Starting /dee2/code/volunteer_pipeline.sh SRR3691901 current disk space = 1523281227776 free memory = 1561802260 SRR3691901 SRAfilesize 3df86935bd1e45d19f78d9ea64feb247 SRR3691901.sra SRR3691901.sra file validated SRR3691901 is paired end SRR3691901 is conventional basespace SRR3691901 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691901_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.61875 34.0 33.0 34.0 32.0 34.0 2 33.1045 34.0 33.0 34.0 32.0 34.0 3 33.184 34.0 33.0 34.0 32.0 34.0 4 33.18675 34.0 33.0 34.0 32.0 34.0 5 33.2885 34.0 33.0 34.0 33.0 34.0 6 36.9425 38.0 37.0 38.0 35.0 38.0 7 37.32525 38.0 38.0 38.0 37.0 38.0 8 37.3905 38.0 38.0 38.0 37.0 38.0 9 37.43 38.0 38.0 38.0 37.0 38.0 10-11 37.407375 38.0 38.0 38.0 37.0 38.0 12-13 37.44175 38.0 38.0 38.0 37.5 38.0 14-15 37.44525 38.0 38.0 38.0 37.5 38.0 16-17 37.530625 38.0 38.0 38.0 38.0 38.0 18-19 37.502 38.0 38.0 38.0 38.0 38.0 20-21 37.429125 38.0 38.0 38.0 37.5 38.0 22-23 37.4135 38.0 38.0 38.0 37.5 38.0 24-25 37.512249999999995 38.0 38.0 38.0 37.5 38.0 26-27 37.414249999999996 38.0 38.0 38.0 37.0 38.0 28-29 37.406625000000005 38.0 38.0 38.0 37.0 38.0 30-31 37.4195 38.0 38.0 38.0 37.0 38.0 32-33 37.387249999999995 38.0 38.0 38.0 37.0 38.0 34-35 37.377125 38.0 38.0 38.0 37.0 38.0 36-37 37.359 38.0 38.0 38.0 37.0 38.0 38-39 37.339375000000004 38.0 38.0 38.0 37.0 38.0 40-41 37.328 38.0 38.0 38.0 37.0 38.0 42-43 37.26225 38.0 38.0 38.0 37.0 38.0 44-45 37.27912499999999 38.0 38.0 38.0 37.0 38.0 46-47 37.181625 38.0 38.0 38.0 37.0 38.0 48-49 37.155125 38.0 38.0 38.0 36.5 38.0 50-51 37.209 38.0 38.0 38.0 37.0 38.0 52-53 37.16975 38.0 38.0 38.0 36.0 38.0 54-55 37.18825 38.0 38.0 38.0 36.5 38.0 56-57 37.181375 38.0 38.0 38.0 36.0 38.0 58-59 37.174625 38.0 38.0 38.0 36.5 38.0 60-61 37.194125 38.0 38.0 38.0 36.5 38.0 62-63 37.126625 38.0 38.0 38.0 36.0 38.0 64-65 37.08125 38.0 38.0 38.0 36.0 38.0 66-67 37.135625000000005 38.0 38.0 38.0 36.0 38.0 68-69 37.10025 38.0 38.0 38.0 36.0 38.0 70-71 37.060249999999996 38.0 38.0 38.0 36.0 38.0 72-73 37.121625 38.0 38.0 38.0 36.0 38.0 74-75 37.144000000000005 38.0 38.0 38.0 36.0 38.0 76-77 37.094750000000005 38.0 38.0 38.0 36.0 38.0 78-79 37.10125 38.0 38.0 38.0 36.0 38.0 80-81 37.026250000000005 38.0 38.0 38.0 36.0 38.0 82-83 36.999375 38.0 38.0 38.0 35.5 38.0 84-85 36.973875 38.0 38.0 38.0 36.0 38.0 86-87 36.932875 38.0 38.0 38.0 36.0 38.0 88-89 36.9045 38.0 38.0 38.0 35.0 38.0 90-91 36.752125 38.0 38.0 38.0 35.0 38.0 92-93 36.797125 38.0 38.0 38.0 35.0 38.0 94-95 36.747 38.0 38.0 38.0 34.5 38.0 96-97 36.704125000000005 38.0 38.0 38.0 35.0 38.0 98-99 36.745625000000004 38.0 38.0 38.0 35.0 38.0 100-101 36.758375 38.0 38.0 38.0 35.0 38.0 102-103 36.713750000000005 38.0 38.0 38.0 35.0 38.0 104-105 36.548125 38.0 38.0 38.0 34.0 38.0 106-107 36.629999999999995 38.0 38.0 38.0 34.0 38.0 108-109 36.61175 38.0 38.0 38.0 34.0 38.0 110-111 36.6315 38.0 38.0 38.0 34.0 38.0 112-113 36.616125 38.0 38.0 38.0 34.0 38.0 114-115 36.473375000000004 38.0 38.0 38.0 34.0 38.0 116-117 36.365125 38.0 38.0 38.0 34.0 38.0 118-119 36.383375 38.0 38.0 38.0 34.0 38.0 120-121 36.391375 38.0 38.0 38.0 34.0 38.0 122-123 36.328500000000005 38.0 38.0 38.0 33.5 38.0 124-125 36.264250000000004 38.0 38.0 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 1.0 23 3.0 24 4.0 25 8.0 26 14.0 27 9.0 28 24.0 29 26.0 30 40.0 31 43.0 32 48.0 33 61.0 34 97.0 35 162.0 36 396.0 37 3061.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.18989280245023 10.82184788157223 8.779989790709546 38.208269525267994 2 25.624999999999996 13.5 31.4 29.475 3 23.200000000000003 19.75 22.225 34.825 4 26.974999999999998 27.700000000000003 19.425 25.900000000000002 5 27.275 30.55 21.85 20.325 6 22.5 32.824999999999996 23.375 21.3 7 17.25 23.25 40.75 18.75 8 20.0 23.599999999999998 29.325000000000003 27.075 9 21.125 20.599999999999998 33.35 24.925 10-11 24.0125 30.337500000000002 22.75 22.900000000000002 12-13 22.6375 24.1375 27.250000000000004 25.974999999999998 14-15 23.125 25.7125 26.337500000000002 24.825 16-17 23.6125 25.6 25.624999999999996 25.162499999999998 18-19 23.375 26.55 25.474999999999998 24.6 20-21 22.3375 26.075 26.125 25.4625 22-23 22.4375 26.437500000000004 25.4875 25.637500000000003 24-25 23.0125 25.7125 25.8125 25.4625 26-27 23.575 25.95 25.05 25.424999999999997 28-29 22.8875 25.825 25.6 25.687500000000004 30-31 23.3875 25.837500000000002 25.4 25.374999999999996 32-33 24.349999999999998 25.687500000000004 25.4875 24.474999999999998 34-35 23.7625 26.237500000000004 26.075 23.925 36-37 22.9625 25.5375 25.05 26.450000000000003 38-39 23.6625 25.25 24.4 26.687499999999996 40-41 23.5 26.325 24.8125 25.362499999999997 42-43 23.35 25.924999999999997 25.2 25.525 44-45 22.8875 25.5 25.9625 25.650000000000002 46-47 23.6625 25.5125 25.45 25.374999999999996 48-49 22.9375 25.7375 25.0125 26.3125 50-51 24.425 26.2875 25.2875 24.0 52-53 23.150000000000002 25.874999999999996 25.362499999999997 25.6125 54-55 22.775000000000002 26.3125 24.625 26.2875 56-57 24.1875 25.587500000000002 24.85 25.374999999999996 58-59 24.099999999999998 25.15 25.337500000000002 25.412499999999998 60-61 23.0875 26.3 24.85 25.7625 62-63 23.575 25.662499999999998 25.525 25.2375 64-65 23.5875 25.5625 24.6875 26.1625 66-67 23.625 25.5 25.4875 25.387500000000003 68-69 23.1125 26.150000000000002 24.9125 25.825 70-71 23.1375 25.45 26.187500000000004 25.224999999999998 72-73 23.7 25.387500000000003 24.7875 26.125 74-75 23.1 25.0 25.412499999999998 26.487500000000004 76-77 24.0 25.637500000000003 24.337500000000002 26.025 78-79 24.1375 25.75 24.337500000000002 25.775 80-81 24.0 25.1 25.374999999999996 25.525 82-83 23.7625 26.787499999999998 25.087500000000002 24.3625 84-85 24.175 25.7625 24.7375 25.324999999999996 86-87 23.575 24.725 25.75 25.95 88-89 24.4125 25.674999999999997 24.6625 25.25 90-91 25.0625 24.712500000000002 24.5 25.724999999999998 92-93 24.2875 25.525 24.875 25.3125 94-95 24.75 25.7 24.85 24.7 96-97 24.275 26.1125 24.575 25.0375 98-99 24.275 26.3125 24.349999999999998 25.0625 100-101 24.525 26.187500000000004 23.7875 25.5 102-103 25.874999999999996 26.0 23.3625 24.762500000000003 104-105 24.0125 27.250000000000004 24.075 24.6625 106-107 25.137500000000003 26.0375 23.6375 25.1875 108-109 25.025 26.4125 23.25 25.3125 110-111 25.174999999999997 26.275 23.2875 25.2625 112-113 24.4125 27.1 22.237499999999997 26.25 114-115 24.25 28.4125 21.95 25.387500000000003 116-117 24.4 28.1875 22.075 25.337500000000002 118-119 25.3125 27.575 21.6625 25.45 120-121 25.324999999999996 27.675 21.7375 25.2625 122-123 25.35 28.050000000000004 21.462500000000002 25.137500000000003 124-125 25.637500000000003 27.787499999999998 21.25 25.324999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 1.5 26 2.0 27 2.5 28 3.0 29 6.5 30 6.5 31 11.5 32 21.0 33 24.0 34 36.0 35 42.0 36 58.5 37 85.5 38 101.5 39 115.0 40 133.5 41 146.5 42 153.5 43 180.0 44 188.5 45 192.5 46 185.5 47 184.5 48 191.5 49 170.0 50 157.5 51 142.0 52 129.0 53 108.0 54 98.0 55 99.5 56 87.5 57 90.5 58 84.0 59 62.0 60 58.5 61 68.5 62 65.5 63 58.5 64 53.5 65 54.0 66 55.0 67 44.5 68 35.5 69 30.5 70 28.5 71 30.5 72 31.0 73 23.5 74 19.0 75 16.0 76 8.0 77 4.5 78 4.5 79 4.0 80 2.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4526024641689716 0.8999999999999999 3 0.025144581342720643 0.075 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.025 64-65 0.15 0.0 0.0 0.0 0.025 66-67 0.15 0.0 0.0 0.0 0.025 68-69 0.23750000000000002 0.0 0.0 0.0 0.025 70-71 0.35 0.0 0.0 0.0 0.025 72-73 0.5125 0.0 0.0 0.0 0.025 74-75 0.625 0.0 0.0 0.0 0.025 76-77 0.7124999999999999 0.0 0.0 0.0 0.025 78-79 0.85 0.0 0.0 0.0 0.025 80-81 0.975 0.0 0.0 0.0 0.025 82-83 1.1375 0.0 0.0 0.0 0.025 84-85 1.4125 0.0 0.0 0.0 0.025 86-87 1.8875 0.0 0.0 0.0 0.025 88-89 2.425 0.0 0.0 0.0 0.025 90-91 2.9875 0.0 0.0 0.0 0.025 92-93 3.625 0.0 0.0 0.0 0.025 94-95 4.425000000000001 0.0 0.0 0.0 0.025 96-97 5.324999999999999 0.0 0.0 0.0 0.025 98-99 6.5 0.0 0.0 0.0 0.025 100-101 7.9125 0.0 0.0 0.0 0.025 102-103 9.6375 0.0 0.0 0.0 0.025 104-105 11.25 0.0 0.0 0.0 0.025 106-107 12.95 0.0 0.0 0.0 0.025 108-109 14.662500000000001 0.0 0.0 0.0 0.025 110-111 16.7125 0.0 0.0 0.0 0.025 112-113 18.95 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3691901 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691901_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87075 33.0 33.0 34.0 32.0 34.0 2 33.0725 34.0 33.0 34.0 32.0 34.0 3 33.08725 34.0 33.0 34.0 33.0 34.0 4 32.929 34.0 33.0 34.0 32.0 34.0 5 33.03125 34.0 33.0 34.0 32.0 34.0 6 37.16175 38.0 38.0 38.0 37.0 38.0 7 37.166 38.0 38.0 38.0 37.0 38.0 8 37.291 38.0 38.0 38.0 37.0 38.0 9 37.206 38.0 38.0 38.0 37.0 38.0 10-11 37.2025 38.0 38.0 38.0 37.0 38.0 12-13 37.0965 38.0 38.0 38.0 37.0 38.0 14-15 37.1205 38.0 38.0 38.0 37.0 38.0 16-17 37.108374999999995 38.0 38.0 38.0 37.0 38.0 18-19 37.1685 38.0 38.0 38.0 37.0 38.0 20-21 37.186499999999995 38.0 38.0 38.0 37.0 38.0 22-23 37.177499999999995 38.0 38.0 38.0 37.0 38.0 24-25 37.113375 38.0 38.0 38.0 37.0 38.0 26-27 37.129625000000004 38.0 38.0 38.0 37.0 38.0 28-29 37.21875 38.0 38.0 38.0 37.0 38.0 30-31 37.255375 38.0 38.0 38.0 37.0 38.0 32-33 37.221625 38.0 38.0 38.0 37.0 38.0 34-35 37.172375 38.0 38.0 38.0 37.0 38.0 36-37 37.060625 38.0 38.0 38.0 36.5 38.0 38-39 37.11775 38.0 38.0 38.0 37.0 38.0 40-41 37.197374999999994 38.0 38.0 38.0 37.0 38.0 42-43 37.16675 38.0 38.0 38.0 37.0 38.0 44-45 37.202375 38.0 38.0 38.0 37.0 38.0 46-47 37.15625 38.0 38.0 38.0 37.0 38.0 48-49 37.11425 38.0 38.0 38.0 37.0 38.0 50-51 37.158249999999995 38.0 38.0 38.0 37.0 38.0 52-53 37.131 38.0 38.0 38.0 37.0 38.0 54-55 37.107124999999996 38.0 38.0 38.0 36.5 38.0 56-57 37.09825 38.0 38.0 38.0 36.5 38.0 58-59 37.058 38.0 38.0 38.0 36.0 38.0 60-61 37.080625 38.0 38.0 38.0 36.5 38.0 62-63 37.09175 38.0 38.0 38.0 36.5 38.0 64-65 37.07425 38.0 38.0 38.0 36.0 38.0 66-67 37.024625 38.0 38.0 38.0 36.0 38.0 68-69 37.0255 38.0 38.0 38.0 36.0 38.0 70-71 36.961375000000004 38.0 38.0 38.0 36.0 38.0 72-73 37.0295 38.0 38.0 38.0 36.0 38.0 74-75 36.916375 38.0 38.0 38.0 36.0 38.0 76-77 37.012125 38.0 38.0 38.0 36.0 38.0 78-79 36.91675 38.0 38.0 38.0 36.0 38.0 80-81 36.920125 38.0 38.0 38.0 36.0 38.0 82-83 36.816625 38.0 38.0 38.0 36.0 38.0 84-85 36.70975 38.0 38.0 38.0 35.0 38.0 86-87 36.717 38.0 38.0 38.0 35.0 38.0 88-89 36.741375000000005 38.0 38.0 38.0 35.0 38.0 90-91 36.733625 38.0 38.0 38.0 35.0 38.0 92-93 36.733875 38.0 38.0 38.0 35.0 38.0 94-95 36.589749999999995 38.0 38.0 38.0 34.5 38.0 96-97 36.65475 38.0 38.0 38.0 34.5 38.0 98-99 36.5595 38.0 38.0 38.0 34.5 38.0 100-101 36.524 38.0 38.0 38.0 34.0 38.0 102-103 36.50275 38.0 38.0 38.0 34.0 38.0 104-105 36.573 38.0 38.0 38.0 34.0 38.0 106-107 36.43875 38.0 38.0 38.0 34.0 38.0 108-109 36.377375 38.0 38.0 38.0 34.0 38.0 110-111 36.31275 38.0 38.0 38.0 33.5 38.0 112-113 36.133250000000004 38.0 38.0 38.0 33.5 38.0 114-115 36.105125 38.0 38.0 38.0 33.0 38.0 116-117 36.12025 38.0 38.0 38.0 32.5 38.0 118-119 35.694875 38.0 37.5 38.0 31.0 38.0 120-121 35.516625000000005 38.0 37.0 38.0 31.0 38.0 122-123 35.40575 38.0 36.5 38.0 31.0 38.0 124-125 35.253 38.0 36.0 38.0 29.5 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 3.0 16 1.0 17 5.0 18 3.0 19 7.0 20 5.0 21 1.0 22 4.0 23 7.0 24 11.0 25 11.0 26 14.0 27 17.0 28 21.0 29 28.0 30 32.0 31 45.0 32 68.0 33 63.0 34 122.0 35 161.0 36 333.0 37 3036.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.05012531328321 17.74436090225564 12.581453634085213 29.624060150375943 2 30.415207603801903 21.38569284642321 29.389694847423716 18.809404702351177 3 24.668501376032022 25.193895421566175 26.46985238929197 23.667750813109834 4 28.61430715357679 30.84042021010505 20.36018009004502 20.185092546273136 5 28.32124093069802 31.023267450587944 19.46459844883663 21.19089316987741 6 23.08654327163582 34.4672336168084 19.70985492746373 22.736368184092047 7 22.886443221610804 18.48424212106053 34.54227113556778 24.087043521760883 8 22.436218109054526 22.836418209104554 24.862431215607803 29.864932466233117 9 24.137068534267133 22.786393196598297 27.388694347173587 25.68784392196098 10-11 26.713356678339167 27.01350675337669 22.18609304652326 24.087043521760883 12-13 26.76338169084542 23.836918459229615 23.36168084042021 26.038019009504755 14-15 24.859251845364692 25.659952458401104 25.071937945702487 24.408857750531716 16-17 26.21043412986363 24.75916426873514 24.271237332666082 24.75916426873514 18-19 25.72536268134067 24.96248124062031 24.949974987493746 24.362181090545274 20-21 26.100550275137568 24.949974987493746 24.987493746873437 23.961980990495245 22-23 25.350175087543768 25.237618809404704 24.79989994997499 24.61230615307654 24-25 25.950475237618807 24.974987493746873 24.437218609304654 24.637318659329665 26-27 26.113056528264135 25.125062531265634 25.03751875937969 23.724362181090545 28-29 26.18809404702351 24.449724862431214 25.325162581290645 24.037018509254626 30-31 26.375687843921963 25.175087543771884 24.749874937468736 23.699349674837418 32-33 25.175087543771884 25.325162581290645 25.962981490745374 23.536768384192097 34-35 25.962981490745374 25.325162581290645 25.437718859429715 23.274137068534266 36-37 25.447042640990368 25.02188320620233 25.647117669125922 23.88395648368138 38-39 25.475237618809405 25.0 25.78789394697349 23.736868434217108 40-41 26.313156578289142 25.012506253126567 25.512756378189096 23.1615807903952 42-43 25.125062531265634 25.11255627813907 25.72536268134067 24.037018509254626 44-45 25.962981490745374 25.76288144072036 24.437218609304654 23.836918459229615 46-47 26.32566283141571 25.57528764382191 24.387193596798397 23.71185592796398 48-49 25.56278139069535 25.512756378189096 24.937468734367183 23.986993496748372 50-51 25.50343964978111 24.552845528455283 25.57848655409631 24.36522826766729 52-53 24.940587867417136 24.953095684803 25.453408380237647 24.652908067542214 54-55 26.21310655327664 23.974487243621812 26.013006503251624 23.799399699849925 56-57 25.6128064032016 25.337668834417208 25.82541270635318 23.224112056028016 58-59 25.337668834417208 24.69984992496248 25.437718859429715 24.524762381190595 60-61 25.162581290645324 25.850425212606304 24.83741870935468 24.149574787393696 62-63 25.337668834417208 25.062531265632813 25.250125062531264 24.349674837418707 64-65 25.887943971985994 24.337168584292147 26.050525262631314 23.724362181090545 66-67 25.900450225112557 25.83791895947974 25.26263131565783 22.998999499749875 68-69 25.54708015505815 25.82218331874453 25.146930098787045 23.48380642741028 70-71 26.20060030015007 24.537268634317158 25.287643821910955 23.974487243621812 72-73 26.413206603301653 23.949474737368686 25.80040020010005 23.836918459229615 74-75 25.350175087543768 24.712356178089045 25.850425212606304 24.087043521760883 76-77 25.3751875937969 25.07503751875938 25.162581290645324 24.387193596798397 78-79 24.937468734367183 26.21310655327664 25.175087543771884 23.67433716858429 80-81 26.275637818909452 25.07503751875938 25.812906453226613 22.836418209104554 82-83 25.29080675422139 25.64102564102564 26.07879924953096 22.989368355222016 84-85 25.31582238899312 25.165728580362728 25.22826766729206 24.290181363352094 86-87 26.604127579737337 24.840525328330205 25.515947467166978 23.039399624765476 88-89 25.634930564243714 24.859251845364692 25.910171399974978 23.595646190416613 90-91 25.431573680260193 26.207155366524894 24.418313735301474 23.942957217913435 92-93 25.775387693846923 25.82541270635318 24.912456228114056 23.486743371685844 94-95 26.504065040650403 25.515947467166978 24.80300187617261 23.176985616010008 96-97 26.685850118854 26.298010759414485 24.74665332165645 22.269485800075064 98-99 26.901901901901905 26.2012012012012 24.21171171171171 22.685185185185187 100-101 26.488988988988986 25.8008008008008 25.487987987987985 22.22222222222222 102-103 26.5015015015015 26.401401401401404 25.037537537537535 22.05955955955956 104-105 26.539039039039036 26.789289289289293 24.624624624624623 22.047047047047048 106-107 27.40462789243277 26.46654158849281 24.515322076297686 21.613508442776734 108-109 27.483112334250688 26.144608456342254 24.818613960470355 21.553665248936703 110-111 27.558168626469854 26.582436827620715 23.53014761070803 22.329246935201404 112-113 29.154154154154156 27.114614614614613 22.6976976976977 21.033533533533532 114-115 29.07907907907908 26.488988988988986 23.185685685685687 21.246246246246248 116-117 28.324784186162894 27.036156637057424 23.433003878393592 21.206055298386087 118-119 29.176086410449635 26.890228585782467 23.109771414217533 20.823913589550365 120-121 30.826217980914112 27.95077850326469 22.714716223003517 18.50828729281768 122-123 31.006778809942254 27.54205372834547 22.294752698970623 19.15641476274165 124-125 31.4665996986439 27.749874434957306 21.772978402812658 19.01054746358614 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.5 22 2.0 23 2.5 24 1.0 25 0.5 26 1.0 27 2.5 28 4.5 29 5.0 30 7.5 31 8.5 32 12.5 33 19.0 34 30.5 35 54.0 36 58.5 37 60.0 38 84.0 39 106.0 40 127.0 41 140.0 42 146.5 43 167.5 44 176.0 45 185.0 46 196.0 47 193.5 48 189.0 49 171.5 50 150.0 51 141.0 52 133.5 53 120.5 54 107.5 55 97.0 56 92.0 57 87.0 58 87.5 59 86.0 60 76.5 61 66.5 62 58.5 63 58.5 64 57.0 65 53.0 66 49.5 67 45.0 68 46.5 69 39.5 70 36.5 71 35.0 72 25.5 73 21.5 74 19.5 75 16.0 76 12.0 77 7.0 78 5.0 79 4.0 80 1.0 81 2.5 82 2.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.05 3 0.075 4 0.05 5 0.075 6 0.05 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.08750000000000001 16-17 0.08750000000000001 18-19 0.05 20-21 0.05 22-23 0.05 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.0375 38-39 0.05 40-41 0.05 42-43 0.05 44-45 0.05 46-47 0.05 48-49 0.05 50-51 0.0625 52-53 0.0625 54-55 0.05 56-57 0.05 58-59 0.05 60-61 0.05 62-63 0.05 64-65 0.05 66-67 0.05 68-69 0.0375 70-71 0.05 72-73 0.05 74-75 0.05 76-77 0.05 78-79 0.05 80-81 0.05 82-83 0.0625 84-85 0.0625 86-87 0.0625 88-89 0.08750000000000001 90-91 0.075 92-93 0.05 94-95 0.0625 96-97 0.08750000000000001 98-99 0.1 100-101 0.1 102-103 0.1 104-105 0.1 106-107 0.0625 108-109 0.075 110-111 0.075 112-113 0.1 114-115 0.1 116-117 0.08750000000000001 118-119 0.475 120-121 0.44999999999999996 122-123 0.42500000000000004 124-125 0.44999999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.4524886877828055 0.8999999999999999 3 0.050276520864756154 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.2125 0.0 0.0 0.0 0.0 70-71 0.325 0.0 0.0 0.0 0.0 72-73 0.475 0.0 0.0 0.0 0.0 74-75 0.575 0.0 0.0 0.0 0.0 76-77 0.6625000000000001 0.0 0.0 0.0 0.0 78-79 0.775 0.0 0.0 0.0 0.0 80-81 0.8999999999999999 0.0 0.0 0.0 0.0 82-83 1.075 0.0 0.0 0.0 0.0 84-85 1.375 0.0 0.0 0.0 0.0 86-87 1.9125 0.0 0.0 0.0 0.0 88-89 2.4625 0.0 0.0 0.0 0.0 90-91 3.0625 0.0 0.0 0.0 0.0 92-93 3.7 0.0 0.0 0.0 0.0 94-95 4.525 0.0 0.0 0.0 0.0 96-97 5.4625 0.0 0.0 0.0 0.0 98-99 6.637499999999999 0.0 0.0 0.0 0.0 100-101 8.0375 0.0 0.0 0.0 0.0 102-103 9.725 0.0 0.0 0.0 0.0 104-105 11.2875 0.0 0.0 0.0 0.0 106-107 12.975 0.0 0.0 0.0 0.0 108-109 14.6375 0.0 0.0 0.0 0.0 110-111 16.625 0.0 0.0 0.0 0.0 112-113 18.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTTAT 15 0.0040706866 59.544304 78-79 AGATCGG 115 0.002420847 15.732442 118-119 >>END_MODULE Read 1159452 spots for SRR3691901.sra Written 1159452 spots for SRR3691901.sra Read 1159452 spots for SRR3691901.sra Written 1159452 spots for SRR3691901.sra Read 1159452 spots for SRR3691901.sra Written 1159452 spots for SRR3691901.sra Read 1159471 spots for SRR3691901.sra Written 1159471 spots for SRR3691901.sra Read 1159452 spots for SRR3691901.sra Written 1159452 spots for SRR3691901.sra Read 1159452 spots for SRR3691901.sra Written 1159452 spots for SRR3691901.sra Read 1159452 spots for SRR3691901.sra Written 1159452 spots for SRR3691901.sra Read 1159452 spots for SRR3691901.sra Written 1159452 spots for SRR3691901.sra Read 1159452 spots for SRR3691901.sra Written 1159452 spots for SRR3691901.sra Read 1159452 spots for SRR3691901.sra Written 1159452 spots for SRR3691901.sra Read 1159452 spots for SRR3691901.sra Written 1159452 spots for SRR3691901.sra Read 1159452 spots for SRR3691901.sra Written 1159452 spots for SRR3691901.sra Read 1159452 spots for SRR3691901.sra Written 1159452 spots for SRR3691901.sra Read 1159452 spots for SRR3691901.sra Written 1159452 spots for SRR3691901.sra Read 1159452 spots for SRR3691901.sra Written 1159452 spots for SRR3691901.sra Read 1159452 spots for SRR3691901.sra Written 1159452 spots for SRR3691901.sra Read 1159452 spots for SRR3691901.sra Written 1159452 spots for SRR3691901.sra Read 1159452 spots for SRR3691901.sra Written 1159452 spots for SRR3691901.sra Read 1159452 spots for SRR3691901.sra Written 1159452 spots for SRR3691901.sra Read 1159452 spots for SRR3691901.sra Written 1159452 spots for SRR3691901.sra SRR ids: ['SRR3691901.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zgxtpgir SRR3691901.sra spots: 23189059 blocks: [[1, 1159452], [1159453, 2318904], [2318905, 3478356], [3478357, 4637808], [4637809, 5797260], [5797261, 6956712], [6956713, 8116164], [8116165, 9275616], [9275617, 10435068], [10435069, 11594520], [11594521, 12753972], [12753973, 13913424], [13913425, 15072876], [15072877, 16232328], [16232329, 17391780], [17391781, 18551232], [18551233, 19710684], [19710685, 20870136], [20870137, 22029588], [22029589, 23189059]] SRR3691901 file size 7382583 SRR3691901 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3691901 SRR3691901_1.fastq SRR3691901_2.fastq Input file: SRR3691901_1.fastq Paired file: SRR3691901_2.fastq trimmed: SRR3691901-trimmed-pair1.fastq, SRR3691901-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:53:16 2024 >> started Mon Dec 9 23:54:23 2024 >> done (66.787s) 23189059 read pairs processed; of these: 259 ( 0.00%) short read pairs filtered out after trimming by size control 10207 ( 0.04%) empty read pairs filtered out after trimming by size control 23178593 (99.95%) read pairs available; of these: 8697738 (37.52%) trimmed read pairs available after processing 14480855 (62.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 2 0.00% 21 7 0.00% 22 5 0.00% 23 5 0.00% 24 4 0.00% 25 5 0.00% 26 12 0.00% 27 20 0.00% 28 25 0.00% 29 31 0.00% 30 46 0.00% 31 56 0.00% 32 68 0.00% 33 77 0.00% 34 77 0.00% 35 77 0.00% 36 129 0.00% 37 147 0.00% 38 179 0.00% 39 232 0.00% 40 244 0.00% 41 307 0.00% 42 386 0.00% 43 387 0.00% 44 446 0.00% 45 451 0.00% 46 547 0.00% 47 634 0.00% 48 866 0.00% 49 948 0.00% 50 1124 0.00% 51 1295 0.01% 52 1452 0.01% 53 1503 0.01% 54 1590 0.01% 55 1724 0.01% 56 2042 0.01% 57 2250 0.01% 58 2515 0.01% 59 2965 0.01% 60 3514 0.02% 61 4041 0.02% 62 4527 0.02% 63 5022 0.02% 64 5390 0.02% 65 5899 0.03% 66 6463 0.03% 67 7207 0.03% 68 8041 0.03% 69 9047 0.04% 70 10448 0.05% 71 12036 0.05% 72 13690 0.06% 73 15709 0.07% 74 17549 0.08% 75 19007 0.08% 76 20797 0.09% 77 22483 0.10% 78 24485 0.11% 79 27259 0.12% 80 30547 0.13% 81 34485 0.15% 82 39386 0.17% 83 44235 0.19% 84 49738 0.21% 85 54884 0.24% 86 58753 0.25% 87 63773 0.28% 88 69298 0.30% 89 74413 0.32% 90 81189 0.35% 91 88458 0.38% 92 96725 0.42% 93 107227 0.46% 94 117605 0.51% 95 127422 0.55% 96 135576 0.58% 97 144511 0.62% 98 150101 0.65% 99 156741 0.68% 100 167730 0.72% 101 176325 0.76% 102 188190 0.81% 103 201801 0.87% 104 212123 0.92% 105 225335 0.97% 106 234699 1.01% 107 240311 1.04% 108 246650 1.06% 109 255975 1.10% 110 260958 1.13% 111 266849 1.15% 112 275931 1.19% 113 286145 1.23% 114 295277 1.27% 115 305812 1.32% 116 312179 1.35% 117 312968 1.35% 118 314151 1.36% 119 311368 1.34% 120 313273 1.35% 121 340258 1.47% 122 314425 1.36% 123 321537 1.39% 124 324894 1.40% 125 14480855 62.48% 23178593 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=30 prefix-density=0.23 prefix-fanout=2.2 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=8 fanout-score=197.63 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=23.3 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=8.68 fanout-score-rank=16 prefix-density=0.32 prefix-fanout=5.5 sequence=AAGGAGCTGGAGGAGGTGAAGAAGGAGTACCCTGACGCCTATGTCCGCATCATCGGCTTCGACAACACCAGGCAAGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGGCAAGGCCTAAGCAAGTTGATTTCTTATAATACAAGAACGGGTCACACCGATTTTATGTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATCTCTCCCAACAACCCGGATTAACTGTATTCATGAGTACTACTATTATAAGAGTACTACAACTATCGTTGGGAGAGGGGCATGTAATATAAACTCCGGTTATACATATTAAGATAAGTATATTTTGTAAAAGAATATCAAATTCGTCGACAAATTCTGATTATGAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=200.86 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=22.5 sequence=CAAGAAGAAGGT SRR3691901 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:55:10 Started mapping on | Dec 09 23:55:10 Finished on | Dec 09 23:56:55 Mapping speed, Million of reads per hour | 794.69 Number of input reads | 23178593 Average input read length | 237 UNIQUE READS: Uniquely mapped reads number | 21786508 Uniquely mapped reads % | 93.99% Average mapped length | 236.60 Number of splices: Total | 15690143 Number of splices: Annotated (sjdb) | 14749207 Number of splices: GT/AG | 15465199 Number of splices: GC/AG | 191714 Number of splices: AT/AC | 7861 Number of splices: Non-canonical | 25369 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.02 Insertion rate per base | 0.01% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 428198 % of reads mapped to multiple loci | 1.85% Number of reads mapped to too many loci | 66757 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.83% % of reads unmapped: other | 1.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 964191 964191 964191 N_multimapping 428198 428198 428198 N_noFeature 963839 21132344 1191770 N_ambiguous 482067 2045 55857 UnstrandedReadsAssigned:20340602 PositiveStrandReadsAssigned:652119 NegativeStrandReadsAssigned:20538881 Dataset is classified negative stranded MeadianReadLen=125 20thPercentileLength=111 echo kmer=107 SRR3691901 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3691901-trimmed-pair1.fastq SRR3691901-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,178,593 reads, 20,787,417 reads pseudoaligned [quant] estimated average fragment length: 139.166 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52973 SRR3691901.ke.tsv 35125 SRR3691901.se.tsv 88098 total ==> SRR3691901.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 797.998 0 0 PNS24247 1044 905.834 74.3377 5.99513 PNS24249 1928 1789.83 150.854 6.15716 PNS24246 1044 905.834 74.3377 5.99513 PNS24248 1044 905.834 74.3377 5.99513 PNS24244 1471 1332.83 150.133 8.22884 PNS24243 293 156.475 0 0 KQK14069 1603 1464.83 42672.4 2128.12 KQK14071 474 336.796 2766.78 600.13 ==> SRR3691901.se.tsv <== BRADI_1g14170v3 50247 BRADI_1g53295v3 41 BRADI_1g59795v3 1391 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 195 BRADI_1g74790v3 223 BRADI_1g09890v3 0 BRADI_1g77505v3 373 BRADI_1g48960v3 0 SRR3691901 completed mapping pipeline successfully