Starting /dee2/code/volunteer_pipeline.sh SRR3691899 current disk space = 1523340767232 free memory = 1598110840 SRR3691899 SRAfilesize 0017c339145303691c1987b7e62e3e63 SRR3691899.sra SRR3691899.sra file validated SRR3691899 is paired end SRR3691899 is conventional basespace SRR3691899 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691899_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.42525 34.0 33.0 34.0 32.0 34.0 2 33.11075 34.0 33.0 34.0 32.0 34.0 3 33.22375 34.0 33.0 34.0 32.0 34.0 4 33.21875 34.0 33.0 34.0 32.0 34.0 5 33.287 34.0 33.0 34.0 33.0 34.0 6 36.762 38.0 37.0 38.0 35.0 38.0 7 37.14275 38.0 38.0 38.0 36.0 38.0 8 37.36375 38.0 38.0 38.0 37.0 38.0 9 37.438 38.0 38.0 38.0 37.0 38.0 10-11 37.407624999999996 38.0 38.0 38.0 37.0 38.0 12-13 37.3185 38.0 38.0 38.0 37.0 38.0 14-15 37.31 38.0 38.0 38.0 37.0 38.0 16-17 37.372625 38.0 38.0 38.0 37.0 38.0 18-19 37.390875 38.0 38.0 38.0 37.0 38.0 20-21 37.444375 38.0 38.0 38.0 37.0 38.0 22-23 37.411874999999995 38.0 38.0 38.0 37.0 38.0 24-25 37.41125 38.0 38.0 38.0 37.0 38.0 26-27 37.4215 38.0 38.0 38.0 37.0 38.0 28-29 37.412875 38.0 38.0 38.0 37.0 38.0 30-31 37.394625000000005 38.0 38.0 38.0 37.0 38.0 32-33 37.364875 38.0 38.0 38.0 37.0 38.0 34-35 37.42175 38.0 38.0 38.0 37.0 38.0 36-37 37.422 38.0 38.0 38.0 37.0 38.0 38-39 37.333124999999995 38.0 38.0 38.0 37.0 38.0 40-41 37.278375 38.0 38.0 38.0 37.0 38.0 42-43 37.209375 38.0 38.0 38.0 37.0 38.0 44-45 37.30575 38.0 38.0 38.0 37.0 38.0 46-47 37.28575 38.0 38.0 38.0 37.0 38.0 48-49 37.26925 38.0 38.0 38.0 37.0 38.0 50-51 37.208375000000004 38.0 38.0 38.0 37.0 38.0 52-53 37.27075000000001 38.0 38.0 38.0 37.0 38.0 54-55 37.207 38.0 38.0 38.0 36.5 38.0 56-57 37.21575 38.0 38.0 38.0 36.5 38.0 58-59 37.187375 38.0 38.0 38.0 36.5 38.0 60-61 37.165000000000006 38.0 38.0 38.0 36.0 38.0 62-63 37.153625000000005 38.0 38.0 38.0 36.5 38.0 64-65 37.175625 38.0 38.0 38.0 36.0 38.0 66-67 37.070625 38.0 38.0 38.0 36.0 38.0 68-69 37.127875 38.0 38.0 38.0 36.0 38.0 70-71 37.123875 38.0 38.0 38.0 36.0 38.0 72-73 37.150375 38.0 38.0 38.0 36.0 38.0 74-75 37.127250000000004 38.0 38.0 38.0 36.0 38.0 76-77 37.032375 38.0 38.0 38.0 35.5 38.0 78-79 37.068125 38.0 38.0 38.0 36.0 38.0 80-81 37.008875 38.0 38.0 38.0 36.0 38.0 82-83 36.991 38.0 38.0 38.0 36.0 38.0 84-85 36.90025 38.0 38.0 38.0 35.0 38.0 86-87 36.946625 38.0 38.0 38.0 35.5 38.0 88-89 37.04174999999999 38.0 38.0 38.0 36.0 38.0 90-91 37.0235 38.0 38.0 38.0 35.5 38.0 92-93 36.85025 38.0 38.0 38.0 35.0 38.0 94-95 36.999375 38.0 38.0 38.0 36.0 38.0 96-97 36.882625000000004 38.0 38.0 38.0 35.0 38.0 98-99 36.822625 38.0 38.0 38.0 35.0 38.0 100-101 36.81625 38.0 38.0 38.0 35.0 38.0 102-103 36.911500000000004 38.0 38.0 38.0 35.0 38.0 104-105 36.786 38.0 38.0 38.0 35.0 38.0 106-107 36.8465 38.0 38.0 38.0 35.0 38.0 108-109 36.818375 38.0 38.0 38.0 35.0 38.0 110-111 36.683875 38.0 38.0 38.0 34.5 38.0 112-113 36.660375 38.0 38.0 38.0 34.5 38.0 114-115 36.649125 38.0 38.0 38.0 34.5 38.0 116-117 36.487750000000005 38.0 38.0 38.0 34.0 38.0 118-119 36.472875 38.0 38.0 38.0 34.0 38.0 120-121 36.265874999999994 38.0 37.5 38.0 33.5 38.0 122-123 36.303625 38.0 38.0 38.0 33.5 38.0 124-125 36.3595 38.0 38.0 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10-11 0.0 2309 12-13 0.0 2309 14-15 0.0 2309 16-17 0.0 2309 18-19 0.0 2309 20-21 0.0 2309 22-23 0.0 2309 24-25 0.0 2309 26-27 0.0 2309 28-29 0.0 2309 30-31 0.0 2309 32-33 0.0 2309 34-35 0.0 2309 36-37 0.0 2309 38-39 0.0 2309 40-41 0.0 2309 42-43 0.0 2309 44-45 0.0 2309 46-47 0.0 2309 48-49 0.0 2309 50-51 0.0 2309 52-53 0.0 2309 54-55 0.0 2309 56-57 0.0 2309 58-59 0.0 2309 60-61 0.0 2309 62-63 0.0 2309 64-65 0.0 2309 66-67 0.0 2309 68-69 0.0 2309 70-71 0.0 2309 72-73 0.0 2309 74-75 0.0 2309 76-77 0.0 2309 78-79 0.0 2309 80-81 0.0 2309 82-83 0.0 2309 84-85 0.0 2309 86-87 0.0 2309 88-89 0.0 2309 90-91 0.0 2309 92-93 0.0 2309 94-95 0.0 2309 96-97 0.0 2309 98-99 0.0 2309 100-101 0.0 2309 102-103 0.0 2309 104-105 0.0 2309 106-107 0.0 2309 108-109 0.0 2309 110-111 0.0 2309 112-113 0.0 2309 114-115 0.0 2309 116-117 0.0 2309 118-119 0.0 2309 120-121 0.0 2309 122-123 0.0 2309 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 3.0 23 0.0 24 2.0 25 7.0 26 12.0 27 13.0 28 25.0 29 30.0 30 26.0 31 50.0 32 57.0 33 68.0 34 99.0 35 152.0 36 322.0 37 3133.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.46983311938382 11.34788189987163 6.675224646983311 35.50706033376123 2 25.174999999999997 13.675 33.825 27.325 3 22.85 18.0 24.7 34.449999999999996 4 27.975 25.0 20.349999999999998 26.674999999999997 5 25.374999999999996 31.525 22.325 20.775 6 20.9 33.425 23.25 22.425 7 16.675 23.875 40.025 19.425 8 18.9 23.525 31.474999999999998 26.1 9 20.7 21.6 32.375 25.324999999999996 10-11 23.75 30.925000000000004 22.3625 22.9625 12-13 23.75 24.575 26.5375 25.137500000000003 14-15 21.65 25.8 26.137500000000003 26.4125 16-17 23.25 26.200000000000003 25.5625 24.9875 18-19 23.474999999999998 26.3 25.2625 24.962500000000002 20-21 22.3625 25.775 25.974999999999998 25.887500000000003 22-23 23.0125 26.137500000000003 25.424999999999997 25.424999999999997 24-25 22.475 25.7125 25.2125 26.6 26-27 23.9 25.650000000000002 25.525 24.925 28-29 23.05 26.700000000000003 24.2375 26.0125 30-31 23.24040505063133 26.378297287160894 24.57807225903238 25.803225403175396 32-33 22.925 25.9625 26.1625 24.95 34-35 23.825 25.7125 24.9375 25.525 36-37 23.849999999999998 25.587500000000002 24.837500000000002 25.724999999999998 38-39 23.0375 26.8375 25.525 24.6 40-41 23.7375 26.0375 25.2625 24.962500000000002 42-43 22.42780347543443 25.690711338917367 26.115764470558823 25.765720715089387 44-45 23.474999999999998 26.1 24.7375 25.687500000000004 46-47 23.5875 26.450000000000003 25.074999999999996 24.887500000000003 48-49 23.5 26.424999999999997 24.462500000000002 25.6125 50-51 22.95 25.387500000000003 25.3125 26.35 52-53 23.6625 25.8625 25.0625 25.412499999999998 54-55 24.05 26.724999999999998 23.875 25.35 56-57 22.725 26.087500000000002 24.887500000000003 26.3 58-59 23.150000000000002 25.525 25.887500000000003 25.4375 60-61 24.349999999999998 25.412499999999998 24.95 25.2875 62-63 22.8625 24.762500000000003 25.95 26.424999999999997 64-65 23.3625 26.375 25.0375 25.224999999999998 66-67 23.980995248812203 25.831457864466117 23.63090772693173 26.556639159789945 68-69 23.55294411801475 25.59069883735467 24.46555819477435 26.390798849856235 70-71 22.727840980122515 26.2782847855982 25.29066133266658 25.703212901612705 72-73 22.9875 24.8 26.05 26.1625 74-75 23.5875 25.8625 25.5625 24.9875 76-77 24.0 24.637500000000003 24.637500000000003 26.724999999999998 78-79 23.325000000000003 25.937500000000004 24.5625 26.174999999999997 80-81 23.4375 25.4 25.662499999999998 25.5 82-83 24.25 25.624999999999996 24.6125 25.5125 84-85 23.2875 26.200000000000003 24.4125 26.1 86-87 23.599999999999998 25.724999999999998 25.412499999999998 25.2625 88-89 23.7375 25.624999999999996 25.25 25.387500000000003 90-91 23.724999999999998 25.837500000000002 23.8875 26.55 92-93 23.6625 26.1125 24.2625 25.9625 94-95 24.5 26.5375 24.15 24.8125 96-97 23.7125 25.0 25.0375 26.25 98-99 23.7 26.187500000000004 24.3 25.8125 100-101 23.95 26.05 24.925 25.074999999999996 102-103 24.349999999999998 26.0375 24.3 25.3125 104-105 23.75 27.3125 24.5125 24.425 106-107 23.825 26.5 23.6625 26.0125 108-109 24.2 26.125 24.099999999999998 25.575 110-111 24.212500000000002 27.287499999999998 23.75 24.75 112-113 24.9375 26.150000000000002 23.7625 25.15 114-115 24.8 26.2625 22.95 25.9875 116-117 25.2125 26.5875 23.025000000000002 25.174999999999997 118-119 24.275 26.650000000000002 23.275000000000002 25.8 120-121 24.9375 26.187500000000004 22.6875 26.187500000000004 122-123 24.525 26.875 22.95 25.650000000000002 124-125 24.6125 27.375 22.825 25.1875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 2.5 28 2.0 29 4.0 30 9.5 31 16.0 32 18.0 33 24.0 34 33.0 35 43.5 36 64.5 37 87.5 38 103.5 39 118.0 40 144.5 41 153.0 42 147.0 43 164.5 44 201.0 45 201.5 46 182.5 47 188.0 48 179.0 49 163.0 50 147.5 51 139.5 52 130.0 53 113.0 54 104.5 55 94.0 56 85.5 57 87.0 58 81.0 59 67.5 60 64.0 61 64.0 62 66.5 63 61.5 64 53.0 65 46.0 66 49.0 67 50.5 68 40.5 69 38.0 70 32.5 71 28.0 72 24.0 73 21.0 74 18.5 75 14.5 76 13.0 77 7.5 78 2.5 79 1.5 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0125 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.025 68-69 0.0125 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37059415911381 98.675 2 0.5538771399798591 1.0999999999999999 3 0.0755287009063444 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1875 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.32499999999999996 0.0 0.0 0.0 0.0 72-73 0.3875 0.0 0.0 0.0 0.0 74-75 0.425 0.0 0.0 0.0 0.0 76-77 0.525 0.0 0.0 0.0 0.0 78-79 0.625 0.0 0.0 0.0 0.0 80-81 0.7875000000000001 0.0 0.0 0.0 0.0 82-83 1.0375 0.0 0.0 0.0 0.0 84-85 1.2 0.0 0.0 0.0 0.0 86-87 1.4500000000000002 0.0 0.0 0.0 0.0 88-89 1.9375 0.0 0.0 0.0 0.0 90-91 2.425 0.0 0.0 0.0 0.0 92-93 3.1125 0.0 0.0 0.0 0.0 94-95 3.9625 0.0 0.0 0.0 0.0 96-97 4.7125 0.0 0.0 0.0 0.0 98-99 5.512499999999999 0.0 0.0 0.0 0.0 100-101 6.325 0.0 0.0 0.0 0.0 102-103 7.7 0.0 0.0 0.0 0.0 104-105 9.1 0.0 0.0 0.0 0.0 106-107 10.2875 0.0 0.0 0.0 0.0 108-109 11.625 0.0 0.0 0.0 0.0 110-111 13.075 0.0 0.0 0.0 0.0 112-113 14.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3691899 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691899_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8565 33.0 33.0 34.0 32.0 34.0 2 32.92375 34.0 33.0 34.0 32.0 34.0 3 32.913 34.0 33.0 34.0 32.0 34.0 4 32.8845 34.0 33.0 34.0 32.0 34.0 5 32.85925 34.0 33.0 34.0 32.0 34.0 6 36.97725 38.0 38.0 38.0 36.0 38.0 7 36.9105 38.0 38.0 38.0 36.0 38.0 8 36.95825 38.0 38.0 38.0 36.0 38.0 9 37.0095 38.0 38.0 38.0 36.0 38.0 10-11 36.98625 38.0 38.0 38.0 36.0 38.0 12-13 36.911125 38.0 38.0 38.0 36.0 38.0 14-15 36.871 38.0 38.0 38.0 36.0 38.0 16-17 37.034375 38.0 38.0 38.0 36.0 38.0 18-19 36.933375 38.0 38.0 38.0 36.0 38.0 20-21 37.002624999999995 38.0 38.0 38.0 36.0 38.0 22-23 36.94925 38.0 38.0 38.0 36.0 38.0 24-25 36.957125 38.0 38.0 38.0 36.0 38.0 26-27 36.996875 38.0 38.0 38.0 36.0 38.0 28-29 37.0025 38.0 38.0 38.0 36.0 38.0 30-31 37.010999999999996 38.0 38.0 38.0 36.0 38.0 32-33 37.04175 38.0 38.0 38.0 36.0 38.0 34-35 36.972875 38.0 38.0 38.0 36.0 38.0 36-37 37.038250000000005 38.0 38.0 38.0 36.0 38.0 38-39 37.057874999999996 38.0 38.0 38.0 37.0 38.0 40-41 37.080375000000004 38.0 38.0 38.0 36.0 38.0 42-43 37.1085 38.0 38.0 38.0 36.0 38.0 44-45 37.10975 38.0 38.0 38.0 37.0 38.0 46-47 37.04875 38.0 38.0 38.0 36.0 38.0 48-49 37.0085 38.0 38.0 38.0 36.0 38.0 50-51 36.941500000000005 38.0 38.0 38.0 36.0 38.0 52-53 36.997875 38.0 38.0 38.0 36.0 38.0 54-55 37.027249999999995 38.0 38.0 38.0 36.0 38.0 56-57 36.942750000000004 38.0 38.0 38.0 36.0 38.0 58-59 36.901250000000005 38.0 38.0 38.0 36.0 38.0 60-61 37.05225 38.0 38.0 38.0 36.5 38.0 62-63 36.99225 38.0 38.0 38.0 36.0 38.0 64-65 37.032624999999996 38.0 38.0 38.0 36.0 38.0 66-67 37.008125 38.0 38.0 38.0 36.0 38.0 68-69 36.99575 38.0 38.0 38.0 36.0 38.0 70-71 36.908249999999995 38.0 38.0 38.0 35.5 38.0 72-73 36.882000000000005 38.0 38.0 38.0 36.0 38.0 74-75 36.887375 38.0 38.0 38.0 36.0 38.0 76-77 36.942125000000004 38.0 38.0 38.0 36.0 38.0 78-79 36.884 38.0 38.0 38.0 35.0 38.0 80-81 36.894999999999996 38.0 38.0 38.0 35.5 38.0 82-83 36.8665 38.0 38.0 38.0 35.5 38.0 84-85 36.72725 38.0 38.0 38.0 35.0 38.0 86-87 36.74875 38.0 38.0 38.0 35.0 38.0 88-89 36.664625 38.0 38.0 38.0 35.0 38.0 90-91 36.793499999999995 38.0 38.0 38.0 35.0 38.0 92-93 36.688125 38.0 38.0 38.0 35.0 38.0 94-95 36.67375 38.0 38.0 38.0 35.0 38.0 96-97 36.65875 38.0 38.0 38.0 35.0 38.0 98-99 36.752875 38.0 38.0 38.0 35.0 38.0 100-101 36.610875 38.0 38.0 38.0 34.5 38.0 102-103 36.596000000000004 38.0 38.0 38.0 34.5 38.0 104-105 36.471625 38.0 38.0 38.0 34.0 38.0 106-107 36.435625 38.0 38.0 38.0 34.0 38.0 108-109 36.545625 38.0 38.0 38.0 34.0 38.0 110-111 36.444374999999994 38.0 38.0 38.0 34.0 38.0 112-113 36.239374999999995 38.0 38.0 38.0 34.0 38.0 114-115 36.189750000000004 38.0 38.0 38.0 32.5 38.0 116-117 36.194500000000005 38.0 38.0 38.0 33.0 38.0 118-119 35.98425 38.0 38.0 38.0 31.5 38.0 120-121 36.05875 38.0 38.0 38.0 32.0 38.0 122-123 35.895875000000004 38.0 38.0 38.0 31.0 38.0 124-125 35.850624999999994 38.0 38.0 38.0 31.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10-11 0.0 2309 12-13 0.0 2309 14-15 0.0 2309 16-17 0.0 2309 18-19 0.0 2309 20-21 0.0 2309 22-23 0.0 2309 24-25 0.0 2309 26-27 0.0 2309 28-29 0.0 2309 30-31 0.0 2309 32-33 0.0 2309 34-35 0.0 2309 36-37 0.0 2309 38-39 0.0 2309 40-41 0.0 2309 42-43 0.0 2309 44-45 0.0 2309 46-47 0.0 2309 48-49 0.0 2309 50-51 0.0 2309 52-53 0.0 2309 54-55 0.0 2309 56-57 0.0 2309 58-59 0.0 2309 60-61 0.0 2309 62-63 0.0 2309 64-65 0.0 2309 66-67 0.0 2309 68-69 0.0 2309 70-71 0.0 2309 72-73 0.0 2309 74-75 0.0 2309 76-77 0.0 2309 78-79 0.0 2309 80-81 0.0 2309 82-83 0.0 2309 84-85 0.0 2309 86-87 0.0 2309 88-89 0.0 2309 90-91 0.0 2309 92-93 0.0 2309 94-95 0.0 2309 96-97 0.0 2309 98-99 0.0 2309 100-101 0.0 2309 102-103 0.0 2309 104-105 0.0 2309 106-107 0.0 2309 108-109 0.0 2309 110-111 0.0 2309 112-113 0.0 2309 114-115 0.0 2309 116-117 0.0 2309 118-119 0.0 2309 120-121 0.0 2309 122-123 0.0 2309 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 4.0 19 3.0 20 5.0 21 3.0 22 10.0 23 7.0 24 12.0 25 20.0 26 21.0 27 18.0 28 22.0 29 38.0 30 48.0 31 52.0 32 52.0 33 88.0 34 100.0 35 130.0 36 331.0 37 3035.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.025000000000006 20.5 9.025 27.450000000000003 2 28.707176794198553 22.455613903475868 29.532383095773945 19.30482620655164 3 22.725 25.2 28.325 23.75 4 27.125 31.474999999999998 19.2 22.2 5 29.275000000000002 33.074999999999996 17.8 19.85 6 23.125 35.3 20.05 21.525 7 23.10577644411103 18.179544886221557 36.284071017754435 22.43060765191298 8 22.780695173793447 21.13028257064266 26.431607901975497 29.657414353588397 9 24.275 21.15 27.474999999999998 27.1 10-11 26.906726681670417 28.419604901225306 21.255313828457115 23.418354588647162 12-13 26.644161040260066 22.305576394098527 24.69367341835459 26.356589147286826 14-15 24.731182795698924 24.731182795698924 25.968992248062015 24.568642160540136 16-17 27.031757939484873 24.18104526131533 24.681170292573142 24.10602650662666 18-19 25.831457864466117 25.431357839459867 23.95598899724931 24.781195298824706 20-21 25.79394848712178 25.693923480870218 24.706176544136035 23.80595148787197 22-23 26.7125 24.3875 24.85 24.05 24-25 25.8625 25.162499999999998 24.325 24.65 26-27 25.465683210401302 24.440555069383674 25.490686335791974 24.603075384423054 28-29 25.84396099024756 24.943735933983497 25.28132033008252 23.93098274568642 30-31 25.831457864466117 24.731182795698924 25.206301575393848 24.23105776444111 32-33 25.278159769971246 25.603200400050007 24.603075384423054 24.515564445555693 34-35 26.450000000000003 25.6125 24.65 23.2875 36-37 26.400000000000002 24.6875 24.8 24.1125 38-39 26.025 24.962500000000002 25.4375 23.575 40-41 26.55 25.7 24.7375 23.0125 42-43 26.2875 25.2875 24.875 23.549999999999997 44-45 25.35 25.137500000000003 26.0 23.5125 46-47 27.250000000000004 24.4875 24.2625 24.0 48-49 26.244061015253813 24.618654663665918 25.681420355088775 23.455863965991497 50-51 25.30632658164541 25.918979744936234 25.268817204301076 23.50587646911728 52-53 26.9567391847962 24.843710927731934 25.10627656914228 23.093273318329583 54-55 25.968992248062015 25.36884221055264 25.081270317579396 23.58089522380595 56-57 26.556639159789945 24.968742185546386 25.818954738684667 22.655663915978995 58-59 26.51912978244561 25.468867216804203 24.718679669917478 23.293323330832706 60-61 25.618904726181547 25.11877969492373 25.681420355088775 23.58089522380595 62-63 25.893973493373345 25.36884221055264 25.71892973243311 23.018254563640912 64-65 26.106526631657918 25.243810952738183 25.143785946486624 23.50587646911728 66-67 25.790723840480062 26.390798849856235 24.765595699462434 23.052881610201275 68-69 25.374999999999996 24.5125 25.45 24.6625 70-71 26.003250406300786 24.478059757469683 25.50318789848731 24.01550193774222 72-73 25.95 24.6125 25.5625 23.875 74-75 25.2375 25.55 26.35 22.8625 76-77 25.387500000000003 25.624999999999996 25.8625 23.125 78-79 26.625 24.837500000000002 25.5 23.0375 80-81 26.0 25.624999999999996 25.074999999999996 23.3 82-83 24.88122030507627 26.03150787696924 25.79394848712178 23.293323330832706 84-85 24.90622655663916 24.76869217304326 26.356589147286826 23.968492123030757 86-87 26.86921730432608 25.131282820705174 24.681170292573142 23.3183295823956 88-89 25.206301575393848 26.531632908227053 25.23130782695674 23.030757689422355 90-91 26.71917979494874 25.381345336334082 25.156289072268066 22.74318579644911 92-93 26.18154538634659 25.943985996499126 25.04376094023506 22.83070767691923 94-95 26.506626656664167 25.881470367591895 24.431107776944234 23.1807951987997 96-97 26.25656414103526 26.04401100275069 25.143785946486624 22.55563890972743 98-99 26.147305239464803 25.747155183193698 25.17193947730399 22.933600100037513 100-101 26.16904226056514 25.318829707426854 25.531382845711427 22.980745186296573 102-103 26.76919229807452 26.18154538634659 24.643660915228807 22.405601400350086 104-105 25.943985996499126 26.71917979494874 24.568642160540136 22.768192048012004 106-107 26.669167291822955 25.881470367591895 24.63115778944736 22.818204551137786 108-109 27.66941735433858 25.64391097774444 25.081270317579396 21.605401350337583 110-111 27.44436109027257 25.668917229307326 24.718679669917478 22.168042010502624 112-113 27.68192048012003 26.63165791447862 24.20605151287822 21.48037009252313 114-115 28.782195548887223 26.506626656664167 23.080770192548137 21.630407601900476 116-117 28.994748687171796 25.78144536134033 23.843460865216304 21.380345086271568 118-119 28.943089430894307 25.54096310193871 24.840525328330205 20.675422138836772 120-121 29.369842460615153 26.731682920730183 23.493373343335833 20.40510127531883 122-123 29.207301825456366 27.24431107776944 24.043510877719427 19.504876219054765 124-125 30.02000500125031 27.33183295823956 23.40585146286572 19.24231057764441 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 1.5 26 2.5 27 2.0 28 3.0 29 9.0 30 13.5 31 12.5 32 17.0 33 24.0 34 30.5 35 36.5 36 52.0 37 79.0 38 92.0 39 95.5 40 117.0 41 138.0 42 156.0 43 169.0 44 177.5 45 187.0 46 186.5 47 187.5 48 178.5 49 179.5 50 164.5 51 128.5 52 116.5 53 117.5 54 107.0 55 103.5 56 105.0 57 92.5 58 83.5 59 81.0 60 77.0 61 68.5 62 59.0 63 62.5 64 67.0 65 56.0 66 49.5 67 47.0 68 46.0 69 40.5 70 39.0 71 31.0 72 28.5 73 25.5 74 13.5 75 12.0 76 11.5 77 9.0 78 2.5 79 2.0 80 2.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.025 9 0.0 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.025 30-31 0.025 32-33 0.0125 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.025 50-51 0.025 52-53 0.025 54-55 0.025 56-57 0.025 58-59 0.025 60-61 0.025 62-63 0.025 64-65 0.025 66-67 0.0125 68-69 0.0 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.025 84-85 0.025 86-87 0.025 88-89 0.025 90-91 0.025 92-93 0.025 94-95 0.025 96-97 0.025 98-99 0.0375 100-101 0.025 102-103 0.025 104-105 0.025 106-107 0.025 108-109 0.025 110-111 0.025 112-113 0.025 114-115 0.025 116-117 0.025 118-119 0.0625 120-121 0.025 122-123 0.025 124-125 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.30120481927710846 0.6 3 0.0502008032128514 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1875 0.0 0.0 0.0 0.0 68-69 0.2625 0.0 0.0 0.0 0.0 70-71 0.35 0.0 0.0 0.0 0.0 72-73 0.4125 0.0 0.0 0.0 0.0 74-75 0.45 0.0 0.0 0.0 0.0 76-77 0.5375000000000001 0.0 0.0 0.0 0.0 78-79 0.625 0.0 0.0 0.0 0.0 80-81 0.7875000000000001 0.0 0.0 0.0 0.0 82-83 1.0375 0.0 0.0 0.0 0.0 84-85 1.2 0.0 0.0 0.0 0.0 86-87 1.4500000000000002 0.0 0.0 0.0 0.0 88-89 1.9124999999999999 0.0 0.0 0.0 0.0 90-91 2.3625 0.0 0.0 0.0 0.0 92-93 3.0375 0.0 0.0 0.0 0.0 94-95 3.85 0.0 0.0 0.0 0.0 96-97 4.574999999999999 0.0 0.0 0.0 0.0 98-99 5.3625 0.0 0.0 0.0 0.0 100-101 6.2 0.0 0.0 0.0 0.0 102-103 7.55 0.0 0.0 0.0 0.0 104-105 8.925 0.0 0.0 0.0 0.0 106-107 10.1125 0.0 0.0 0.0 0.0 108-109 11.3875 0.0 0.0 0.0 0.0 110-111 12.8375 0.0 0.0 0.0 0.0 112-113 14.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1257496 spots for SRR3691899.sra Written 1257496 spots for SRR3691899.sra Read 1257496 spots for SRR3691899.sra Written 1257496 spots for SRR3691899.sra Read 1257496 spots for SRR3691899.sra Written 1257496 spots for SRR3691899.sra Read 1257496 spots for SRR3691899.sra Written 1257496 spots for SRR3691899.sra Read 1257496 spots for SRR3691899.sra Written 1257496 spots for SRR3691899.sra Read 1257496 spots for SRR3691899.sra Written 1257496 spots for SRR3691899.sra Read 1257496 spots for SRR3691899.sra Written 1257496 spots for SRR3691899.sra Read 1257496 spots for SRR3691899.sra Written 1257496 spots for SRR3691899.sra Read 1257498 spots for SRR3691899.sra Written 1257498 spots for SRR3691899.sra Read 1257496 spots for SRR3691899.sra Written 1257496 spots for SRR3691899.sra Read 1257496 spots for SRR3691899.sra Written 1257496 spots for SRR3691899.sra Read 1257496 spots for SRR3691899.sra Written 1257496 spots for SRR3691899.sra Read 1257496 spots for SRR3691899.sra Written 1257496 spots for SRR3691899.sra Read 1257496 spots for SRR3691899.sra Written 1257496 spots for SRR3691899.sra Read 1257496 spots for SRR3691899.sra Written 1257496 spots for SRR3691899.sra Read 1257496 spots for SRR3691899.sra Written 1257496 spots for SRR3691899.sra Read 1257496 spots for SRR3691899.sra Written 1257496 spots for SRR3691899.sra Read 1257496 spots for SRR3691899.sra Written 1257496 spots for SRR3691899.sra Read 1257496 spots for SRR3691899.sra Written 1257496 spots for SRR3691899.sra Read 1257496 spots for SRR3691899.sra Written 1257496 spots for SRR3691899.sra SRR ids: ['SRR3691899.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6syragxt SRR3691899.sra spots: 25149922 blocks: [[1, 1257496], [1257497, 2514992], [2514993, 3772488], [3772489, 5029984], [5029985, 6287480], [6287481, 7544976], [7544977, 8802472], [8802473, 10059968], [10059969, 11317464], [11317465, 12574960], [12574961, 13832456], [13832457, 15089952], [15089953, 16347448], [16347449, 17604944], [17604945, 18862440], [18862441, 20119936], [20119937, 21377432], [21377433, 22634928], [22634929, 23892424], [23892425, 25149922]] SRR3691899 file size 8007776 SRR3691899 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3691899 SRR3691899_1.fastq SRR3691899_2.fastq Input file: SRR3691899_1.fastq Paired file: SRR3691899_2.fastq trimmed: SRR3691899-trimmed-pair1.fastq, SRR3691899-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:48:26 2024 >> started Mon Dec 9 23:48:54 2024 >> done (27.548s) 25149922 read pairs processed; of these: 146 ( 0.00%) short read pairs filtered out after trimming by size control 3188 ( 0.01%) empty read pairs filtered out after trimming by size control 25146588 (99.99%) read pairs available; of these: 5306180 (21.10%) trimmed read pairs available after processing 19840408 (78.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 4 0.00% 21 3 0.00% 22 2 0.00% 23 4 0.00% 24 7 0.00% 25 9 0.00% 26 8 0.00% 27 9 0.00% 28 6 0.00% 29 10 0.00% 30 10 0.00% 31 22 0.00% 32 17 0.00% 33 30 0.00% 34 33 0.00% 35 32 0.00% 36 40 0.00% 37 60 0.00% 38 55 0.00% 39 78 0.00% 40 110 0.00% 41 96 0.00% 42 144 0.00% 43 139 0.00% 44 166 0.00% 45 166 0.00% 46 178 0.00% 47 233 0.00% 48 275 0.00% 49 346 0.00% 50 417 0.00% 51 428 0.00% 52 482 0.00% 53 551 0.00% 54 572 0.00% 55 616 0.00% 56 676 0.00% 57 743 0.00% 58 884 0.00% 59 1021 0.00% 60 1215 0.00% 61 1406 0.01% 62 1551 0.01% 63 1845 0.01% 64 2049 0.01% 65 2143 0.01% 66 2322 0.01% 67 2592 0.01% 68 2839 0.01% 69 3221 0.01% 70 3895 0.02% 71 4234 0.02% 72 5094 0.02% 73 5957 0.02% 74 6489 0.03% 75 7033 0.03% 76 7806 0.03% 77 8520 0.03% 78 9235 0.04% 79 10476 0.04% 80 11745 0.05% 81 13442 0.05% 82 14968 0.06% 83 17005 0.07% 84 19108 0.08% 85 21301 0.08% 86 23367 0.09% 87 24981 0.10% 88 27162 0.11% 89 29312 0.12% 90 32288 0.13% 91 35658 0.14% 92 38753 0.15% 93 42616 0.17% 94 46654 0.19% 95 51390 0.20% 96 54746 0.22% 97 58874 0.23% 98 61226 0.24% 99 64665 0.26% 100 69432 0.28% 101 72826 0.29% 102 77306 0.31% 103 83109 0.33% 104 86465 0.34% 105 92600 0.37% 106 96591 0.38% 107 98714 0.39% 108 101923 0.41% 109 106185 0.42% 110 108784 0.43% 111 118867 0.47% 112 229476 0.91% 113 235562 0.94% 114 243400 0.97% 115 253572 1.01% 116 259781 1.03% 117 262306 1.04% 118 263262 1.05% 119 262837 1.05% 120 265617 1.06% 121 306757 1.22% 122 268170 1.07% 123 275007 1.09% 124 279761 1.11% 125 19840408 78.90% 25146588 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=36 prefix-density=0.17 prefix-fanout=2.0 sequence=GTATTTAGCCTTGGACGGAGTCTACCGCCCGATTTGGGCTGCATTCCCAAACAACCCGACTCGTTGACGGCGCCTCGTGGGGCGACAGGGTCCGGGCCGGACGGGGCTCTCACCCTCCCAGGCGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGTCGCTGAGGACGCCTCTCCAGACTACAATTCGGACGGCACGGCCGCCCGATTCTCAAGCTGGGCTGCTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTCTCCT criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=285.10 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=17.8 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=8.91 fanout-score-rank=14 prefix-density=0.34 prefix-fanout=5.6 sequence=AAGGAGCTGGAGGAGGTGAAGAAGGAGTACCCTGACGCCTATGTCCGCATCATCGGCTTCGACAACACCAGGCAAGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGGCAAGGCCTAAGCAAGTTGATTTCTTATAATACAAGAACGGGTCACACCGATTTTATGTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATCTCTCCCAACAACCCGGATTAACTGTATTCATGAGTACTACTATTATAAGAGTACTACAACTATCGTTGGGAGAGGGGCATGTAATATAAACTCCGGTTATACATATTAAGATAAGTATATTTTGTAAAAGAATATCAAATTCGTCGACAAATTCTGATT criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=176.69 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=22.3 sequence=CAAGAAGAAGGT SRR3691899 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:49:41 Started mapping on | Dec 09 23:49:41 Finished on | Dec 09 23:51:26 Mapping speed, Million of reads per hour | 862.17 Number of input reads | 25146588 Average input read length | 244 UNIQUE READS: Uniquely mapped reads number | 22499580 Uniquely mapped reads % | 89.47% Average mapped length | 241.58 Number of splices: Total | 16187760 Number of splices: Annotated (sjdb) | 15195913 Number of splices: GT/AG | 15964236 Number of splices: GC/AG | 187372 Number of splices: AT/AC | 8768 Number of splices: Non-canonical | 27384 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.06 Insertion rate per base | 0.01% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 536160 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 93657 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.50% % of reads unmapped: other | 1.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2111142 2111142 2111142 N_multimapping 536160 536160 536160 N_noFeature 1036987 11935403 11153051 N_ambiguous 521605 41764 34573 UnstrandedReadsAssigned:20940988 PositiveStrandReadsAssigned:10522413 NegativeStrandReadsAssigned:11311956 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=117 echo kmer=113 SRR3691899 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3691899-trimmed-pair1.fastq SRR3691899-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,146,588 reads, 22,699,074 reads pseudoaligned [quant] estimated average fragment length: 151.671 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52973 SRR3691899.ke.tsv 35125 SRR3691899.se.tsv 88098 total ==> SRR3691899.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 785.433 0 0 PNS24247 1044 893.329 86.5417 6.26852 PNS24249 1928 1777.33 200.532 7.30075 PNS24246 1044 893.329 86.5417 6.26852 PNS24248 1044 893.329 86.5417 6.26852 PNS24244 1471 1320.33 279.843 13.7146 PNS24243 293 145.289 11 4.89903 KQK14069 1603 1452.33 36095.2 1608.18 KQK14071 474 324.538 1989.72 396.713 ==> SRR3691899.se.tsv <== BRADI_1g14170v3 40013 BRADI_1g53295v3 49 BRADI_1g59795v3 1609 BRADI_1g07683v3 0 BRADI_1g00485v3 30 BRADI_1g20270v3 204 BRADI_1g74790v3 253 BRADI_1g09890v3 0 BRADI_1g77505v3 379 BRADI_1g48960v3 0 SRR3691899 completed mapping pipeline successfully