Starting /dee2/code/volunteer_pipeline.sh SRR3691900 current disk space = 1523303780352 free memory = 1602353216 SRR3691900 SRAfilesize 78074488b3ed6a09b645d48d32b2d6fd SRR3691900.sra SRR3691900.sra file validated SRR3691900 is paired end SRR3691900 is conventional basespace SRR3691900 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691900_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.583 34.0 33.0 34.0 32.0 34.0 2 33.08275 34.0 33.0 34.0 32.0 34.0 3 33.1635 34.0 33.0 34.0 32.0 34.0 4 33.2385 34.0 33.0 34.0 32.0 34.0 5 33.2415 34.0 33.0 34.0 33.0 34.0 6 36.87125 38.0 37.0 38.0 36.0 38.0 7 37.2775 38.0 38.0 38.0 37.0 38.0 8 37.407 38.0 38.0 38.0 37.0 38.0 9 37.5395 38.0 38.0 38.0 38.0 38.0 10-11 37.494749999999996 38.0 38.0 38.0 37.5 38.0 12-13 37.463 38.0 38.0 38.0 38.0 38.0 14-15 37.433625 38.0 38.0 38.0 38.0 38.0 16-17 37.5205 38.0 38.0 38.0 38.0 38.0 18-19 37.45975 38.0 38.0 38.0 38.0 38.0 20-21 37.48175 38.0 38.0 38.0 37.5 38.0 22-23 37.506375 38.0 38.0 38.0 38.0 38.0 24-25 37.485375000000005 38.0 38.0 38.0 38.0 38.0 26-27 37.510125 38.0 38.0 38.0 38.0 38.0 28-29 37.44225 38.0 38.0 38.0 38.0 38.0 30-31 37.447874999999996 38.0 38.0 38.0 37.5 38.0 32-33 37.385999999999996 38.0 38.0 38.0 37.5 38.0 34-35 37.4035 38.0 38.0 38.0 37.0 38.0 36-37 37.364875 38.0 38.0 38.0 37.0 38.0 38-39 37.319625 38.0 38.0 38.0 37.0 38.0 40-41 37.382374999999996 38.0 38.0 38.0 37.0 38.0 42-43 37.345749999999995 38.0 38.0 38.0 37.0 38.0 44-45 37.262625 38.0 38.0 38.0 37.0 38.0 46-47 37.212 38.0 38.0 38.0 37.0 38.0 48-49 37.31425 38.0 38.0 38.0 37.0 38.0 50-51 37.278999999999996 38.0 38.0 38.0 37.0 38.0 52-53 37.308375 38.0 38.0 38.0 37.0 38.0 54-55 37.2715 38.0 38.0 38.0 37.0 38.0 56-57 37.213125000000005 38.0 38.0 38.0 37.0 38.0 58-59 37.316125 38.0 38.0 38.0 37.0 38.0 60-61 37.31725 38.0 38.0 38.0 37.0 38.0 62-63 37.219125 38.0 38.0 38.0 37.0 38.0 64-65 37.2505 38.0 38.0 38.0 37.0 38.0 66-67 37.20525000000001 38.0 38.0 38.0 36.5 38.0 68-69 37.238249999999994 38.0 38.0 38.0 37.0 38.0 70-71 37.179249999999996 38.0 38.0 38.0 36.0 38.0 72-73 37.189875 38.0 38.0 38.0 36.5 38.0 74-75 37.20975 38.0 38.0 38.0 36.5 38.0 76-77 37.08925 38.0 38.0 38.0 36.0 38.0 78-79 37.171875 38.0 38.0 38.0 36.0 38.0 80-81 37.074124999999995 38.0 38.0 38.0 36.0 38.0 82-83 37.098124999999996 38.0 38.0 38.0 36.0 38.0 84-85 37.059875 38.0 38.0 38.0 36.0 38.0 86-87 37.072125 38.0 38.0 38.0 36.0 38.0 88-89 37.042249999999996 38.0 38.0 38.0 36.0 38.0 90-91 36.82925 38.0 38.0 38.0 35.0 38.0 92-93 36.942750000000004 38.0 38.0 38.0 35.0 38.0 94-95 36.843 38.0 38.0 38.0 35.0 38.0 96-97 36.880125 38.0 38.0 38.0 35.0 38.0 98-99 36.909375 38.0 38.0 38.0 35.0 38.0 100-101 36.8665 38.0 38.0 38.0 35.0 38.0 102-103 36.80575 38.0 38.0 38.0 35.0 38.0 104-105 36.69375 38.0 38.0 38.0 34.5 38.0 106-107 36.779624999999996 38.0 38.0 38.0 35.0 38.0 108-109 36.710750000000004 38.0 38.0 38.0 35.0 38.0 110-111 36.84925 38.0 38.0 38.0 35.0 38.0 112-113 36.757999999999996 38.0 38.0 38.0 35.0 38.0 114-115 36.585875 38.0 38.0 38.0 34.0 38.0 116-117 36.467 38.0 38.0 38.0 34.0 38.0 118-119 36.56925 38.0 38.0 38.0 34.0 38.0 120-121 36.589875000000006 38.0 38.0 38.0 34.5 38.0 122-123 36.566625 38.0 38.0 38.0 34.0 38.0 124-125 36.502 38.0 38.0 38.0 34.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 1.0 23 3.0 24 4.0 25 2.0 26 3.0 27 17.0 28 26.0 29 26.0 30 30.0 31 41.0 32 59.0 33 79.0 34 97.0 35 139.0 36 300.0 37 3172.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.420837589376916 7.865168539325842 8.478038815117467 36.235955056179776 2 25.974999999999998 12.625 30.875000000000004 30.525000000000002 3 23.150000000000002 17.05 24.2 35.6 4 29.5 22.675 21.4 26.424999999999997 5 28.125 27.950000000000003 23.549999999999997 20.375 6 21.95 31.275 24.7 22.075 7 17.925 23.25 40.575 18.25 8 20.3 22.375 31.525 25.8 9 19.8 20.724999999999998 34.275 25.2 10-11 23.6625 30.562499999999996 23.1625 22.6125 12-13 22.8625 24.3125 27.775 25.05 14-15 22.9875 24.474999999999998 27.700000000000003 24.837500000000002 16-17 23.599999999999998 24.762500000000003 25.6125 26.025 18-19 24.65 25.25 25.2875 24.8125 20-21 23.575 26.375 26.0 24.05 22-23 23.1 26.625 25.4375 24.837500000000002 24-25 24.45 25.624999999999996 24.7 25.224999999999998 26-27 22.287499999999998 26.0125 26.075 25.624999999999996 28-29 22.975 25.900000000000002 24.8625 26.2625 30-31 23.2125 25.474999999999998 25.85 25.4625 32-33 23.5625 25.7 25.924999999999997 24.8125 34-35 23.5875 25.525 25.324999999999996 25.5625 36-37 23.325000000000003 25.0625 25.6125 26.0 38-39 22.6125 25.650000000000002 25.95 25.7875 40-41 23.5375 25.8625 25.7625 24.837500000000002 42-43 23.8625 25.474999999999998 25.374999999999996 25.2875 44-45 22.75 25.324999999999996 26.900000000000002 25.025 46-47 23.7375 25.275 25.2875 25.7 48-49 23.425 24.887500000000003 26.275 25.412499999999998 50-51 23.5875 25.337500000000002 25.7875 25.2875 52-53 23.7375 25.374999999999996 25.35 25.5375 54-55 23.8125 24.975 25.112499999999997 26.1 56-57 23.962500000000002 25.387500000000003 25.2375 25.412499999999998 58-59 24.5375 25.162499999999998 26.174999999999997 24.125 60-61 23.8625 25.387500000000003 25.112499999999997 25.637500000000003 62-63 24.3875 24.087500000000002 25.674999999999997 25.85 64-65 23.925 25.45 25.25 25.374999999999996 66-67 24.025 25.3 25.0375 25.637500000000003 68-69 23.974999999999998 25.4625 25.4375 25.124999999999996 70-71 23.7125 25.3125 25.224999999999998 25.75 72-73 24.0 25.25 24.725 26.025 74-75 23.5 24.9875 26.125 25.387500000000003 76-77 23.5125 24.9125 25.587500000000002 25.9875 78-79 24.9125 24.9 24.4 25.7875 80-81 23.962500000000002 25.374999999999996 24.975 25.687500000000004 82-83 23.974999999999998 25.3125 25.4 25.3125 84-85 23.925 24.95 25.0 26.125 86-87 24.3625 25.575 25.1875 24.875 88-89 24.587500000000002 26.35 24.375 24.6875 90-91 24.6125 25.2375 24.462500000000002 25.687500000000004 92-93 24.775 25.575 25.0 24.65 94-95 23.849999999999998 26.4625 24.587500000000002 25.1 96-97 25.0625 26.474999999999998 24.175 24.2875 98-99 25.25 25.575 24.425 24.75 100-101 24.6 25.874999999999996 24.0125 25.5125 102-103 24.725 26.0625 24.0375 25.174999999999997 104-105 25.124999999999996 26.85 23.3625 24.6625 106-107 25.424999999999997 27.474999999999998 23.0625 24.0375 108-109 25.3125 27.575 22.5125 24.6 110-111 25.8125 27.6875 21.6625 24.837500000000002 112-113 25.2875 27.3625 22.325 25.025 114-115 24.875 27.537499999999998 22.112499999999997 25.474999999999998 116-117 25.224999999999998 27.075 22.225 25.474999999999998 118-119 24.712500000000002 28.425 21.4875 25.374999999999996 120-121 25.45 27.787499999999998 21.462500000000002 25.3 122-123 25.5375 28.237499999999997 21.349999999999998 24.875 124-125 25.387500000000003 29.037499999999998 20.875 24.7 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.0 26 2.5 27 3.5 28 7.5 29 10.0 30 8.0 31 11.5 32 15.5 33 23.5 34 30.0 35 37.0 36 56.0 37 67.5 38 78.0 39 99.5 40 123.0 41 153.5 42 177.5 43 178.5 44 180.5 45 191.0 46 203.5 47 202.5 48 177.5 49 158.5 50 155.5 51 150.0 52 132.0 53 108.5 54 105.0 55 112.0 56 103.0 57 90.0 58 82.5 59 75.0 60 67.0 61 65.5 62 62.0 63 54.5 64 53.0 65 52.0 66 49.0 67 51.0 68 50.0 69 44.0 70 34.5 71 25.5 72 22.0 73 15.5 74 11.5 75 10.0 76 6.5 77 4.0 78 4.0 79 3.5 80 2.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47156517362859 98.825 2 0.45294413688978363 0.8999999999999999 3 0.050327126321087066 0.15 4 0.0 0.0 5 0.025163563160543533 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATCTCGTAT 5 0.125 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.21250000000000002 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.3 0.0 0.0 0.0 0.0 70-71 0.36250000000000004 0.0 0.0 0.0 0.0 72-73 0.5249999999999999 0.0 0.0 0.0 0.0 74-75 0.6125 0.0 0.0 0.0 0.0 76-77 0.7375 0.0 0.0 0.0 0.0 78-79 0.875 0.0 0.0 0.0 0.0 80-81 1.075 0.0 0.0 0.0 0.0 82-83 1.2875 0.0 0.0 0.0 0.0 84-85 1.6749999999999998 0.0 0.0 0.0 0.0 86-87 2.3 0.0 0.0 0.0 0.0 88-89 3.0375 0.0 0.0 0.0 0.0 90-91 3.65 0.0 0.0 0.0 0.0 92-93 4.45 0.0 0.0 0.0 0.0 94-95 5.3375 0.0 0.0 0.0 0.0 96-97 6.862500000000001 0.0 0.0 0.0 0.0 98-99 8.5125 0.0 0.0 0.0 0.0 100-101 10.350000000000001 0.0 0.0 0.0 0.0 102-103 12.45 0.0 0.0 0.0 0.0 104-105 14.4875 0.0 0.0 0.0 0.0 106-107 16.65 0.0 0.0 0.0 0.0 108-109 18.8875 0.0 0.0 0.0 0.0 110-111 21.3625 0.0 0.0 0.0 0.0 112-113 23.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3691900 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691900_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.70675 33.0 33.0 34.0 32.0 34.0 2 32.8315 34.0 33.0 34.0 32.0 34.0 3 32.90475 34.0 33.0 34.0 32.0 34.0 4 32.71425 34.0 33.0 34.0 32.0 34.0 5 32.834 34.0 33.0 34.0 32.0 34.0 6 36.92 38.0 38.0 38.0 36.0 38.0 7 36.9525 38.0 38.0 38.0 36.0 38.0 8 37.01225 38.0 38.0 38.0 36.0 38.0 9 36.953 38.0 38.0 38.0 36.0 38.0 10-11 36.900875 38.0 38.0 38.0 36.0 38.0 12-13 36.856875 38.0 38.0 38.0 36.0 38.0 14-15 36.92775 38.0 38.0 38.0 36.0 38.0 16-17 36.85225 38.0 38.0 38.0 36.0 38.0 18-19 36.888999999999996 38.0 38.0 38.0 36.0 38.0 20-21 36.840625 38.0 38.0 38.0 36.0 38.0 22-23 36.786500000000004 38.0 38.0 38.0 36.0 38.0 24-25 36.8215 38.0 38.0 38.0 36.0 38.0 26-27 36.82875 38.0 38.0 38.0 36.0 38.0 28-29 36.987125 38.0 38.0 38.0 36.0 38.0 30-31 36.981875 38.0 38.0 38.0 36.0 38.0 32-33 36.935249999999996 38.0 38.0 38.0 36.0 38.0 34-35 36.9195 38.0 38.0 38.0 36.0 38.0 36-37 36.85325 38.0 38.0 38.0 36.0 38.0 38-39 36.881875 38.0 38.0 38.0 36.0 38.0 40-41 36.876374999999996 38.0 38.0 38.0 36.0 38.0 42-43 36.925375 38.0 38.0 38.0 36.0 38.0 44-45 36.795249999999996 38.0 38.0 38.0 35.5 38.0 46-47 36.852625 38.0 38.0 38.0 36.0 38.0 48-49 36.860125 38.0 38.0 38.0 36.0 38.0 50-51 36.88675 38.0 38.0 38.0 36.0 38.0 52-53 36.84975 38.0 38.0 38.0 36.0 38.0 54-55 36.788624999999996 38.0 38.0 38.0 35.5 38.0 56-57 36.76375 38.0 38.0 38.0 35.5 38.0 58-59 36.7615 38.0 38.0 38.0 35.5 38.0 60-61 36.858875 38.0 38.0 38.0 36.0 38.0 62-63 36.820875 38.0 38.0 38.0 36.0 38.0 64-65 36.796 38.0 38.0 38.0 36.0 38.0 66-67 36.770250000000004 38.0 38.0 38.0 35.5 38.0 68-69 36.64025 38.0 38.0 38.0 34.5 38.0 70-71 36.625875 38.0 38.0 38.0 35.0 38.0 72-73 36.770125 38.0 38.0 38.0 35.5 38.0 74-75 36.639250000000004 38.0 38.0 38.0 35.0 38.0 76-77 36.632374999999996 38.0 38.0 38.0 35.0 38.0 78-79 36.613375000000005 38.0 38.0 38.0 35.0 38.0 80-81 36.62625 38.0 38.0 38.0 35.0 38.0 82-83 36.55075 38.0 38.0 38.0 34.5 38.0 84-85 36.462374999999994 38.0 38.0 38.0 34.0 38.0 86-87 36.592 38.0 38.0 38.0 35.0 38.0 88-89 36.492875 38.0 38.0 38.0 34.0 38.0 90-91 36.40275 38.0 38.0 38.0 34.0 38.0 92-93 36.35025 38.0 38.0 38.0 34.0 38.0 94-95 36.418375 38.0 38.0 38.0 34.0 38.0 96-97 36.39 38.0 38.0 38.0 34.0 38.0 98-99 36.254875 38.0 38.0 38.0 34.0 38.0 100-101 36.243375 38.0 38.0 38.0 34.0 38.0 102-103 36.191874999999996 38.0 38.0 38.0 33.5 38.0 104-105 36.227999999999994 38.0 38.0 38.0 34.0 38.0 106-107 36.142250000000004 38.0 38.0 38.0 33.5 38.0 108-109 36.16325 38.0 38.0 38.0 33.0 38.0 110-111 36.099625 38.0 38.0 38.0 33.5 38.0 112-113 35.931 38.0 38.0 38.0 32.0 38.0 114-115 35.907875000000004 38.0 38.0 38.0 31.5 38.0 116-117 35.70275 38.0 37.0 38.0 31.0 38.0 118-119 35.303625 38.0 36.5 38.0 30.0 38.0 120-121 35.07625 38.0 36.0 38.0 28.5 38.0 122-123 34.87175 38.0 36.0 38.0 25.5 38.0 124-125 34.775 38.0 35.5 38.0 25.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 2.0 17 9.0 18 14.0 19 5.0 20 10.0 21 7.0 22 11.0 23 10.0 24 13.0 25 19.0 26 20.0 27 24.0 28 30.0 29 26.0 30 46.0 31 55.0 32 61.0 33 87.0 34 126.0 35 170.0 36 359.0 37 2893.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.51680883090818 18.916206723532365 12.895132965378824 27.67185148018063 2 31.298473855391546 23.267450587940957 26.294721040780583 19.139354515886914 3 22.34175631723793 24.34325744308231 29.372029021766327 23.942957217913435 4 28.446334751063297 29.997498123592692 19.36452339254441 22.191643732799598 5 28.646484863647736 33.17488116087065 18.88916687515637 19.289467100325243 6 23.411705852926463 35.692846423211606 19.559779889944974 21.335667833916958 7 23.686843421710854 19.259629814907452 33.74187093546773 23.311655827913956 8 23.43671835917959 23.611805902951478 23.961980990495245 28.989494747373683 9 23.936968484242122 21.83591795897949 27.613806903451728 26.613306653326664 10-11 26.432324243182386 28.233675256442332 20.80310232674506 24.530898173630224 12-13 25.881911433575183 23.367525644233176 24.468351263447584 26.28221165874406 14-15 24.843632724543408 25.193895421566175 25.106329747310486 24.856142106579934 16-17 26.695021265949464 25.168876657493122 23.967975981986488 24.168126094570926 18-19 26.307230422817113 24.91868901676257 23.867900925694272 24.906179634726044 20-21 25.628517823639775 25.07817385866166 24.840525328330205 24.452782989368355 22-23 26.063031515757878 25.0 25.050025012506254 23.88694347173587 24-25 25.912956478239117 24.72486243121561 25.325162581290645 24.037018509254626 26-27 25.237618809404704 25.312656328164078 24.68734367183592 24.7623811905953 28-29 24.81240620310155 25.26263131565783 25.012506253126567 24.912456228114056 30-31 25.203252032520325 24.72795497185741 25.753595997498437 24.315196998123827 32-33 25.437718859429715 25.587793896948476 25.087543771885944 23.88694347173587 34-35 24.874937468734366 26.350675337668832 24.92496248124062 23.84942471235618 36-37 24.821808178066775 24.684256596223584 25.734650493935224 24.759284731774414 38-39 24.92496248124062 25.812906453226613 25.312656328164078 23.949474737368686 40-41 26.00375234521576 24.44027517198249 24.82801751094434 24.72795497185741 42-43 24.81240620310155 25.362681340670335 25.46273136568284 24.362181090545274 44-45 26.20387742338962 24.715447154471544 25.22826766729206 23.85240775484678 46-47 25.950475237618807 25.86293146573287 24.412206103051524 23.774387193596798 48-49 25.941213258286428 26.19136960600375 24.190118824265166 23.677298311444652 50-51 26.032024018013512 24.88116087065299 24.69352014010508 24.39329497122842 52-53 26.09457092819615 24.69352014010508 25.293970477858394 23.91793845384038 54-55 25.93194896172129 25.11883912934701 25.093820365273956 23.855391543657746 56-57 25.11883912934701 25.40655491618714 25.619214410808105 23.855391543657746 58-59 25.74108818011257 24.452782989368355 25.403377110694187 24.40275171982489 60-61 25.941213258286428 25.65353345841151 24.853033145716072 23.55222013758599 62-63 25.365853658536587 26.216385240775487 24.552845528455283 23.864915572232643 64-65 25.212606303151574 25.46273136568284 25.512756378189096 23.81190595297649 66-67 25.275137568784395 26.425712856428213 25.062531265632813 23.23661830915458 68-69 25.09691134175316 26.910091284231584 24.721770663999 23.271226710016258 70-71 25.159434788045516 25.54708015505815 25.62210829060898 23.67137676628736 72-73 25.60030015007504 25.887943971985994 25.18759379689845 23.32416208104052 74-75 25.7503751875938 25.912956478239117 25.325162581290645 23.011505752876438 76-77 25.80040020010005 25.212606303151574 25.287643821910955 23.699349674837418 78-79 26.21310655327664 25.975487743871934 24.974987493746873 22.836418209104554 80-81 25.50956608728273 26.15980992872327 24.946855070651495 23.383768913342504 82-83 25.065666041275797 26.55409631019387 24.740462789243278 23.639774859287055 84-85 26.21966474856142 24.931198398799097 25.719289467100324 23.129847385539154 86-87 26.09457092819615 26.720040030022517 24.59344508381286 22.59194395796848 88-89 25.806855141356017 25.619214410808105 25.30647985989492 23.267450587940957 90-91 26.444833625218916 25.99449587190393 24.280710532899676 23.279959969977483 92-93 25.581686264698522 26.7575681761321 24.293219914936202 23.367525644233176 94-95 26.278924327704818 26.36647904940588 24.11507191994997 23.239524702939338 96-97 26.310521706493184 26.72338296009008 23.97097460277743 22.99512073063931 98-99 26.176176176176174 26.726726726726728 25.425425425425423 21.67167167167167 100-101 26.463963963963966 26.38888888888889 23.973973973973976 23.173173173173172 102-103 27.289789789789793 27.414914914914917 23.385885885885884 21.90940940940941 104-105 27.020265198899175 27.257943457593193 23.992994746059544 21.728796597448085 106-107 28.68401300975732 26.832624468351263 23.14235676757568 21.341005754315738 108-109 27.920940705529144 27.132849637227917 23.417563172379285 21.528646484863646 110-111 28.521391043282463 27.645734300725543 23.267450587940957 20.565424068051037 112-113 30.113849618416115 27.13624421368698 21.9942449643438 20.755661203553107 114-115 29.600900788189666 26.735893907168773 22.594770424121105 21.068434880520456 116-117 30.585439079309484 27.695771828871653 21.553665248936703 20.165123842882164 118-119 30.207018429689477 27.871749558192377 22.46907346629639 19.452158545821764 120-121 30.851735015772867 27.760252365930597 22.03154574132492 19.35646687697161 122-123 30.85656616626719 28.37138892393087 21.88722089062697 18.88482401917497 124-125 32.03785488958991 28.315457413249213 21.13564668769716 18.51104100946372 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 2.0 24 2.5 25 1.5 26 1.5 27 5.0 28 7.5 29 5.0 30 5.5 31 8.5 32 13.5 33 18.5 34 23.5 35 33.5 36 47.0 37 63.5 38 78.0 39 97.0 40 133.0 41 148.0 42 152.0 43 173.5 44 190.0 45 207.0 46 207.5 47 191.5 48 187.0 49 182.5 50 153.0 51 130.5 52 123.0 53 125.0 54 118.5 55 102.5 56 90.0 57 88.0 58 90.5 59 77.0 60 71.0 61 68.5 62 62.5 63 58.5 64 52.0 65 45.5 66 52.5 67 53.5 68 48.0 69 39.5 70 33.5 71 34.0 72 28.0 73 20.5 74 12.5 75 7.0 76 6.5 77 6.0 78 4.5 79 3.5 80 2.0 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.075 3 0.075 4 0.075 5 0.075 6 0.05 7 0.05 8 0.05 9 0.05 10-11 0.075 12-13 0.075 14-15 0.075 16-17 0.075 18-19 0.075 20-21 0.0625 22-23 0.05 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.0625 32-33 0.05 34-35 0.05 36-37 0.0375 38-39 0.05 40-41 0.0625 42-43 0.05 44-45 0.0625 46-47 0.05 48-49 0.0625 50-51 0.075 52-53 0.075 54-55 0.075 56-57 0.075 58-59 0.0625 60-61 0.0625 62-63 0.0625 64-65 0.05 66-67 0.05 68-69 0.0375 70-71 0.0375 72-73 0.05 74-75 0.05 76-77 0.05 78-79 0.05 80-81 0.0375 82-83 0.0625 84-85 0.075 86-87 0.075 88-89 0.075 90-91 0.075 92-93 0.075 94-95 0.0625 96-97 0.08750000000000001 98-99 0.1 100-101 0.1 102-103 0.1 104-105 0.075 106-107 0.075 108-109 0.075 110-111 0.075 112-113 0.08750000000000001 114-115 0.08750000000000001 116-117 0.075 118-119 0.975 120-121 0.9375 122-123 0.9125 124-125 0.9375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.21250000000000002 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.3 0.0 0.0 0.0 0.0 70-71 0.36250000000000004 0.0 0.0 0.0 0.0 72-73 0.5249999999999999 0.0 0.0 0.0 0.0 74-75 0.6125 0.0 0.0 0.0 0.0 76-77 0.725 0.0 0.0 0.0 0.0 78-79 0.8374999999999999 0.0 0.0 0.0 0.0 80-81 1.025 0.0 0.0 0.0 0.0 82-83 1.2375 0.0 0.0 0.0 0.0 84-85 1.65 0.0 0.0 0.0 0.0 86-87 2.3125 0.0 0.0 0.0 0.0 88-89 3.0875 0.0 0.0 0.0 0.0 90-91 3.7 0.0 0.0 0.0 0.0 92-93 4.5 0.0 0.0 0.0 0.0 94-95 5.3625 0.0 0.0 0.0 0.0 96-97 6.95 0.0 0.0 0.0 0.0 98-99 8.600000000000001 0.0 0.0 0.0 0.0 100-101 10.4125 0.0 0.0 0.0 0.0 102-103 12.375 0.0 0.0 0.0 0.0 104-105 14.475 0.0 0.0 0.0 0.0 106-107 16.675 0.0 0.0 0.0 0.0 108-109 18.975 0.0 0.0 0.0 0.0 110-111 21.4875 0.0 0.0 0.0 0.0 112-113 23.799999999999997 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGTACT 15 0.004098244 59.45 82-83 AAAAAAA 40 0.0047681252 30.101263 118-119 >>END_MODULE Read 1195524 spots for SRR3691900.sra Written 1195524 spots for SRR3691900.sra Read 1195524 spots for SRR3691900.sra Written 1195524 spots for SRR3691900.sra Read 1195524 spots for SRR3691900.sra Written 1195524 spots for SRR3691900.sra Read 1195524 spots for SRR3691900.sra Written 1195524 spots for SRR3691900.sra Read 1195524 spots for SRR3691900.sra Written 1195524 spots for SRR3691900.sra Read 1195524 spots for SRR3691900.sra Written 1195524 spots for SRR3691900.sra Read 1195524 spots for SRR3691900.sra Written 1195524 spots for SRR3691900.sra Read 1195524 spots for SRR3691900.sra Written 1195524 spots for SRR3691900.sra Read 1195524 spots for SRR3691900.sra Written 1195524 spots for SRR3691900.sra Read 1195524 spots for SRR3691900.sra Written 1195524 spots for SRR3691900.sra Read 1195524 spots for SRR3691900.sra Written 1195524 spots for SRR3691900.sra Read 1195524 spots for SRR3691900.sra Written 1195524 spots for SRR3691900.sra Read 1195524 spots for SRR3691900.sra Written 1195524 spots for SRR3691900.sra Read 1195524 spots for SRR3691900.sra Written 1195524 spots for SRR3691900.sra Read 1195524 spots for SRR3691900.sra Written 1195524 spots for SRR3691900.sra Read 1195524 spots for SRR3691900.sra Written 1195524 spots for SRR3691900.sra Read 1195524 spots for SRR3691900.sra Written 1195524 spots for SRR3691900.sra Read 1195524 spots for SRR3691900.sra Written 1195524 spots for SRR3691900.sra Read 1195524 spots for SRR3691900.sra Written 1195524 spots for SRR3691900.sra Read 1195528 spots for SRR3691900.sra Written 1195528 spots for SRR3691900.sra SRR ids: ['SRR3691900.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o5nbzooh SRR3691900.sra spots: 23910484 blocks: [[1, 1195524], [1195525, 2391048], [2391049, 3586572], [3586573, 4782096], [4782097, 5977620], [5977621, 7173144], [7173145, 8368668], [8368669, 9564192], [9564193, 10759716], [10759717, 11955240], [11955241, 13150764], [13150765, 14346288], [14346289, 15541812], [15541813, 16737336], [16737337, 17932860], [17932861, 19128384], [19128385, 20323908], [20323909, 21519432], [21519433, 22714956], [22714957, 23910484]] SRR3691900 file size 7612606 SRR3691900 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3691900 SRR3691900_1.fastq SRR3691900_2.fastq Input file: SRR3691900_1.fastq Paired file: SRR3691900_2.fastq trimmed: SRR3691900-trimmed-pair1.fastq, SRR3691900-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:50:58 2024 >> started Mon Dec 9 23:51:21 2024 >> done (22.520s) 23910484 read pairs processed; of these: 127 ( 0.00%) short read pairs filtered out after trimming by size control 12639 ( 0.05%) empty read pairs filtered out after trimming by size control 23897718 (99.95%) read pairs available; of these: 7452447 (31.18%) trimmed read pairs available after processing 16445271 (68.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 4 0.00% 21 6 0.00% 22 2 0.00% 23 5 0.00% 24 1 0.00% 25 8 0.00% 26 10 0.00% 27 11 0.00% 28 16 0.00% 29 24 0.00% 30 28 0.00% 31 32 0.00% 32 42 0.00% 33 46 0.00% 34 44 0.00% 35 48 0.00% 36 77 0.00% 37 77 0.00% 38 106 0.00% 39 116 0.00% 40 168 0.00% 41 200 0.00% 42 222 0.00% 43 238 0.00% 44 255 0.00% 45 256 0.00% 46 303 0.00% 47 406 0.00% 48 446 0.00% 49 573 0.00% 50 605 0.00% 51 722 0.00% 52 826 0.00% 53 875 0.00% 54 957 0.00% 55 1005 0.00% 56 1106 0.00% 57 1271 0.01% 58 1485 0.01% 59 1694 0.01% 60 2000 0.01% 61 2410 0.01% 62 2707 0.01% 63 3032 0.01% 64 3219 0.01% 65 3588 0.02% 66 3927 0.02% 67 4268 0.02% 68 4747 0.02% 69 5513 0.02% 70 6421 0.03% 71 7361 0.03% 72 8429 0.04% 73 9603 0.04% 74 10651 0.04% 75 11694 0.05% 76 12847 0.05% 77 13876 0.06% 78 15023 0.06% 79 16897 0.07% 80 19311 0.08% 81 22049 0.09% 82 24730 0.10% 83 27889 0.12% 84 31515 0.13% 85 34193 0.14% 86 36762 0.15% 87 39928 0.17% 88 42979 0.18% 89 46513 0.19% 90 50400 0.21% 91 55751 0.23% 92 61335 0.26% 93 67357 0.28% 94 74366 0.31% 95 79244 0.33% 96 84165 0.35% 97 88418 0.37% 98 92946 0.39% 99 97054 0.41% 100 103210 0.43% 101 108480 0.45% 102 115794 0.48% 103 124482 0.52% 104 129352 0.54% 105 138371 0.58% 106 140978 0.59% 107 143797 0.60% 108 147398 0.62% 109 151405 0.63% 110 155746 0.65% 111 177314 0.74% 112 324489 1.36% 113 332839 1.39% 114 343047 1.44% 115 354072 1.48% 116 357163 1.49% 117 357792 1.50% 118 356369 1.49% 119 351321 1.47% 120 350964 1.47% 121 380041 1.59% 122 350594 1.47% 123 355852 1.49% 124 362140 1.52% 125 16445271 68.82% 23897718 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=27 prefix-density=0.30 prefix-fanout=2.2 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=226.58 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=20.9 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=28 prefix-density=0.28 prefix-fanout=2.1 sequence=CCATGTTCGGGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=14 fanout-score=133.10 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=17.2 sequence=GAAGAAGAAGAAACAACTCCGGCCATGGCGGGCATCATCCACAAGATCGAGGAGAAGCTCCACATGGGCGGTGGCAGCGACCACAAGGACGAGCACAAGAA SRR3691900 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:52:04 Started mapping on | Dec 09 23:52:04 Finished on | Dec 09 23:53:54 Mapping speed, Million of reads per hour | 782.11 Number of input reads | 23897718 Average input read length | 241 UNIQUE READS: Uniquely mapped reads number | 21310567 Uniquely mapped reads % | 89.17% Average mapped length | 236.97 Number of splices: Total | 15937243 Number of splices: Annotated (sjdb) | 14967445 Number of splices: GT/AG | 15715926 Number of splices: GC/AG | 187047 Number of splices: AT/AC | 8359 Number of splices: Non-canonical | 25911 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.05 Insertion rate per base | 0.01% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 393221 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 54327 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.14% % of reads unmapped: other | 0.81% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2194156 2194156 2194156 N_multimapping 393221 393221 393221 N_noFeature 926655 11555692 10268893 N_ambiguous 480066 40434 29498 UnstrandedReadsAssigned:19903846 PositiveStrandReadsAssigned:9714441 NegativeStrandReadsAssigned:11012176 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=109 echo kmer=105 SRR3691900 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3691900-trimmed-pair1.fastq SRR3691900-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,897,718 reads, 21,987,433 reads pseudoaligned [quant] estimated average fragment length: 134.084 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,213 rounds 52973 SRR3691900.ke.tsv 35125 SRR3691900.se.tsv 88098 total ==> SRR3691900.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 803.069 0 0 PNS24247 1044 910.916 63.4137 4.80745 PNS24249 1928 1794.92 207.062 7.96647 PNS24246 1044 910.916 63.4137 4.80745 PNS24248 1044 910.916 63.4137 4.80745 PNS24244 1471 1337.92 129.697 6.69436 PNS24243 293 161.504 8 3.4207 KQK14069 1603 1469.92 42204.4 1982.78 KQK14071 474 341.973 3378.11 682.17 ==> SRR3691900.se.tsv <== BRADI_1g14170v3 48316 BRADI_1g53295v3 30 BRADI_1g59795v3 1405 BRADI_1g07683v3 0 BRADI_1g00485v3 17 BRADI_1g20270v3 164 BRADI_1g74790v3 165 BRADI_1g09890v3 0 BRADI_1g77505v3 333 BRADI_1g48960v3 2 SRR3691900 completed mapping pipeline successfully