Starting /dee2/code/volunteer_pipeline.sh SRR3691902 current disk space = 1523461365760 free memory = 1565157948 SRR3691902 SRAfilesize b85c6fe5c55629804c5e80725624cb70 SRR3691902.sra SRR3691902.sra file validated SRR3691902 is paired end SRR3691902 is conventional basespace SRR3691902 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691902_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82725 33.0 33.0 34.0 32.0 34.0 2 32.966 34.0 33.0 34.0 32.0 34.0 3 32.975 34.0 33.0 34.0 32.0 34.0 4 32.8005 34.0 33.0 34.0 32.0 34.0 5 32.9005 34.0 33.0 34.0 32.0 34.0 6 36.973 38.0 38.0 38.0 36.0 38.0 7 36.985 38.0 38.0 38.0 36.0 38.0 8 37.0535 38.0 38.0 38.0 36.0 38.0 9 37.006 38.0 38.0 38.0 37.0 38.0 10-11 37.000625 38.0 38.0 38.0 36.5 38.0 12-13 36.952 38.0 38.0 38.0 36.5 38.0 14-15 36.942625 38.0 38.0 38.0 36.5 38.0 16-17 36.97 38.0 38.0 38.0 36.0 38.0 18-19 37.02675 38.0 38.0 38.0 36.5 38.0 20-21 36.994749999999996 38.0 38.0 38.0 36.5 38.0 22-23 36.903375 38.0 38.0 38.0 36.0 38.0 24-25 36.98775 38.0 38.0 38.0 36.0 38.0 26-27 36.961375000000004 38.0 38.0 38.0 36.0 38.0 28-29 37.040625 38.0 38.0 38.0 36.5 38.0 30-31 36.94075 38.0 38.0 38.0 36.0 38.0 32-33 36.999624999999995 38.0 38.0 38.0 37.0 38.0 34-35 37.036500000000004 38.0 38.0 38.0 37.0 38.0 36-37 36.982375000000005 38.0 38.0 38.0 36.0 38.0 38-39 36.904125 38.0 38.0 38.0 36.0 38.0 40-41 36.982749999999996 38.0 38.0 38.0 36.0 38.0 42-43 37.037375 38.0 38.0 38.0 37.0 38.0 44-45 36.958875 38.0 38.0 38.0 36.0 38.0 46-47 36.963625 38.0 38.0 38.0 36.0 38.0 48-49 36.922375 38.0 38.0 38.0 36.0 38.0 50-51 36.960875 38.0 38.0 38.0 36.0 38.0 52-53 36.870999999999995 38.0 38.0 38.0 36.0 38.0 54-55 36.948875 38.0 38.0 38.0 36.0 38.0 56-57 36.898125 38.0 38.0 38.0 36.0 38.0 58-59 36.902 38.0 38.0 38.0 36.0 38.0 60-61 36.847750000000005 38.0 38.0 38.0 36.0 38.0 62-63 36.897125 38.0 38.0 38.0 36.0 38.0 64-65 36.795375 38.0 38.0 38.0 36.0 38.0 66-67 36.78975 38.0 38.0 38.0 35.5 38.0 68-69 36.751875 38.0 38.0 38.0 35.0 38.0 70-71 36.803375 38.0 38.0 38.0 35.5 38.0 72-73 36.801375 38.0 38.0 38.0 35.5 38.0 74-75 36.752875 38.0 38.0 38.0 35.5 38.0 76-77 36.700625 38.0 38.0 38.0 35.0 38.0 78-79 36.728 38.0 38.0 38.0 35.0 38.0 80-81 36.632000000000005 38.0 38.0 38.0 35.0 38.0 82-83 36.655125 38.0 38.0 38.0 35.0 38.0 84-85 36.474125 38.0 38.0 38.0 34.0 38.0 86-87 36.59925 38.0 38.0 38.0 35.0 38.0 88-89 36.617625000000004 38.0 38.0 38.0 35.0 38.0 90-91 36.5295 38.0 38.0 38.0 34.0 38.0 92-93 36.492000000000004 38.0 38.0 38.0 34.0 38.0 94-95 36.469750000000005 38.0 38.0 38.0 34.0 38.0 96-97 36.40075 38.0 38.0 38.0 34.0 38.0 98-99 36.244249999999994 38.0 38.0 38.0 33.5 38.0 100-101 36.304375 38.0 38.0 38.0 34.0 38.0 102-103 36.16775 38.0 38.0 38.0 34.0 38.0 104-105 36.297 38.0 38.0 38.0 34.0 38.0 106-107 36.26875 38.0 38.0 38.0 34.0 38.0 108-109 36.156625000000005 38.0 38.0 38.0 33.0 38.0 110-111 36.14875000000001 38.0 38.0 38.0 33.5 38.0 112-113 36.016375 38.0 38.0 38.0 33.0 38.0 114-115 36.007999999999996 38.0 38.0 38.0 33.0 38.0 116-117 35.801625 38.0 37.5 38.0 31.5 38.0 118-119 35.602875 38.0 37.5 38.0 31.0 38.0 120-121 35.391 38.0 36.0 38.0 31.0 38.0 122-123 35.41475 38.0 36.5 38.0 31.0 38.0 124-125 35.274 38.0 36.0 38.0 30.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 6.0 17 11.0 18 9.0 19 6.0 20 6.0 21 4.0 22 3.0 23 10.0 24 19.0 25 17.0 26 14.0 27 15.0 28 19.0 29 37.0 30 41.0 31 48.0 32 62.0 33 76.0 34 109.0 35 149.0 36 371.0 37 2963.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.54964894684052 20.511534603811434 8.976930792377132 28.961885656970914 2 31.406406406406408 20.995995995995994 26.676676676676674 20.92092092092092 3 23.64864864864865 23.623623623623622 28.678678678678676 24.04904904904905 4 27.152152152152155 31.006006006006004 19.96996996996997 21.871871871871875 5 28.72872872872873 31.83183183183183 17.26726726726727 22.17217217217217 6 24.44944944944945 32.907907907907905 18.243243243243242 24.3993993993994 7 23.473473473473476 17.792792792792792 33.033033033033036 25.7007007007007 8 24.0990990990991 22.097097097097095 21.696696696696698 32.107107107107105 9 23.923923923923923 21.146146146146148 25.925925925925924 29.004004004004003 10-11 28.653653653653656 25.5005005005005 19.644644644644647 26.2012012012012 12-13 27.37737737737738 21.483983983983983 23.185685685685687 27.952952952952952 14-15 27.681141283944438 23.06344637717432 22.950819672131146 26.304592666750093 16-17 27.62202753441802 23.454317897371716 22.490613266583228 26.433041301627036 18-19 26.851851851851855 24.036536536536538 22.384884884884883 26.726726726726728 20-21 26.851851851851855 23.46096096096096 23.385885885885884 26.3013013013013 22-23 26.876876876876878 23.04804804804805 22.785285285285287 27.289789789789793 24-25 27.37737737737738 23.66116116116116 22.6976976976977 26.263763763763766 26-27 26.18868868868869 23.2982982982983 23.385885885885884 27.127127127127125 28-29 26.7017017017017 23.81131131131131 23.61111111111111 25.875875875875877 30-31 27.039539539539543 23.573573573573572 22.64764764764765 26.739239239239236 32-33 27.289789789789793 23.34834834834835 23.235735735735734 26.126126126126124 34-35 26.726726726726728 22.134634634634633 23.723723723723726 27.414914914914917 36-37 27.45245245245245 23.2982982982983 22.74774774774775 26.5015015015015 38-39 27.952952952952952 23.04804804804805 22.972972972972975 26.026026026026027 40-41 27.264764764764767 23.123123123123122 23.34834834834835 26.263763763763766 42-43 27.177177177177175 24.436936936936938 23.073073073073072 25.312812812812812 44-45 28.09059059059059 23.473473473473476 23.085585585585587 25.350350350350347 46-47 26.664164164164166 22.972972972972975 23.435935935935937 26.926926926926924 48-49 27.33983983983984 23.536036036036037 22.91041041041041 26.213713713713716 50-51 27.43085971718183 23.35127017895132 23.889375547490925 25.328494556375926 52-53 26.914414414414416 23.773773773773772 22.835335335335337 26.476476476476474 54-55 26.476476476476474 23.686186186186188 23.473473473473476 26.363863863863862 56-57 27.32732732732733 23.06056056056056 23.173173173173172 26.43893893893894 58-59 28.003003003003002 23.473473473473476 23.04804804804805 25.475475475475474 60-61 27.25225225225225 23.2982982982983 23.986486486486484 25.462962962962965 62-63 27.352352352352355 23.21071071071071 24.14914914914915 25.287787787787785 64-65 26.401401401401404 24.074074074074073 22.972972972972975 26.55155155155155 66-67 26.213713713713716 23.26076076076076 24.2992992992993 26.226226226226224 68-69 27.064564564564563 22.922922922922922 23.973973973973976 26.038538538538536 70-71 27.45245245245245 23.46096096096096 23.16066066066066 25.925925925925924 72-73 26.226226226226224 24.186686686686688 23.435935935935937 26.151151151151154 74-75 26.93943943943944 22.96046046046046 23.836336336336338 26.263763763763766 76-77 27.489989989989986 23.34834834834835 24.136636636636634 25.025025025025027 78-79 26.95195195195195 23.235735735735734 23.673673673673672 26.13863863863864 80-81 26.83933933933934 24.06156156156156 23.61111111111111 25.487987987987985 82-83 27.214714714714717 23.5985985985986 23.185685685685687 26.001001001001 84-85 26.539039039039036 24.11161161161161 23.435935935935937 25.913413413413412 86-87 26.714214214214216 24.16166166166166 23.573573573573572 25.55055055055055 88-89 26.583229036295368 23.00375469336671 24.30538172715895 26.107634543178975 90-91 27.064564564564563 24.2992992992993 23.035535535535537 25.600600600600597 92-93 27.239739739739736 24.5995995995996 23.36086086086086 24.7997997997998 94-95 28.64114114114114 24.374374374374376 22.685185185185187 24.2992992992993 96-97 27.575416197271245 24.55876830642133 23.269495556390034 24.596319939917386 98-99 27.366049073610416 24.57436154231347 23.773159739609415 24.2864296444667 100-101 27.904356534802204 24.59939909864797 22.646469704556836 24.849774661992992 102-103 27.72909364046069 23.773159739609415 24.54932398597897 23.948422633950926 104-105 28.71088861076345 24.6558197747184 22.302878598247812 24.330413016270338 106-107 28.24427480916031 24.427480916030532 23.251157552246276 24.077086722562882 108-109 27.856338380678263 23.801776999124012 24.139657114253534 24.202227505944187 110-111 28.74483794268552 24.715304717807534 23.06344637717432 23.476410962332626 112-113 29.265239704593814 25.122042808862183 22.944048066090875 22.66866942045312 114-115 29.039929903617473 24.88421579672049 22.981599699586933 23.094254600075104 116-117 29.424280350438046 24.831038798498124 22.27784730913642 23.46683354192741 118-119 28.51577227598341 25.449289933391984 22.00578107326882 24.029156717355786 120-121 29.321608040201003 25.95477386934673 21.871859296482413 22.851758793969847 122-123 30.285140057781685 25.109910815224218 21.69325461625424 22.911694510739856 124-125 30.22613065326633 24.384422110552766 22.537688442211053 22.851758793969847 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 0.5 28 0.0 29 0.0 30 1.5 31 3.5 32 3.5 33 5.0 34 8.5 35 13.5 36 21.0 37 27.0 38 40.5 39 58.5 40 79.5 41 112.0 42 134.0 43 142.0 44 149.0 45 171.0 46 172.5 47 162.5 48 173.0 49 171.0 50 153.5 51 137.0 52 133.5 53 124.5 54 108.5 55 112.5 56 114.0 57 106.5 58 108.0 59 99.0 60 91.5 61 91.5 62 82.0 63 79.5 64 75.5 65 79.0 66 82.0 67 73.5 68 80.0 69 77.0 70 60.5 71 56.5 72 56.0 73 44.0 74 30.0 75 20.0 76 16.0 77 18.0 78 16.5 79 7.5 80 4.5 81 3.5 82 1.0 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.1 3 0.1 4 0.1 5 0.1 6 0.1 7 0.1 8 0.1 9 0.1 10-11 0.1 12-13 0.1 14-15 0.11249999999999999 16-17 0.125 18-19 0.1 20-21 0.1 22-23 0.1 24-25 0.1 26-27 0.1 28-29 0.1 30-31 0.1 32-33 0.1 34-35 0.1 36-37 0.1 38-39 0.1 40-41 0.1 42-43 0.1 44-45 0.1 46-47 0.1 48-49 0.1 50-51 0.11249999999999999 52-53 0.1 54-55 0.1 56-57 0.1 58-59 0.1 60-61 0.1 62-63 0.1 64-65 0.1 66-67 0.1 68-69 0.1 70-71 0.1 72-73 0.1 74-75 0.1 76-77 0.1 78-79 0.1 80-81 0.1 82-83 0.1 84-85 0.1 86-87 0.1 88-89 0.125 90-91 0.1 92-93 0.1 94-95 0.1 96-97 0.13749999999999998 98-99 0.15 100-101 0.15 102-103 0.15 104-105 0.125 106-107 0.11249999999999999 108-109 0.11249999999999999 110-111 0.11249999999999999 112-113 0.13749999999999998 114-115 0.13749999999999998 116-117 0.125 118-119 0.5375 120-121 0.5 122-123 0.4875 124-125 0.5 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57286432160805 99.075 2 0.37688442211055273 0.75 3 0.02512562814070352 0.075 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.3 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.42500000000000004 0.0 0.0 0.0 0.0 78-79 0.5125 0.0 0.0 0.0 0.0 80-81 0.5874999999999999 0.0 0.0 0.0 0.0 82-83 0.75 0.0 0.0 0.0 0.0 84-85 1.0375 0.0 0.0 0.0 0.0 86-87 1.275 0.0 0.0 0.0 0.0 88-89 1.525 0.0 0.0 0.0 0.0 90-91 1.7875 0.0 0.0 0.0 0.0 92-93 2.275 0.0 0.0 0.0 0.0 94-95 2.8625 0.0 0.0 0.0 0.0 96-97 3.4625000000000004 0.0 0.0 0.0 0.0 98-99 4.15 0.0 0.0 0.0 0.0 100-101 4.825 0.0 0.0 0.0 0.0 102-103 5.75 0.0 0.0 0.0 0.0 104-105 6.675000000000001 0.0 0.0 0.0 0.0 106-107 7.725 0.0 0.0 0.0 0.0 108-109 8.725 0.0 0.0 0.0 0.0 110-111 9.875 0.0 0.0 0.0 0.0 112-113 11.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 35 0.0026274757 34.0 112-113 >>END_MODULE SRR3691902 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691902_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72475 34.0 33.0 34.0 32.0 34.0 2 33.129 34.0 33.0 34.0 32.0 34.0 3 33.2005 34.0 33.0 34.0 32.0 34.0 4 33.13825 34.0 33.0 34.0 32.0 34.0 5 33.24225 34.0 33.0 34.0 32.0 34.0 6 36.82425 38.0 37.0 38.0 35.0 38.0 7 37.24975 38.0 38.0 38.0 36.0 38.0 8 37.291 38.0 38.0 38.0 37.0 38.0 9 37.3615 38.0 38.0 38.0 37.0 38.0 10-11 37.359750000000005 38.0 38.0 38.0 37.0 38.0 12-13 37.31975 38.0 38.0 38.0 37.0 38.0 14-15 37.3245 38.0 38.0 38.0 37.0 38.0 16-17 37.432500000000005 38.0 38.0 38.0 37.0 38.0 18-19 37.3215 38.0 38.0 38.0 37.0 38.0 20-21 37.309375 38.0 38.0 38.0 37.0 38.0 22-23 37.370000000000005 38.0 38.0 38.0 37.0 38.0 24-25 37.377624999999995 38.0 38.0 38.0 37.0 38.0 26-27 37.303 38.0 38.0 38.0 37.0 38.0 28-29 37.266125 38.0 38.0 38.0 37.0 38.0 30-31 37.2825 38.0 38.0 38.0 37.0 38.0 32-33 37.31575 38.0 38.0 38.0 37.0 38.0 34-35 37.324625 38.0 38.0 38.0 37.0 38.0 36-37 37.272125 38.0 38.0 38.0 37.0 38.0 38-39 37.238375 38.0 38.0 38.0 37.0 38.0 40-41 37.21975 38.0 38.0 38.0 37.0 38.0 42-43 37.193125 38.0 38.0 38.0 36.0 38.0 44-45 37.10375 38.0 38.0 38.0 36.0 38.0 46-47 37.118624999999994 38.0 38.0 38.0 36.0 38.0 48-49 37.088125000000005 38.0 38.0 38.0 36.0 38.0 50-51 37.170625 38.0 38.0 38.0 36.0 38.0 52-53 37.070875 38.0 38.0 38.0 36.0 38.0 54-55 37.080875 38.0 38.0 38.0 36.0 38.0 56-57 37.053875000000005 38.0 38.0 38.0 36.0 38.0 58-59 37.08225 38.0 38.0 38.0 36.0 38.0 60-61 37.060874999999996 38.0 38.0 38.0 36.0 38.0 62-63 37.03175 38.0 38.0 38.0 35.5 38.0 64-65 37.020375 38.0 38.0 38.0 36.0 38.0 66-67 37.017250000000004 38.0 38.0 38.0 36.0 38.0 68-69 36.98225 38.0 38.0 38.0 35.5 38.0 70-71 36.937375 38.0 38.0 38.0 35.0 38.0 72-73 36.981625 38.0 38.0 38.0 35.5 38.0 74-75 36.929500000000004 38.0 38.0 38.0 35.5 38.0 76-77 36.910125 38.0 38.0 38.0 35.5 38.0 78-79 36.920625 38.0 38.0 38.0 35.0 38.0 80-81 36.895875000000004 38.0 38.0 38.0 35.0 38.0 82-83 36.86825 38.0 38.0 38.0 35.0 38.0 84-85 36.859750000000005 38.0 38.0 38.0 35.0 38.0 86-87 36.77475 38.0 38.0 38.0 35.0 38.0 88-89 36.79625 38.0 38.0 38.0 35.0 38.0 90-91 36.517250000000004 38.0 38.0 38.0 34.0 38.0 92-93 36.682 38.0 38.0 38.0 34.5 38.0 94-95 36.630750000000006 38.0 38.0 38.0 34.5 38.0 96-97 36.641 38.0 38.0 38.0 34.0 38.0 98-99 36.705875 38.0 38.0 38.0 34.0 38.0 100-101 36.599875 38.0 38.0 38.0 34.0 38.0 102-103 36.637625 38.0 38.0 38.0 34.0 38.0 104-105 36.516375 38.0 38.0 38.0 34.0 38.0 106-107 36.460125000000005 38.0 38.0 38.0 34.0 38.0 108-109 36.430375 38.0 38.0 38.0 34.0 38.0 110-111 36.46325 38.0 38.0 38.0 34.0 38.0 112-113 36.414125 38.0 38.0 38.0 34.0 38.0 114-115 36.396125 38.0 38.0 38.0 34.0 38.0 116-117 36.16975 38.0 37.5 38.0 33.0 38.0 118-119 36.169 38.0 38.0 38.0 33.5 38.0 120-121 36.142875000000004 38.0 38.0 38.0 33.0 38.0 122-123 36.151125 38.0 38.0 38.0 33.0 38.0 124-125 36.034875 38.0 37.0 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 5.0 24 5.0 25 12.0 26 9.0 27 17.0 28 34.0 29 34.0 30 42.0 31 42.0 32 54.0 33 70.0 34 117.0 35 168.0 36 427.0 37 2963.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.20478249809209 14.627321292292036 7.275502416687865 32.89239379292801 2 27.35 14.575 31.025000000000002 27.05 3 22.85 22.525000000000002 24.425 30.2 4 27.325 26.55 22.425 23.7 5 25.4 32.375 20.95 21.275 6 23.724999999999998 33.525 20.7 22.05 7 19.625 21.4 38.625 20.349999999999998 8 22.7 21.45 25.775 30.075000000000003 9 20.875 20.849999999999998 30.425 27.85 10-11 26.0625 26.2625 21.75 25.924999999999997 12-13 24.4 22.55 24.5125 28.537499999999998 14-15 24.224999999999998 23.075000000000003 25.3125 27.3875 16-17 25.1 23.7 24.0 27.200000000000003 18-19 24.6625 25.2125 23.875 26.25 20-21 25.412499999999998 23.575 23.5625 27.450000000000003 22-23 24.2375 24.3 24.8625 26.6 24-25 25.3 25.137500000000003 22.4625 27.1 26-27 24.5125 24.325 24.2 26.9625 28-29 24.2 24.6125 24.2625 26.924999999999997 30-31 25.337500000000002 23.8875 23.5875 27.187499999999996 32-33 25.874999999999996 23.875 24.1875 26.0625 34-35 24.7875 24.462500000000002 24.025 26.724999999999998 36-37 24.6 25.5625 23.025000000000002 26.8125 38-39 24.9125 24.25 23.9 26.937499999999996 40-41 24.2875 25.124999999999996 23.75 26.8375 42-43 24.5375 24.0625 23.9125 27.487499999999997 44-45 25.4375 24.224999999999998 23.925 26.4125 46-47 25.162499999999998 24.462500000000002 23.7 26.674999999999997 48-49 25.112499999999997 23.7875 23.7875 27.3125 50-51 25.15 24.224999999999998 23.875 26.75 52-53 26.6125 24.0125 23.1625 26.2125 54-55 25.0 23.325000000000003 24.075 27.6 56-57 25.05 24.1875 23.549999999999997 27.212500000000002 58-59 24.975 23.4125 24.0625 27.55 60-61 25.587500000000002 24.025 23.7 26.687499999999996 62-63 25.650000000000002 23.5625 23.45 27.3375 64-65 25.95 24.125 23.5375 26.387500000000003 66-67 26.025 23.575 23.549999999999997 26.85 68-69 26.275 23.2625 23.549999999999997 26.9125 70-71 25.874999999999996 24.925 23.4625 25.7375 72-73 25.074999999999996 24.4375 23.3375 27.150000000000002 74-75 26.737499999999997 22.975 23.549999999999997 26.737499999999997 76-77 25.3125 25.137500000000003 22.975 26.575 78-79 26.474999999999998 23.6875 23.6125 26.224999999999998 80-81 26.337500000000002 24.7 22.662499999999998 26.3 82-83 25.387500000000003 24.0625 23.375 27.175 84-85 26.1125 23.6625 23.7875 26.437500000000004 86-87 25.374999999999996 23.9875 23.5625 27.075 88-89 25.5 24.275 23.8125 26.4125 90-91 25.937500000000004 23.65 23.400000000000002 27.0125 92-93 26.974999999999998 24.2 22.3375 26.487500000000004 94-95 26.0375 23.674999999999997 23.025000000000002 27.2625 96-97 26.174999999999997 24.05 22.05 27.725 98-99 26.525 23.3625 23.825 26.2875 100-101 26.4125 23.6625 23.25 26.674999999999997 102-103 26.5375 23.775 22.4625 27.224999999999998 104-105 26.3 23.95 22.9375 26.8125 106-107 25.874999999999996 23.8125 23.5 26.8125 108-109 26.0625 24.5125 21.975 27.450000000000003 110-111 26.025 24.55 22.9625 26.4625 112-113 26.275 25.324999999999996 21.85 26.55 114-115 25.45 25.112499999999997 22.3125 27.125 116-117 26.3 23.8875 22.85 26.9625 118-119 27.3 24.1625 21.8 26.737499999999997 120-121 26.5875 26.174999999999997 20.9875 26.25 122-123 26.087500000000002 24.9125 22.4375 26.5625 124-125 26.525 25.687500000000004 21.6875 26.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 1.0 28 1.5 29 1.5 30 2.0 31 4.5 32 4.5 33 5.5 34 10.5 35 20.0 36 30.5 37 39.5 38 56.5 39 76.0 40 86.5 41 116.5 42 141.0 43 153.0 44 172.0 45 171.5 46 180.5 47 193.0 48 180.5 49 158.5 50 152.0 51 145.5 52 133.0 53 122.5 54 108.0 55 104.5 56 99.5 57 86.0 58 83.5 59 90.5 60 96.0 61 83.5 62 78.0 63 86.5 64 76.5 65 67.5 66 73.5 67 71.5 68 68.5 69 61.0 70 54.5 71 52.5 72 44.0 73 34.5 74 25.0 75 24.0 76 22.5 77 18.0 78 11.5 79 6.0 80 5.0 81 4.0 82 1.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.21250000000000002 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.325 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.4875 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.75 0.0 0.0 0.0 0.0 84-85 1.0375 0.0 0.0 0.0 0.0 86-87 1.2875 0.0 0.0 0.0 0.0 88-89 1.5499999999999998 0.0 0.0 0.0 0.0 90-91 1.8125 0.0 0.0 0.0 0.0 92-93 2.2625 0.0 0.0 0.0 0.0 94-95 2.8 0.0 0.0 0.0 0.0 96-97 3.3625 0.0 0.0 0.0 0.0 98-99 4.05 0.0 0.0 0.0 0.0 100-101 4.7125 0.0 0.0 0.0 0.0 102-103 5.6875 0.0 0.0 0.0 0.0 104-105 6.6375 0.0 0.0 0.0 0.0 106-107 7.725 0.0 0.0 0.0 0.0 108-109 8.775 0.0 0.0 0.0 0.0 110-111 9.962499999999999 0.0 0.0 0.0 0.0 112-113 11.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1203520 spots for SRR3691902.sra Written 1203520 spots for SRR3691902.sra Read 1203520 spots for SRR3691902.sra Written 1203520 spots for SRR3691902.sra Read 1203520 spots for SRR3691902.sra Written 1203520 spots for SRR3691902.sra Read 1203520 spots for SRR3691902.sra Written 1203520 spots for SRR3691902.sra Read 1203520 spots for SRR3691902.sra Written 1203520 spots for SRR3691902.sra Read 1203520 spots for SRR3691902.sra Written 1203520 spots for SRR3691902.sra Read 1203520 spots for SRR3691902.sra Written 1203520 spots for SRR3691902.sra Read 1203520 spots for SRR3691902.sra Written 1203520 spots for SRR3691902.sra Read 1203520 spots for SRR3691902.sra Written 1203520 spots for SRR3691902.sra Read 1203520 spots for SRR3691902.sra Written 1203520 spots for SRR3691902.sra Read 1203520 spots for SRR3691902.sra Written 1203520 spots for SRR3691902.sra Read 1203520 spots for SRR3691902.sra Written 1203520 spots for SRR3691902.sra Read 1203520 spots for SRR3691902.sra Written 1203520 spots for SRR3691902.sra Read 1203520 spots for SRR3691902.sra Written 1203520 spots for SRR3691902.sra Read 1203520 spots for SRR3691902.sra Written 1203520 spots for SRR3691902.sra Read 1203520 spots for SRR3691902.sra Written 1203520 spots for SRR3691902.sra Read 1203520 spots for SRR3691902.sra Written 1203520 spots for SRR3691902.sra Read 1203524 spots for SRR3691902.sra Written 1203524 spots for SRR3691902.sra Read 1203520 spots for SRR3691902.sra Written 1203520 spots for SRR3691902.sra Read 1203520 spots for SRR3691902.sra Written 1203520 spots for SRR3691902.sra SRR ids: ['SRR3691902.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_84dws_6f SRR3691902.sra spots: 24070404 blocks: [[1, 1203520], [1203521, 2407040], [2407041, 3610560], [3610561, 4814080], [4814081, 6017600], [6017601, 7221120], [7221121, 8424640], [8424641, 9628160], [9628161, 10831680], [10831681, 12035200], [12035201, 13238720], [13238721, 14442240], [14442241, 15645760], [15645761, 16849280], [16849281, 18052800], [18052801, 19256320], [19256321, 20459840], [20459841, 21663360], [21663361, 22866880], [22866881, 24070404]] SRR3691902 file size 7663589 SRR3691902 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3691902 SRR3691902_1.fastq SRR3691902_2.fastq Input file: SRR3691902_1.fastq Paired file: SRR3691902_2.fastq trimmed: SRR3691902-trimmed-pair1.fastq, SRR3691902-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:00:19 2024 >> started Tue Dec 10 00:00:45 2024 >> done (26.023s) 24070404 read pairs processed; of these: 162 ( 0.00%) short read pairs filtered out after trimming by size control 2209 ( 0.01%) empty read pairs filtered out after trimming by size control 24068033 (99.99%) read pairs available; of these: 3945966 (16.40%) trimmed read pairs available after processing 20122067 (83.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 3 0.00% 21 2 0.00% 22 3 0.00% 23 2 0.00% 24 7 0.00% 25 3 0.00% 26 7 0.00% 27 3 0.00% 28 10 0.00% 29 9 0.00% 30 17 0.00% 31 14 0.00% 32 22 0.00% 33 30 0.00% 34 23 0.00% 35 28 0.00% 36 18 0.00% 37 32 0.00% 38 57 0.00% 39 55 0.00% 40 74 0.00% 41 67 0.00% 42 87 0.00% 43 104 0.00% 44 98 0.00% 45 106 0.00% 46 128 0.00% 47 154 0.00% 48 155 0.00% 49 207 0.00% 50 204 0.00% 51 244 0.00% 52 288 0.00% 53 304 0.00% 54 322 0.00% 55 334 0.00% 56 350 0.00% 57 421 0.00% 58 469 0.00% 59 564 0.00% 60 683 0.00% 61 800 0.00% 62 891 0.00% 63 998 0.00% 64 1100 0.00% 65 1183 0.00% 66 1266 0.01% 67 1433 0.01% 68 1470 0.01% 69 1727 0.01% 70 2134 0.01% 71 2377 0.01% 72 2778 0.01% 73 3052 0.01% 74 3518 0.01% 75 3842 0.02% 76 4414 0.02% 77 4602 0.02% 78 5001 0.02% 79 5587 0.02% 80 6627 0.03% 81 7640 0.03% 82 8825 0.04% 83 10159 0.04% 84 11416 0.05% 85 12075 0.05% 86 13412 0.06% 87 14464 0.06% 88 15262 0.06% 89 16615 0.07% 90 19007 0.08% 91 21495 0.09% 92 24294 0.10% 93 27129 0.11% 94 29994 0.12% 95 32080 0.13% 96 34542 0.14% 97 36349 0.15% 98 38163 0.16% 99 40819 0.17% 100 43895 0.18% 101 48320 0.20% 102 53073 0.22% 103 58726 0.24% 104 62381 0.26% 105 66959 0.28% 106 68202 0.28% 107 69519 0.29% 108 70146 0.29% 109 73256 0.30% 110 76334 0.32% 111 86608 0.36% 112 172282 0.72% 113 182996 0.76% 114 193191 0.80% 115 200859 0.83% 116 202774 0.84% 117 202083 0.84% 118 200418 0.83% 119 200360 0.83% 120 203229 0.84% 121 248589 1.03% 122 217224 0.90% 123 229570 0.95% 124 240714 1.00% 125 20122067 83.60% 24068033 reads passed initial QC criterion=sequence-density sequence-density=9.52 sequence-density-rank=1 fanout-score=36.44 fanout-score-rank=1 prefix-density=9.61 prefix-fanout=36.1 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAA criterion=fanout-score sequence-density=9.52 sequence-density-rank=1 fanout-score=36.44 fanout-score-rank=1 prefix-density=9.61 prefix-fanout=36.1 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAA criterion=sequence-density sequence-density=9.60 sequence-density-rank=1 fanout-score=43.30 fanout-score-rank=1 prefix-density=9.65 prefix-fanout=43.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=9.60 sequence-density-rank=1 fanout-score=43.30 fanout-score-rank=1 prefix-density=9.65 prefix-fanout=43.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTATGCCGTCTTCTGCTTGAAAAA Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAA -y AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTATGCCGTCTTCTGCTTGAAAAA -o SRR3691902 SRR3691902_1.fastq SRR3691902_2.fastq Input file: SRR3691902_1.fastq Paired file: SRR3691902_2.fastq trimmed: SRR3691902-trimmed-pair1.fastq, SRR3691902-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAA -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:02:56 2024 >> started Tue Dec 10 00:03:20 2024 >> done (23.415s) 19254427 read pairs processed; of these: 130 ( 0.00%) short read pairs filtered out after trimming by size control 885 ( 0.00%) empty read pairs filtered out after trimming by size control 19253412 (99.99%) read pairs available; of these: 986101 ( 5.12%) trimmed read pairs available after processing 18267311 (94.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 5 0.00% 21 3 0.00% 22 3 0.00% 23 2 0.00% 24 8 0.00% 25 7 0.00% 26 9 0.00% 27 6 0.00% 28 17 0.00% 29 14 0.00% 30 16 0.00% 31 24 0.00% 32 35 0.00% 33 39 0.00% 34 49 0.00% 35 42 0.00% 36 48 0.00% 37 83 0.00% 38 75 0.00% 39 84 0.00% 40 111 0.00% 41 127 0.00% 42 138 0.00% 43 144 0.00% 44 152 0.00% 45 177 0.00% 46 210 0.00% 47 244 0.00% 48 273 0.00% 49 343 0.00% 50 354 0.00% 51 396 0.00% 52 458 0.00% 53 465 0.00% 54 539 0.00% 55 552 0.00% 56 570 0.00% 57 677 0.00% 58 778 0.00% 59 869 0.00% 60 1072 0.01% 61 1244 0.01% 62 1461 0.01% 63 1586 0.01% 64 1741 0.01% 65 1883 0.01% 66 2051 0.01% 67 2280 0.01% 68 2399 0.01% 69 2760 0.01% 70 3433 0.02% 71 3801 0.02% 72 4422 0.02% 73 5059 0.03% 74 5672 0.03% 75 6196 0.03% 76 6870 0.04% 77 7459 0.04% 78 7922 0.04% 79 9071 0.05% 80 10594 0.06% 81 12147 0.06% 82 14070 0.07% 83 16058 0.08% 84 18323 0.10% 85 19699 0.10% 86 21475 0.11% 87 23026 0.12% 88 24484 0.13% 89 26569 0.14% 90 30191 0.16% 91 34483 0.18% 92 38963 0.20% 93 43403 0.23% 94 48254 0.25% 95 51640 0.27% 96 55097 0.29% 97 58020 0.30% 98 60847 0.32% 99 64904 0.34% 100 69774 0.36% 101 76572 0.40% 102 84461 0.44% 103 92959 0.48% 104 99872 0.52% 105 105947 0.55% 106 108835 0.57% 107 110706 0.57% 108 112826 0.59% 109 117130 0.61% 110 121099 0.63% 111 128357 0.67% 112 137609 0.71% 113 146792 0.76% 114 154822 0.80% 115 160568 0.83% 116 162168 0.84% 117 162151 0.84% 118 160224 0.83% 119 160083 0.83% 120 162678 0.84% 121 195922 1.02% 122 173764 0.90% 123 183687 0.95% 124 192634 1.00% 125 15112984 78.50% criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.87 fanout-score-rank=25 prefix-density=0.22 prefix-fanout=2.9 sequence=CTCGCCATGTTCTCCATGTTCGGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=570.68 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=23.0 sequence=CGGCGGCGGCAACTGGAGGGAGTGAATGGTGGGGCCCCTCGTGGCCAGTTATCCTTGTTACCTTTTATCTGTGATGTTATCGCTCCCGAGTATCCTAGATCTCGCTCCATCGCGTAGGGTTTGAGATGTTTAAGGGTTACCATTAGGTGTTTGTCCGTGATGCTACCTGTCGTGTGTTCCTGTTCTGTTCCGTTCGCTATCCCTATGAATGAATGAAA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=27 prefix-density=0.20 prefix-fanout=2.6 sequence=CTCGCCATGTTCTCCATGTTCGGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=381.32 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=24.3 sequence=CCGGCGGCGGCAACTGGAGGGAGTGAATGGTGGGGCCCCTCGTGGCCAGTTATCCTTGTTACCTTTTATCTGTGATGTTATCGCTCCCGAGTATCCTAGATCTCGCTCCATCGCGTAGGGTTTGAGATGTTTAAGGGTTACCATTAGGTGTTTGTCCGTGATGCTACCTGTCGTGTGTTCCTGTTCTGTTCCGTTCGCTATCCCTATGAATGAATGAAAA SRR3691902 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:05:20 Started mapping on | Dec 10 00:05:25 Finished on | Dec 10 00:06:51 Mapping speed, Million of reads per hour | 1007.46 Number of input reads | 24067018 Average input read length | 243 UNIQUE READS: Uniquely mapped reads number | 22740176 Uniquely mapped reads % | 94.49% Average mapped length | 242.87 Number of splices: Total | 16865334 Number of splices: Annotated (sjdb) | 15866536 Number of splices: GT/AG | 16636356 Number of splices: GC/AG | 198497 Number of splices: AT/AC | 8687 Number of splices: Non-canonical | 21794 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.07 Insertion rate per base | 0.01% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 326013 % of reads mapped to multiple loci | 1.35% Number of reads mapped to too many loci | 37532 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.39% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1001051 1001051 1001051 N_multimapping 326013 326013 326013 N_noFeature 629309 11526651 11427336 N_ambiguous 477367 32564 31348 UnstrandedReadsAssigned:21633500 PositiveStrandReadsAssigned:11180961 NegativeStrandReadsAssigned:11281492 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=123 echo kmer=119 SRR3691902 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3691902-trimmed-pair1.fastq SRR3691902-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,067,018 reads, 22,431,523 reads pseudoaligned [quant] estimated average fragment length: 162.736 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52973 SRR3691902.ke.tsv 35125 SRR3691902.se.tsv 88098 total ==> SRR3691902.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 774.441 0.124121 0.0102003 PNS24247 1044 882.264 96.9926 6.99674 PNS24249 1928 1766.26 359.777 12.9638 PNS24246 1044 882.264 96.9926 6.99674 PNS24248 1044 882.264 96.9926 6.99674 PNS24244 1471 1309.26 41.1217 1.99894 PNS24243 293 136.507 14 6.52721 KQK14069 1603 1441.26 41389.8 1827.7 KQK14071 474 313.797 3274.05 664.037 ==> SRR3691902.se.tsv <== BRADI_1g14170v3 46953 BRADI_1g53295v3 32 BRADI_1g59795v3 793 BRADI_1g07683v3 1 BRADI_1g00485v3 28 BRADI_1g20270v3 211 BRADI_1g74790v3 338 BRADI_1g09890v3 0 BRADI_1g77505v3 317 BRADI_1g48960v3 0 SRR3691902 completed mapping pipeline successfully