38.0 22-23 37.488 38.0 38.0 38.0 37.5 38.0 24-25 37.460875 38.0 38.0 38.0 37.5 38.0 26-27 37.432249999999996 38.0 38.0 38.0 37.0 38.0 28-29 37.366125 38.0 38.0 38.0 37.0 38.0 30-31 37.3525 38.0 38.0 38.0 37.0 38.0 32-33 37.3725 38.0 38.0 38.0 37.0 38.0 34-35 37.3995 38.0 38.0 38.0 37.0 38.0 36-37 37.37675 38.0 38.0 38.0 37.0 38.0 38-39 37.367625000000004 38.0 38.0 38.0 37.0 38.0 40-41 37.229625 38.0 38.0 38.0 37.0 38.0 42-43 37.23075 38.0 38.0 38.0 37.0 38.0 44-45 37.251 38.0 38.0 38.0 37.0 38.0 46-47 37.230875 38.0 38.0 38.0 37.0 38.0 48-49 37.205625 38.0 38.0 38.0 37.0 38.0 50-51 37.232 38.0 38.0 38.0 36.5 38.0 52-53 37.182874999999996 38.0 38.0 38.0 36.5 38.0 54-55 37.163 38.0 38.0 38.0 36.5 38.0 56-57 37.22575 38.0 38.0 38.0 37.0 38.0 58-59 37.181375 38.0 38.0 38.0 36.5 38.0 60-61 37.155249999999995 38.0 38.0 38.0 36.0 38.0 62-63 37.162125 38.0 38.0 38.0 36.0 38.0 64-65 37.125 38.0 38.0 38.0 36.0 38.0 66-67 37.107625 38.0 38.0 38.0 36.0 38.0 68-69 37.133375 38.0 38.0 38.0 36.0 38.0 70-71 37.151624999999996 38.0 38.0 38.0 36.0 38.0 72-73 37.10925 38.0 38.0 38.0 36.0 38.0 74-75 37.14 38.0 38.0 38.0 36.0 38.0 76-77 37.06075 38.0 38.0 38.0 36.0 38.0 78-79 37.1035 38.0 38.0 38.0 36.0 38.0 80-81 37.0245 38.0 38.0 38.0 36.0 38.0 82-83 36.941374999999994 38.0 38.0 38.0 35.5 38.0 84-85 36.9325 38.0 38.0 38.0 35.0 38.0 86-87 36.90025 38.0 38.0 38.0 35.5 38.0 88-89 36.98625 38.0 38.0 38.0 35.5 38.0 90-91 36.975125 38.0 38.0 38.0 35.5 38.0 92-93 36.9375 38.0 38.0 38.0 35.0 38.0 94-95 36.947125 38.0 38.0 38.0 35.5 38.0 96-97 36.84775 38.0 38.0 38.0 35.0 38.0 98-99 36.828625 38.0 38.0 38.0 35.0 38.0 100-101 36.824 38.0 38.0 38.0 35.0 38.0 102-103 36.900625000000005 38.0 38.0 38.0 35.0 38.0 104-105 36.77175 38.0 38.0 38.0 35.0 38.0 106-107 36.7915 38.0 38.0 38.0 35.0 38.0 108-109 36.7535 38.0 38.0 38.0 35.0 38.0 110-111 36.623374999999996 38.0 38.0 38.0 34.0 38.0 112-113 36.624875 38.0 38.0 38.0 34.5 38.0 114-115 36.6405 38.0 38.0 38.0 34.5 38.0 116-117 36.482 38.0 38.0 38.0 34.0 38.0 118-119 36.429 38.0 38.0 38.0 34.0 38.0 120-121 36.411874999999995 38.0 38.0 38.0 34.0 38.0 122-123 36.36275 38.0 38.0 38.0 33.5 38.0 124-125 36.229625 38.0 38.0 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10-11 0.0 2309 12-13 0.0 2309 14-15 0.0 2309 16-17 0.0 2309 18-19 0.0 2309 20-21 0.0 2309 22-23 0.0 2309 24-25 0.0 2309 26-27 0.0 2309 28-29 0.0 2309 30-31 0.0 2309 32-33 0.0 2309 34-35 0.0 2309 36-37 0.0 2309 38-39 0.0 2309 40-41 0.0 2309 42-43 0.0 2309 44-45 0.0 2309 46-47 0.0 2309 48-49 0.0 2309 50-51 0.0 2309 52-53 0.0 2309 54-55 0.0 2309 56-57 0.0 2309 58-59 0.0 2309 60-61 0.0 2309 62-63 0.0 2309 64-65 0.0 2309 66-67 0.0 2309 68-69 0.0 2309 70-71 0.0 2309 72-73 0.0 2309 74-75 0.0 2309 76-77 0.0 2309 78-79 0.0 2309 80-81 0.0 2309 82-83 0.0 2309 84-85 0.0 2309 86-87 0.0 2309 88-89 0.0 2309 90-91 0.0 2309 92-93 0.0 2309 94-95 0.0 2309 96-97 0.0 2309 98-99 0.0 2309 100-101 0.0 2309 102-103 0.0 2309 104-105 0.0 2309 106-107 0.0 2309 108-109 0.0 2309 110-111 0.0 2309 112-113 0.0 2309 114-115 0.0 2309 116-117 0.0 2309 118-119 0.0 2309 120-121 0.0 2309 122-123 0.0 2309 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 5.0 24 3.0 25 8.0 26 8.0 27 16.0 28 20.0 29 28.0 30 32.0 31 52.0 32 44.0 33 72.0 34 91.0 35 158.0 36 351.0 37 3111.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.089171974522294 8.229299363057326 6.012738853503185 35.6687898089172 2 25.4 11.1 33.050000000000004 30.45 3 23.25 17.1 23.275000000000002 36.375 4 28.725 24.224999999999998 21.099999999999998 25.95 5 26.474999999999998 29.049999999999997 24.5 19.975 6 21.95 31.474999999999998 23.775 22.8 7 16.475 22.075 43.45 18.0 8 18.2 25.1 31.75 24.95 9 19.875 22.525000000000002 34.225 23.375 10-11 22.85 32.125 22.912499999999998 22.112499999999997 12-13 22.45 25.025 27.4125 25.112499999999997 14-15 22.5875 26.6 26.787499999999998 24.025 16-17 23.1 26.7125 25.7125 24.474999999999998 18-19 23.5875 26.6125 24.712500000000002 25.087500000000002 20-21 23.3875 26.424999999999997 26.5125 23.674999999999997 22-23 23.4875 27.075 25.4625 23.974999999999998 24-25 23.4375 26.087500000000002 24.887500000000003 25.587500000000002 26-27 23.275000000000002 26.525 25.2375 24.962500000000002 28-29 22.650000000000002 26.025 25.650000000000002 25.674999999999997 30-31 23.618404601150285 26.71917979494874 24.85621405351338 24.8062015503876 32-33 22.900000000000002 26.85 25.900000000000002 24.349999999999998 34-35 22.9375 27.0 25.887500000000003 24.175 36-37 23.8125 24.3125 26.0125 25.8625 38-39 22.877859732466558 25.778222277784725 25.715714464308036 25.62820352544068 40-41 23.827978497312163 26.515814476809602 25.053131641455185 24.603075384423054 42-43 23.618404601150285 25.98149537384346 25.256314078519633 25.143785946486624 44-45 23.0375 26.474999999999998 24.8 25.687500000000004 46-47 23.974999999999998 26.325 25.2875 24.4125 48-49 23.615451931491435 26.053256657082137 24.915614451806476 25.415676959619955 50-51 23.275000000000002 26.0 24.9125 25.8125 52-53 23.8375 26.474999999999998 25.2625 24.425 54-55 23.549999999999997 26.724999999999998 24.725 25.0 56-57 23.25 25.7125 25.674999999999997 25.362499999999997 58-59 22.6 27.0 24.775 25.624999999999996 60-61 23.177897237154642 26.31578947368421 25.26565820727591 25.240655081885237 62-63 23.549999999999997 26.137500000000003 24.5625 25.75 64-65 23.9375 25.0625 26.0125 24.9875 66-67 23.058646992622233 26.259847442791045 25.23446292359635 25.447042640990368 68-69 23.868467116779193 25.6064016004001 25.456364091022753 25.068767191797946 70-71 23.777972246530815 25.690711338917367 25.2281535191899 25.30316289536192 72-73 24.125 25.662499999999998 25.587500000000002 24.625 74-75 23.599999999999998 25.7 25.624999999999996 25.074999999999996 76-77 25.124999999999996 25.35 24.837500000000002 24.6875 78-79 23.7875 25.7375 24.887500000000003 25.587500000000002 80-81 23.0 26.1625 26.0125 24.825 82-83 24.087500000000002 26.0125 25.2 24.7 84-85 23.525 26.2625 25.025 25.1875 86-87 23.825 25.412499999999998 25.2625 25.5 88-89 24.962500000000002 25.474999999999998 25.1 24.462500000000002 90-91 24.825 26.0375 24.1875 24.95 92-93 24.45 25.45 25.362499999999997 24.7375 94-95 24.625 26.5125 24.5625 24.3 96-97 24.025 25.974999999999998 23.974999999999998 26.025 98-99 24.2625 26.7125 24.6625 24.3625 100-101 25.224999999999998 26.6 23.3125 24.8625 102-103 24.30303787973497 26.89086135766971 23.67795974496812 25.128141017627204 104-105 24.962500000000002 27.037499999999998 23.775 24.224999999999998 106-107 24.425 27.8875 22.8375 24.85 108-109 24.85 26.5875 23.549999999999997 25.0125 110-111 25.324999999999996 27.175 22.875 24.625 112-113 24.975 28.825 21.9375 24.2625 114-115 23.7 29.4875 22.175 24.637500000000003 116-117 25.474999999999998 28.4 21.4875 24.637500000000003 118-119 24.45 28.925 21.05 25.575 120-121 24.85 28.349999999999998 21.637500000000003 25.162499999999998 122-123 24.75 29.1375 21.5375 24.575 124-125 24.8125 28.95 21.025 25.2125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.0 25 1.5 26 1.5 27 2.5 28 3.5 29 4.5 30 9.0 31 16.5 32 22.5 33 26.5 34 32.5 35 41.0 36 65.5 37 86.5 38 100.5 39 116.0 40 130.0 41 149.0 42 164.5 43 176.5 44 189.0 45 201.5 46 209.0 47 202.5 48 185.5 49 160.0 50 136.0 51 131.5 52 128.5 53 126.0 54 119.5 55 110.5 56 99.5 57 83.5 58 79.0 59 73.5 60 60.5 61 57.0 62 57.5 63 51.5 64 48.0 65 47.5 66 46.0 67 43.5 68 40.5 69 30.5 70 25.0 71 30.0 72 25.0 73 13.5 74 8.0 75 7.5 76 8.0 77 6.5 78 3.0 79 1.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.025 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0125 40-41 0.0125 42-43 0.025 44-45 0.0 46-47 0.0 48-49 0.0125 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0125 62-63 0.0 64-65 0.0 66-67 0.0375 68-69 0.025 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0125 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11683068382538 98.2 2 0.8327024981074944 1.6500000000000001 3 0.05046681806712087 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.07500000000000001 0.0 0.0 0.0 0.0 58-59 0.1125 0.0 0.0 0.0 0.0 60-61 0.1375 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2625 0.0 0.0 0.0 0.0 68-69 0.3125 0.0 0.0 0.0 0.0 70-71 0.35 0.0 0.0 0.0 0.0 72-73 0.4 0.0 0.0 0.0 0.0 74-75 0.55 0.0 0.0 0.0 0.0 76-77 0.8 0.0 0.0 0.0 0.0 78-79 1.0375 0.0 0.0 0.0 0.0 80-81 1.2625000000000002 0.0 0.0 0.0 0.0 82-83 1.7374999999999998 0.0 0.0 0.0 0.0 84-85 2.3875 0.0 0.0 0.0 0.0 86-87 2.925 0.0 0.0 0.0 0.0 88-89 3.6624999999999996 0.0 0.0 0.0 0.0 90-91 4.637499999999999 0.0 0.0 0.0 0.0 92-93 5.65 0.0 0.0 0.0 0.0 94-95 6.875 0.0 0.0 0.0 0.0 96-97 7.987500000000001 0.0 0.0 0.0 0.0 98-99 9.2625 0.0 0.0 0.0 0.0 100-101 10.925 0.0 0.0 0.0 0.0 102-103 12.475 0.0 0.0 0.0 0.0 104-105 14.65 0.0 0.0 0.0 0.0 106-107 17.1625 0.0 0.0 0.0 0.0 108-109 19.6375 0.0 0.0 0.0 0.0 110-111 21.8125 0.0 0.0 0.0 0.0 112-113 24.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGAG 90 5.124962E-4 19.833332 118-119 TCGGAAG 115 0.002657218 15.521739 116-117 GATCGGA 130 0.0060101566 13.730769 114-115 >>END_MODULE Read 1080773 spots for SRR3691898.sra Written 1080773 spots for SRR3691898.sra Read 1080773 spots for SRR3691898.sra Written 1080773 spots for SRR3691898.sra Read 1080773 spots for SRR3691898.sra Written 1080773 spots for SRR3691898.sra Read 1080773 spots for SRR3691898.sra Written 1080773 spots for SRR3691898.sra Read 1080773 spots for SRR3691898.sra Written 1080773 spots for SRR3691898.sra Read 1080773 spots for SRR3691898.sra Written 1080773 spots for SRR3691898.sra Read 1080773 spots for SRR3691898.sra Written 1080773 spots for SRR3691898.sra Read 1080773 spots for SRR3691898.sra Written 1080773 spots for SRR3691898.sra Read 1080773 spots for SRR3691898.sra Written 1080773 spots for SRR3691898.sra Read 1080773 spots for SRR3691898.sra Written 1080773 spots for SRR3691898.sra Read 1080773 spots for SRR3691898.sra Written 1080773 spots for SRR3691898.sra Read 1080773 spots for SRR3691898.sra Written 1080773 spots for SRR3691898.sra Read 1080773 spots for SRR3691898.sra Written 1080773 spots for SRR3691898.sra Read 1080784 spots for SRR3691898.sra Written 1080784 spots for SRR3691898.sra Read 1080773 spots for SRR3691898.sra Written 1080773 spots for SRR3691898.sra Read 1080773 spots for SRR3691898.sra Written 1080773 spots for SRR3691898.sra Read 1080773 spots for SRR3691898.sra Written 1080773 spots for SRR3691898.sra Read 1080773 spots for SRR3691898.sra Written 1080773 spots for SRR3691898.sra Read 1080773 spots for SRR3691898.sra Written 1080773 spots for SRR3691898.sra Read 1080773 spots for SRR3691898.sra Written 1080773 spots for SRR3691898.sra SRR ids: ['SRR3691898.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9dk4d_a2 SRR3691898.sra spots: 21615471 blocks: [[1, 1080773], [1080774, 2161546], [2161547, 3242319], [3242320, 4323092], [4323093, 5403865], [5403866, 6484638], [6484639, 7565411], [7565412, 8646184], [8646185, 9726957], [9726958, 10807730], [10807731, 11888503], [11888504, 12969276], [12969277, 14050049], [14050050, 15130822], [15130823, 16211595], [16211596, 17292368], [17292369, 18373141], [18373142, 19453914], [19453915, 20534687], [20534688, 21615471]] SRR3691898 file size 6880874 SRR3691898 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3691898 SRR3691898_1.fastq SRR3691898_2.fastq Input file: SRR3691898_1.fastq Paired file: SRR3691898_2.fastq trimmed: SRR3691898-trimmed-pair1.fastq, SRR3691898-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:46:03 2024 >> started Mon Dec 9 23:46:36 2024 >> done (33.178s) 21615471 read pairs processed; of these: 162 ( 0.00%) short read pairs filtered out after trimming by size control 4695 ( 0.02%) empty read pairs filtered out after trimming by size control 21610614 (99.98%) read pairs available; of these: 7028597 (32.52%) trimmed read pairs available after processing 14582017 (67.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 2 0.00% 21 1 0.00% 22 6 0.00% 23 4 0.00% 24 2 0.00% 25 5 0.00% 26 3 0.00% 27 8 0.00% 28 11 0.00% 29 20 0.00% 30 32 0.00% 31 34 0.00% 32 40 0.00% 33 41 0.00% 34 47 0.00% 35 58 0.00% 36 68 0.00% 37 62 0.00% 38 107 0.00% 39 118 0.00% 40 160 0.00% 41 170 0.00% 42 200 0.00% 43 178 0.00% 44 209 0.00% 45 253 0.00% 46 309 0.00% 47 345 0.00% 48 454 0.00% 49 531 0.00% 50 619 0.00% 51 705 0.00% 52 805 0.00% 53 808 0.00% 54 961 0.00% 55 1022 0.00% 56 1040 0.00% 57 1287 0.01% 58 1375 0.01% 59 1729 0.01% 60 1994 0.01% 61 2220 0.01% 62 2519 0.01% 63 2864 0.01% 64 3204 0.01% 65 3327 0.02% 66 3694 0.02% 67 4142 0.02% 68 4506 0.02% 69 5126 0.02% 70 6022 0.03% 71 7039 0.03% 72 8000 0.04% 73 9115 0.04% 74 10057 0.05% 75 11114 0.05% 76 12080 0.06% 77 13243 0.06% 78 14553 0.07% 79 16318 0.08% 80 18153 0.08% 81 20845 0.10% 82 23731 0.11% 83 26672 0.12% 84 30038 0.14% 85 33225 0.15% 86 36142 0.17% 87 38748 0.18% 88 41805 0.19% 89 45129 0.21% 90 49079 0.23% 91 54558 0.25% 92 59098 0.27% 93 65024 0.30% 94 71436 0.33% 95 77237 0.36% 96 82207 0.38% 97 86682 0.40% 98 89732 0.42% 99 94103 0.44% 100 100056 0.46% 101 104921 0.49% 102 111479 0.52% 103 118746 0.55% 104 123672 0.57% 105 131676 0.61% 106 135710 0.63% 107 138067 0.64% 108 140633 0.65% 109 144189 0.67% 110 147743 0.68% 111 168244 0.78% 112 306987 1.42% 113 311162 1.44% 114 321981 1.49% 115 330694 1.53% 116 334898 1.55% 117 334329 1.55% 118 334277 1.55% 119 327411 1.52% 120 328102 1.52% 121 348928 1.61% 122 325315 1.51% 123 327916 1.52% 124 332847 1.54% 125 14582017 67.48% 21610614 reads passed initial QC criterion=sequence-density sequence-density=23.95 sequence-density-rank=1 fanout-score=31.33 fanout-score-rank=1 prefix-density=24.12 prefix-fanout=31.1 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA criterion=fanout-score sequence-density=23.95 sequence-density-rank=1 fanout-score=31.33 fanout-score-rank=1 prefix-density=24.12 prefix-fanout=31.1 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA criterion=sequence-density sequence-density=24.06 sequence-density-rank=1 fanout-score=43.76 fanout-score-rank=1 prefix-density=24.16 prefix-fanout=43.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=24.06 sequence-density-rank=1 fanout-score=43.76 fanout-score-rank=1 prefix-density=24.16 prefix-fanout=43.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -y AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3691898 SRR3691898_1.fastq SRR3691898_2.fastq Input file: SRR3691898_1.fastq Paired file: SRR3691898_2.fastq trimmed: SRR3691898-trimmed-pair1.fastq, SRR3691898-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:48:08 2024 >> started Mon Dec 9 23:48:34 2024 >> done (25.832s) 19881765 read pairs processed; of these: 120 ( 0.00%) short read pairs filtered out after trimming by size control 3541 ( 0.02%) empty read pairs filtered out after trimming by size control 19878104 (99.98%) read pairs available; of these: 2495064 (12.55%) trimmed read pairs available after processing 17383040 (87.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 3 0.00% 20 4 0.00% 21 4 0.00% 22 11 0.00% 23 4 0.00% 24 7 0.00% 25 8 0.00% 26 8 0.00% 27 15 0.00% 28 22 0.00% 29 30 0.00% 30 48 0.00% 31 61 0.00% 32 70 0.00% 33 80 0.00% 34 98 0.00% 35 93 0.00% 36 121 0.00% 37 161 0.00% 38 186 0.00% 39 227 0.00% 40 300 0.00% 41 338 0.00% 42 367 0.00% 43 370 0.00% 44 400 0.00% 45 472 0.00% 46 562 0.00% 47 636 0.00% 48 848 0.00% 49 994 0.01% 50 1178 0.01% 51 1300 0.01% 52 1469 0.01% 53 1510 0.01% 54 1741 0.01% 55 1907 0.01% 56 1974 0.01% 57 2299 0.01% 58 2604 0.01% 59 3153 0.02% 60 3715 0.02% 61 4073 0.02% 62 4706 0.02% 63 5324 0.03% 64 5859 0.03% 65 6210 0.03% 66 6776 0.03% 67 7596 0.04% 68 8300 0.04% 69 9524 0.05% 70 11064 0.06% 71 12786 0.06% 72 14684 0.07% 73 16848 0.08% 74 18348 0.09% 75 20381 0.10% 76 22535 0.11% 77 24457 0.12% 78 26624 0.13% 79 29856 0.15% 80 33536 0.17% 81 37950 0.19% 82 43674 0.22% 83 48876 0.25% 84 55056 0.28% 85 60802 0.31% 86 65908 0.33% 87 70680 0.36% 88 77049 0.39% 89 82830 0.42% 90 90072 0.45% 91 99910 0.50% 92 108265 0.54% 93 119119 0.60% 94 131449 0.66% 95 142075 0.71% 96 151001 0.76% 97 159715 0.80% 98 165429 0.83% 99 172758 0.87% 100 183891 0.93% 101 192618 0.97% 102 205016 1.03% 103 217929 1.10% 104 227016 1.14% 105 240388 1.21% 106 249608 1.26% 107 254100 1.28% 108 258731 1.30% 109 264466 1.33% 110 267937 1.35% 111 274153 1.38% 112 282540 1.42% 113 286571 1.44% 114 296147 1.49% 115 304210 1.53% 116 307770 1.55% 117 307647 1.55% 118 307172 1.55% 119 301276 1.52% 120 302174 1.52% 121 318326 1.60% 122 299436 1.51% 123 301993 1.52% 124 305724 1.54% 125 10919754 54.93% criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=41 prefix-density=0.09 prefix-fanout=1.9 sequence=ACCCGAACATGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=200.84 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=23.2 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=3.47 fanout-score-rank=28 prefix-density=0.12 prefix-fanout=2.7 sequence=CCATGTTCGGGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=185.07 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=24.7 sequence=CTGCTGCTGCTGT SRR3691898 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:49:36 Started mapping on | Dec 09 23:49:36 Finished on | Dec 09 23:50:57 Mapping speed, Million of reads per hour | 960.31 Number of input reads | 21606953 Average input read length | 234 UNIQUE READS: Uniquely mapped reads number | 20136925 Uniquely mapped reads % | 93.20% Average mapped length | 233.61 Number of splices: Total | 13668059 Number of splices: Annotated (sjdb) | 12797666 Number of splices: GT/AG | 13475915 Number of splices: GC/AG | 159303 Number of splices: AT/AC | 7396 Number of splices: Non-canonical | 25445 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 2.08 Insertion rate per base | 0.01% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 509063 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 98067 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.59% % of reads unmapped: other | 1.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 961091 961091 961091 N_multimapping 509063 509063 509063 N_noFeature 929548 10376724 10271902 N_ambiguous 471632 28914 27975 UnstrandedReadsAssigned:18735745 PositiveStrandReadsAssigned:9731287 NegativeStrandReadsAssigned:9837048 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=108 echo kmer=103 SRR3691898 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3691898-trimmed-pair1.fastq SRR3691898-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,606,953 reads, 19,623,086 reads pseudoaligned [quant] estimated average fragment length: 132.179 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,353 rounds 52973 SRR3691898.ke.tsv 35125 SRR3691898.se.tsv 88098 total ==> SRR3691898.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 804.946 0 0 PNS24247 1044 912.821 80.3225 6.72238 PNS24249 1928 1796.82 201.621 8.57238 PNS24246 1044 912.821 80.3225 6.72238 PNS24248 1044 912.821 80.3225 6.72238 PNS24244 1471 1339.82 192.412 10.9713 PNS24243 293 163.107 15 7.02572 KQK14069 1603 1471.82 32391.4 1681.3 KQK14071 474 343.682 1913.72 425.396 ==> SRR3691898.se.tsv <== BRADI_1g14170v3 38962 BRADI_1g53295v3 27 BRADI_1g59795v3 1453 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 180 BRADI_1g74790v3 183 BRADI_1g09890v3 0 BRADI_1g77505v3 285 BRADI_1g48960v3 0 SRR3691898 completed mapping pipeline successfully