Starting /dee2/code/volunteer_pipeline.sh SRR3691903 current disk space = 1523470970880 free memory = 1564926988 SRR3691903 SRAfilesize 59180efc842854e730878c10bd599485 SRR3691903.sra SRR3691903.sra file validated SRR3691903 is paired end SRR3691903 is conventional basespace SRR3691903 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691903_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76825 33.0 33.0 34.0 32.0 34.0 2 32.94175 34.0 33.0 34.0 32.0 34.0 3 32.9595 34.0 33.0 34.0 32.0 34.0 4 32.76575 34.0 33.0 34.0 32.0 34.0 5 32.867 34.0 33.0 34.0 32.0 34.0 6 37.04025 38.0 38.0 38.0 36.0 38.0 7 36.982 38.0 38.0 38.0 36.0 38.0 8 37.068 38.0 38.0 38.0 36.0 38.0 9 37.07975 38.0 38.0 38.0 37.0 38.0 10-11 37.00925 38.0 38.0 38.0 36.0 38.0 12-13 36.985125 38.0 38.0 38.0 36.0 38.0 14-15 37.052 38.0 38.0 38.0 36.0 38.0 16-17 37.006249999999994 38.0 38.0 38.0 36.0 38.0 18-19 36.981625 38.0 38.0 38.0 36.0 38.0 20-21 36.917874999999995 38.0 38.0 38.0 36.0 38.0 22-23 36.918875 38.0 38.0 38.0 36.0 38.0 24-25 37.01475 38.0 38.0 38.0 36.0 38.0 26-27 36.989375 38.0 38.0 38.0 36.0 38.0 28-29 37.093999999999994 38.0 38.0 38.0 36.5 38.0 30-31 37.06325 38.0 38.0 38.0 37.0 38.0 32-33 37.111625000000004 38.0 38.0 38.0 37.0 38.0 34-35 37.013 38.0 38.0 38.0 36.0 38.0 36-37 37.0005 38.0 38.0 38.0 36.0 38.0 38-39 37.028625 38.0 38.0 38.0 36.0 38.0 40-41 37.079 38.0 38.0 38.0 36.0 38.0 42-43 37.04675 38.0 38.0 38.0 36.0 38.0 44-45 37.080125 38.0 38.0 38.0 36.0 38.0 46-47 37.06125 38.0 38.0 38.0 36.0 38.0 48-49 37.048125 38.0 38.0 38.0 36.0 38.0 50-51 37.07325 38.0 38.0 38.0 36.0 38.0 52-53 37.034 38.0 38.0 38.0 36.0 38.0 54-55 36.97525 38.0 38.0 38.0 36.0 38.0 56-57 36.910624999999996 38.0 38.0 38.0 36.0 38.0 58-59 36.9015 38.0 38.0 38.0 36.0 38.0 60-61 36.95325 38.0 38.0 38.0 36.0 38.0 62-63 36.927625000000006 38.0 38.0 38.0 36.0 38.0 64-65 36.88225 38.0 38.0 38.0 36.0 38.0 66-67 36.792625 38.0 38.0 38.0 35.0 38.0 68-69 36.813625 38.0 38.0 38.0 35.5 38.0 70-71 36.842375000000004 38.0 38.0 38.0 35.5 38.0 72-73 36.950874999999996 38.0 38.0 38.0 36.0 38.0 74-75 36.820375 38.0 38.0 38.0 35.0 38.0 76-77 36.827749999999995 38.0 38.0 38.0 35.5 38.0 78-79 36.755875 38.0 38.0 38.0 35.0 38.0 80-81 36.754875 38.0 38.0 38.0 35.0 38.0 82-83 36.66525 38.0 38.0 38.0 34.5 38.0 84-85 36.591499999999996 38.0 38.0 38.0 34.5 38.0 86-87 36.60975 38.0 38.0 38.0 34.5 38.0 88-89 36.594375 38.0 38.0 38.0 34.5 38.0 90-91 36.541875000000005 38.0 38.0 38.0 34.0 38.0 92-93 36.471999999999994 38.0 38.0 38.0 34.0 38.0 94-95 36.466499999999996 38.0 38.0 38.0 34.0 38.0 96-97 36.409625 38.0 38.0 38.0 34.0 38.0 98-99 36.332499999999996 38.0 38.0 38.0 34.0 38.0 100-101 36.432249999999996 38.0 38.0 38.0 34.0 38.0 102-103 36.29925 38.0 38.0 38.0 34.0 38.0 104-105 36.41175 38.0 38.0 38.0 34.0 38.0 106-107 36.26775 38.0 38.0 38.0 33.5 38.0 108-109 36.0985 38.0 38.0 38.0 33.0 38.0 110-111 36.203 38.0 38.0 38.0 33.5 38.0 112-113 36.1045 38.0 38.0 38.0 33.0 38.0 114-115 36.065625 38.0 38.0 38.0 33.0 38.0 116-117 35.8965 38.0 37.5 38.0 31.5 38.0 118-119 35.451625 38.0 36.5 38.0 31.0 38.0 120-121 35.277375 38.0 36.0 38.0 30.0 38.0 122-123 35.221625 38.0 36.0 38.0 29.0 38.0 124-125 34.976625 38.0 36.0 38.0 27.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 4.0 17 9.0 18 5.0 19 4.0 20 5.0 21 4.0 22 5.0 23 8.0 24 10.0 25 14.0 26 24.0 27 21.0 28 27.0 29 33.0 30 36.0 31 49.0 32 56.0 33 82.0 34 129.0 35 183.0 36 365.0 37 2925.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.335839598997495 16.040100250626566 11.954887218045112 37.669172932330824 2 30.76538269134567 21.885942971485743 26.038019009504755 21.310655327663834 3 23.936968484242122 23.736868434217108 25.012506253126567 27.313656828414207 4 27.63881940970485 27.963981990995496 19.559779889944974 24.83741870935468 5 30.390195097548773 30.040020010005 18.63431715857929 20.935467733866933 6 24.562281140570285 33.31665832916458 18.459229614807406 23.66183091545773 7 24.281070267566893 18.179544886221557 31.45786446611653 26.081520380095025 8 25.906476619154787 21.330332583145786 23.53088272068017 29.232308077019255 9 23.536768384192097 22.26113056528264 26.088044022011005 28.114057028514257 10-11 27.97648824412206 26.300650325162582 18.846923461730867 26.87593796898449 12-13 27.70135067533767 21.1855927963982 22.048524262131068 29.064532266133064 14-15 26.96348174087044 24.299649824912457 21.785892946473236 26.95097548774387 16-17 28.214107053526767 22.823911955977987 22.14857428714357 26.813406703351678 18-19 28.251625812906454 24.024512256128062 21.52326163081541 26.20060030015007 20-21 26.825912956478238 24.23711855927964 21.92346173086543 27.01350675337669 22-23 27.260222583468803 23.646367387770415 22.495935975990996 26.597474052769787 24-25 27.46029761160435 23.17118919594848 22.77103913967738 26.597474052769787 26-27 27.619404851212803 23.43085771442861 22.73068267066767 26.219054763690924 28-29 28.107026756689173 22.73068267066767 22.1055263815954 27.056764191047762 30-31 27.12267100162561 22.77103913967738 23.50881580592722 26.597474052769787 32-33 26.825912956478238 24.58729364682341 21.935967983991997 26.650825412706354 34-35 26.910091284231584 24.071526822558457 22.39589846192322 26.62248343128673 36-37 27.403425428178522 23.75296912114014 22.677834729341168 26.16577072134017 38-39 27.3 24.3125 21.912499999999998 26.474999999999998 40-41 28.044511127781945 23.243310827706924 22.493123280820203 26.219054763690924 42-43 27.79792422158309 23.546329873702636 22.13329998749531 26.522445917218956 44-45 26.972614730523947 24.184069025884707 23.371264224084033 25.472052019507313 46-47 27.522821057896714 23.046142303363762 22.00825309491059 27.42278354382894 48-49 28.176588294147077 24.16208104052026 21.83591795897949 25.82541270635318 50-51 28.62681340670335 22.998999499749875 22.623811905952977 25.7503751875938 52-53 27.276138069034516 22.761380690345174 22.961480740370185 27.00100050025013 54-55 27.151075537768882 23.6368184092046 23.024012006003 26.18809404702351 56-57 28.2016008004002 24.099549774887443 22.698849424712357 25.0 58-59 27.851425712856425 23.499249624812407 21.46073036518259 27.188594297148573 60-61 26.850925462731368 23.411705852926463 23.261630815407706 26.475737868934466 62-63 27.113556778389196 24.099549774887443 22.59879939969985 26.18809404702351 64-65 28.382095523880967 22.06801700425106 23.36834208552138 26.18154538634659 66-67 26.372389646117295 24.52169563586345 22.358384394147805 26.747530323871448 68-69 28.0625 24.3 21.975 25.662499999999998 70-71 28.462500000000002 23.5625 22.112499999999997 25.8625 72-73 27.825 23.9375 22.650000000000002 25.587500000000002 74-75 27.712500000000002 23.175 23.0 26.1125 76-77 27.528441055131893 23.615451931491435 22.30278784848106 26.553319164895612 78-79 27.24431107776944 23.58089522380595 22.543135783945985 26.63165791447862 80-81 27.131782945736433 23.63090772693173 23.080770192548137 26.156539134783696 82-83 27.363681840920464 23.949474737368686 22.448724362181093 26.23811905952976 84-85 27.4512256128064 23.424212106053027 23.336668334167083 25.78789394697349 86-87 27.651325662831418 24.099549774887443 23.12406203101551 25.125062531265634 88-89 27.813906953476735 24.462231115557778 22.298649324662332 25.42521260630315 90-91 27.776388194097045 24.537268634317158 22.773886943471737 24.912456228114056 92-93 28.289144572286144 24.349674837418707 22.411205602801402 24.949974987493746 94-95 27.838919459729865 23.62431215607804 22.386193096548272 26.150575287643825 96-97 27.238619309654826 23.92446223111556 23.261630815407706 25.57528764382191 98-99 29.30215107553777 24.19959979989995 22.436218109054526 24.062031015507753 100-101 28.35167583791896 24.174587293646823 22.198599299649825 25.275137568784395 102-103 27.651325662831418 24.499749874937468 22.848924462231114 25.0 104-105 28.31415707853927 24.81240620310155 22.811405702851424 24.062031015507753 106-107 29.327163581790895 24.437218609304654 22.011005502751377 24.224612306153077 108-109 27.788894447223612 25.63781890945473 22.686343171585793 23.88694347173587 110-111 29.314657328664335 24.73736868434217 22.136068034017008 23.81190595297649 112-113 29.214607303651825 24.81240620310155 22.32366183091546 23.649324662331164 114-115 29.289644822411205 24.96248124062031 22.098549274637318 23.649324662331164 116-117 30.09004502251126 24.349674837418707 22.161080540270135 23.3991995997999 118-119 30.47318611987382 25.514195583596216 21.48895899053628 22.52365930599369 120-121 29.712339137017413 25.902094372949787 21.410547564976028 22.975018925056776 122-123 30.806105714646147 26.542197552668096 21.13031411631134 21.521382616374414 124-125 30.860459248044407 25.220792329043658 22.10446631339894 21.814282109512995 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 1.5 29 1.5 30 1.0 31 3.0 32 3.5 33 4.0 34 4.0 35 7.0 36 15.5 37 22.0 38 32.0 39 50.5 40 70.0 41 94.0 42 125.0 43 142.5 44 146.5 45 163.0 46 176.5 47 193.5 48 184.5 49 162.0 50 142.0 51 126.5 52 126.0 53 114.5 54 107.0 55 108.0 56 100.5 57 87.5 58 100.0 59 109.5 60 97.5 61 88.5 62 93.5 63 95.5 64 95.5 65 92.5 66 81.0 67 83.0 68 82.0 69 75.0 70 73.5 71 63.0 72 48.5 73 48.5 74 47.5 75 33.5 76 28.0 77 19.0 78 9.5 79 7.0 80 5.0 81 3.0 82 2.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.05 3 0.05 4 0.05 5 0.05 6 0.05 7 0.025 8 0.025 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.0375 24-25 0.0375 26-27 0.025 28-29 0.025 30-31 0.0375 32-33 0.05 34-35 0.0375 36-37 0.0125 38-39 0.0 40-41 0.025 42-43 0.0375 44-45 0.0375 46-47 0.0375 48-49 0.05 50-51 0.05 52-53 0.05 54-55 0.05 56-57 0.05 58-59 0.05 60-61 0.05 62-63 0.05 64-65 0.025 66-67 0.0375 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.025 80-81 0.025 82-83 0.05 84-85 0.05 86-87 0.05 88-89 0.05 90-91 0.05 92-93 0.05 94-95 0.05 96-97 0.05 98-99 0.05 100-101 0.05 102-103 0.05 104-105 0.05 106-107 0.05 108-109 0.05 110-111 0.05 112-113 0.05 114-115 0.05 116-117 0.05 118-119 0.9375 120-121 0.9249999999999999 122-123 0.9125 124-125 0.9249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.11249999999999999 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.4875 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.825 0.0 0.0 0.0 0.0 86-87 1.1875 0.0 0.0 0.0 0.0 88-89 1.5625 0.0 0.0 0.0 0.0 90-91 1.9749999999999999 0.0 0.0 0.0 0.0 92-93 2.4749999999999996 0.0 0.0 0.0 0.0 94-95 3.075 0.0 0.0 0.0 0.0 96-97 3.8 0.0 0.0 0.0 0.0 98-99 4.737500000000001 0.0 0.0 0.0 0.0 100-101 5.7125 0.0 0.0 0.0 0.0 102-103 6.824999999999999 0.0 0.0 0.0 0.0 104-105 7.8625 0.0 0.0 0.0 0.0 106-107 9.0875 0.0 0.0 0.0 0.0 108-109 10.475000000000001 0.0 0.0 0.0 0.0 110-111 11.975 0.0 0.0 0.0 0.0 112-113 13.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3691903 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691903_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.596 34.0 33.0 34.0 32.0 34.0 2 33.0375 34.0 33.0 34.0 32.0 34.0 3 33.11775 34.0 33.0 34.0 32.0 34.0 4 33.11575 34.0 33.0 34.0 32.0 34.0 5 33.18125 34.0 33.0 34.0 32.0 34.0 6 36.86375 38.0 37.0 38.0 35.0 38.0 7 37.22025 38.0 38.0 38.0 36.0 38.0 8 37.29575 38.0 38.0 38.0 37.0 38.0 9 37.41475 38.0 38.0 38.0 37.0 38.0 10-11 37.4065 38.0 38.0 38.0 37.0 38.0 12-13 37.4525 38.0 38.0 38.0 37.0 38.0 14-15 37.449375 38.0 38.0 38.0 37.0 38.0 16-17 37.51475 38.0 38.0 38.0 38.0 38.0 18-19 37.368875 38.0 38.0 38.0 37.0 38.0 20-21 37.432500000000005 38.0 38.0 38.0 37.0 38.0 22-23 37.47475 38.0 38.0 38.0 37.0 38.0 24-25 37.465125 38.0 38.0 38.0 37.0 38.0 26-27 37.386624999999995 38.0 38.0 38.0 37.0 38.0 28-29 37.361999999999995 38.0 38.0 38.0 37.0 38.0 30-31 37.347 38.0 38.0 38.0 37.0 38.0 32-33 37.288375 38.0 38.0 38.0 37.0 38.0 34-35 37.292 38.0 38.0 38.0 37.0 38.0 36-37 37.276375 38.0 38.0 38.0 37.0 38.0 38-39 37.262375000000006 38.0 38.0 38.0 37.0 38.0 40-41 37.26175 38.0 38.0 38.0 37.0 38.0 42-43 37.222375 38.0 38.0 38.0 37.0 38.0 44-45 37.2795 38.0 38.0 38.0 37.0 38.0 46-47 37.186375 38.0 38.0 38.0 36.5 38.0 48-49 37.187 38.0 38.0 38.0 36.0 38.0 50-51 37.192125000000004 38.0 38.0 38.0 36.5 38.0 52-53 37.144000000000005 38.0 38.0 38.0 36.5 38.0 54-55 37.147625000000005 38.0 38.0 38.0 36.0 38.0 56-57 37.1155 38.0 38.0 38.0 36.0 38.0 58-59 37.12875 38.0 38.0 38.0 36.0 38.0 60-61 37.120999999999995 38.0 38.0 38.0 36.0 38.0 62-63 37.096875 38.0 38.0 38.0 36.0 38.0 64-65 37.088 38.0 38.0 38.0 36.0 38.0 66-67 37.025625000000005 38.0 38.0 38.0 36.0 38.0 68-69 37.097750000000005 38.0 38.0 38.0 36.0 38.0 70-71 37.01575 38.0 38.0 38.0 35.5 38.0 72-73 37.082750000000004 38.0 38.0 38.0 36.0 38.0 74-75 37.054500000000004 38.0 38.0 38.0 36.0 38.0 76-77 36.995875 38.0 38.0 38.0 35.0 38.0 78-79 36.9395 38.0 38.0 38.0 35.0 38.0 80-81 36.96225 38.0 38.0 38.0 35.0 38.0 82-83 37.0025 38.0 38.0 38.0 35.5 38.0 84-85 36.8705 38.0 38.0 38.0 35.0 38.0 86-87 36.86075 38.0 38.0 38.0 35.0 38.0 88-89 36.84025 38.0 38.0 38.0 35.0 38.0 90-91 36.6005 38.0 38.0 38.0 34.0 38.0 92-93 36.722750000000005 38.0 38.0 38.0 34.5 38.0 94-95 36.599125 38.0 38.0 38.0 34.0 38.0 96-97 36.700374999999994 38.0 38.0 38.0 34.0 38.0 98-99 36.752125 38.0 38.0 38.0 35.0 38.0 100-101 36.635625 38.0 38.0 38.0 34.0 38.0 102-103 36.553625 38.0 38.0 38.0 34.0 38.0 104-105 36.505875 38.0 38.0 38.0 34.0 38.0 106-107 36.480125 38.0 38.0 38.0 34.0 38.0 108-109 36.3875 38.0 38.0 38.0 34.0 38.0 110-111 36.590125 38.0 38.0 38.0 34.0 38.0 112-113 36.361374999999995 38.0 38.0 38.0 34.0 38.0 114-115 36.329125000000005 38.0 38.0 38.0 33.5 38.0 116-117 36.16825 38.0 37.0 38.0 33.0 38.0 118-119 36.182 38.0 37.5 38.0 33.0 38.0 120-121 36.178375 38.0 37.5 38.0 33.0 38.0 122-123 36.12725 38.0 37.0 38.0 33.0 38.0 124-125 36.072 38.0 36.5 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 3.0 23 0.0 24 7.0 25 8.0 26 7.0 27 16.0 28 27.0 29 27.0 30 30.0 31 44.0 32 59.0 33 89.0 34 90.0 35 187.0 36 436.0 37 2969.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.94844308320572 10.03062787136294 8.141909137314956 42.87901990811638 2 25.874999999999996 12.4 31.874999999999996 29.849999999999998 3 24.25 16.150000000000002 21.525 38.074999999999996 4 28.925 22.975 19.775000000000002 28.325 5 28.675 28.549999999999997 21.725 21.05 6 23.599999999999998 29.325000000000003 22.6 24.474999999999998 7 20.599999999999998 21.775 35.975 21.65 8 21.3 22.45 27.875 28.375 9 21.0 19.725 32.1 27.175 10-11 24.15 27.675 22.425 25.75 12-13 25.7125 21.8 24.6125 27.875 14-15 25.174999999999997 23.4125 25.112499999999997 26.3 16-17 24.637500000000003 23.6125 24.349999999999998 27.400000000000002 18-19 25.4875 23.849999999999998 24.4125 26.25 20-21 24.8625 23.9875 24.474999999999998 26.674999999999997 22-23 25.4875 24.0375 23.4875 26.987499999999997 24-25 24.1875 23.2875 24.175 28.349999999999998 26-27 25.2 23.575 23.724999999999998 27.500000000000004 28-29 25.687500000000004 24.65 23.0 26.6625 30-31 25.4 23.6375 23.275000000000002 27.6875 32-33 24.9375 24.375 23.45 27.237499999999997 34-35 25.7 23.5375 23.325000000000003 27.437499999999996 36-37 25.387500000000003 23.7625 23.5125 27.3375 38-39 25.087500000000002 22.9375 23.5875 28.3875 40-41 25.275 22.7375 24.337500000000002 27.650000000000002 42-43 24.4875 23.875 23.9125 27.725 44-45 24.837500000000002 23.375 24.4375 27.35 46-47 26.337500000000002 23.45 23.9375 26.275 48-49 25.4625 22.475 23.9125 28.15 50-51 25.3125 24.175 23.0375 27.474999999999998 52-53 26.174999999999997 24.55 22.625 26.650000000000002 54-55 24.9375 23.95 23.25 27.8625 56-57 24.9125 23.674999999999997 23.8375 27.575 58-59 25.9875 23.075000000000003 23.45 27.487499999999997 60-61 25.35 21.975 24.087500000000002 28.5875 62-63 25.924999999999997 22.787499999999998 23.925 27.3625 64-65 26.05 23.8375 23.2875 26.825 66-67 26.575 22.3125 23.1875 27.925 68-69 24.962500000000002 22.9625 23.9375 28.1375 70-71 26.687499999999996 22.8 23.6375 26.875 72-73 26.275 22.7625 23.275000000000002 27.6875 74-75 25.387500000000003 22.725 24.087500000000002 27.800000000000004 76-77 25.974999999999998 23.0125 24.1375 26.875 78-79 25.974999999999998 22.912499999999998 22.9625 28.15 80-81 25.924999999999997 23.1 23.8125 27.1625 82-83 26.5 22.4625 23.674999999999997 27.3625 84-85 25.974999999999998 23.4375 22.412499999999998 28.175 86-87 27.400000000000002 23.962500000000002 23.0375 25.6 88-89 26.424999999999997 22.5625 23.075000000000003 27.9375 90-91 26.8625 22.3625 23.6625 27.1125 92-93 26.924999999999997 23.6875 22.45 26.937499999999996 94-95 27.425 23.2375 22.9625 26.375 96-97 26.174999999999997 23.275000000000002 22.3875 28.1625 98-99 27.0625 23.275000000000002 22.787499999999998 26.875 100-101 26.825 23.0625 23.962500000000002 26.150000000000002 102-103 26.5125 24.0 22.325 27.1625 104-105 26.637499999999996 23.962500000000002 22.625 26.775 106-107 26.85 24.65 22.325 26.174999999999997 108-109 26.987499999999997 24.15 22.175 26.687499999999996 110-111 26.375 24.5 22.662499999999998 26.4625 112-113 26.437500000000004 24.0375 22.412499999999998 27.1125 114-115 26.787499999999998 25.112499999999997 21.55 26.55 116-117 27.400000000000002 25.025 21.1625 26.4125 118-119 26.924999999999997 25.362499999999997 21.65 26.0625 120-121 24.8 26.575 21.6625 26.9625 122-123 26.5625 25.575 20.962500000000002 26.900000000000002 124-125 25.75 25.650000000000002 21.5 27.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 1.5 29 3.0 30 5.5 31 6.0 32 5.5 33 7.5 34 9.5 35 14.5 36 21.0 37 29.5 38 45.0 39 60.5 40 82.5 41 107.5 42 123.5 43 139.0 44 154.0 45 173.0 46 171.5 47 165.5 48 169.5 49 161.5 50 153.5 51 147.5 52 137.0 53 117.0 54 105.5 55 107.0 56 102.5 57 96.0 58 100.5 59 100.5 60 100.5 61 94.5 62 74.5 63 83.5 64 93.5 65 83.0 66 73.0 67 74.0 68 73.0 69 61.0 70 55.5 71 55.5 72 53.0 73 44.5 74 39.0 75 35.0 76 26.0 77 16.0 78 12.5 79 10.0 80 7.0 81 5.5 82 4.5 83 2.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0125 64-65 0.037500000000000006 0.0 0.0 0.0 0.025 66-67 0.1375 0.0 0.0 0.0 0.025 68-69 0.2 0.0 0.0 0.0 0.025 70-71 0.2 0.0 0.0 0.0 0.025 72-73 0.25 0.0 0.0 0.0 0.025 74-75 0.25 0.0 0.0 0.0 0.025 76-77 0.3125 0.0 0.0 0.0 0.025 78-79 0.44999999999999996 0.0 0.0 0.0 0.025 80-81 0.5375000000000001 0.0 0.0 0.0 0.025 82-83 0.675 0.0 0.0 0.0 0.025 84-85 0.875 0.0 0.0 0.0 0.025 86-87 1.25 0.0 0.0 0.0 0.025 88-89 1.6124999999999998 0.0 0.0 0.0 0.025 90-91 2.025 0.0 0.0 0.0 0.025 92-93 2.5250000000000004 0.0 0.0 0.0 0.025 94-95 3.125 0.0 0.0 0.0 0.025 96-97 3.85 0.0 0.0 0.0 0.025 98-99 4.7875 0.0 0.0 0.0 0.025 100-101 5.7875 0.0 0.0 0.0 0.025 102-103 6.8625 0.0 0.0 0.0 0.025 104-105 7.949999999999999 0.0 0.0 0.0 0.025 106-107 9.2375 0.0 0.0 0.0 0.025 108-109 10.6625 0.0 0.0 0.0 0.025 110-111 12.25 0.0 0.0 0.0 0.025 112-113 14.0375 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1205270 spots for SRR3691903.sra Written 1205270 spots for SRR3691903.sra Read 1205270 spots for SRR3691903.sra Written 1205270 spots for SRR3691903.sra Read 1205270 spots for SRR3691903.sra Written 1205270 spots for SRR3691903.sra Read 1205270 spots for SRR3691903.sra Written 1205270 spots for SRR3691903.sra Read 1205270 spots for SRR3691903.sra Written 1205270 spots for SRR3691903.sra Read 1205270 spots for SRR3691903.sra Written 1205270 spots for SRR3691903.sra Read 1205270 spots for SRR3691903.sra Written 1205270 spots for SRR3691903.sra Read 1205270 spots for SRR3691903.sra Written 1205270 spots for SRR3691903.sra Read 1205270 spots for SRR3691903.sra Written 1205270 spots for SRR3691903.sra Read 1205270 spots for SRR3691903.sra Written 1205270 spots for SRR3691903.sra Read 1205270 spots for SRR3691903.sra Written 1205270 spots for SRR3691903.sra Read 1205270 spots for SRR3691903.sra Written 1205270 spots for SRR3691903.sra Read 1205270 spots for SRR3691903.sra Written 1205270 spots for SRR3691903.sra Read 1205275 spots for SRR3691903.sra Written 1205275 spots for SRR3691903.sra Read 1205270 spots for SRR3691903.sra Written 1205270 spots for SRR3691903.sra Read 1205270 spots for SRR3691903.sra Written 1205270 spots for SRR3691903.sra Read 1205270 spots for SRR3691903.sra Written 1205270 spots for SRR3691903.sra Read 1205270 spots for SRR3691903.sra Written 1205270 spots for SRR3691903.sra Read 1205270 spots for SRR3691903.sra Written 1205270 spots for SRR3691903.sra Read 1205270 spots for SRR3691903.sra Written 1205270 spots for SRR3691903.sra SRR ids: ['SRR3691903.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_on3sk1xs SRR3691903.sra spots: 24105405 blocks: [[1, 1205270], [1205271, 2410540], [2410541, 3615810], [3615811, 4821080], [4821081, 6026350], [6026351, 7231620], [7231621, 8436890], [8436891, 9642160], [9642161, 10847430], [10847431, 12052700], [12052701, 13257970], [13257971, 14463240], [14463241, 15668510], [15668511, 16873780], [16873781, 18079050], [18079051, 19284320], [19284321, 20489590], [20489591, 21694860], [21694861, 22900130], [22900131, 24105405]] SRR3691903 file size 7674745 SRR3691903 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3691903 SRR3691903_1.fastq SRR3691903_2.fastq Input file: SRR3691903_1.fastq Paired file: SRR3691903_2.fastq trimmed: SRR3691903-trimmed-pair1.fastq, SRR3691903-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:00:33 2024 >> started Tue Dec 10 00:00:58 2024 >> done (24.636s) 24105405 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 962 ( 0.00%) empty read pairs filtered out after trimming by size control 24104442 (100.00%) read pairs available; of these: 3143793 (13.04%) trimmed read pairs available after processing 20960649 (86.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 80 36 0.00% 81 122 0.00% 82 27 0.00% 83 5 0.00% 84 0 0.00% 85 0 0.00% 86 0 0.00% 87 0 0.00% 88 0 0.00% 89 0 0.00% 90 0 0.00% 91 0 0.00% 92 0 0.00% 93 0 0.00% 94 0 0.00% 95 1 0.00% 96 75 0.00% 97 70 0.00% 98 37 0.00% 99 473 0.00% 100 697 0.00% 101 554 0.00% 102 412 0.00% 103 1325 0.01% 104 273 0.00% 105 1855 0.01% 106 11 0.00% 107 2 0.00% 108 48 0.00% 109 650 0.00% 110 2799 0.01% 111 23404 0.10% 112 205440 0.85% 113 211017 0.88% 114 216082 0.90% 115 225021 0.93% 116 232084 0.96% 117 234212 0.97% 118 240509 1.00% 119 243396 1.01% 120 246622 1.02% 121 290339 1.20% 122 252639 1.05% 123 253683 1.05% 124 259873 1.08% 125 20960649 86.96% 24104442 reads passed initial QC criterion=sequence-density sequence-density=12.05 sequence-density-rank=1 fanout-score=34.74 fanout-score-rank=1 prefix-density=12.14 prefix-fanout=34.5 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA criterion=fanout-score sequence-density=12.05 sequence-density-rank=1 fanout-score=34.74 fanout-score-rank=1 prefix-density=12.14 prefix-fanout=34.5 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA criterion=sequence-density sequence-density=12.11 sequence-density-rank=1 fanout-score=45.81 fanout-score-rank=1 prefix-density=12.18 prefix-fanout=45.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=12.11 sequence-density-rank=1 fanout-score=45.81 fanout-score-rank=1 prefix-density=12.18 prefix-fanout=45.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTGAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -y AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTGAAAAAAA -o SRR3691903 SRR3691903_1.fastq SRR3691903_2.fastq Input file: SRR3691903_1.fastq Paired file: SRR3691903_2.fastq trimmed: SRR3691903-trimmed-pair1.fastq, SRR3691903-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:02:56 2024 >> started Tue Dec 10 00:03:21 2024 >> done (24.518s) 20396066 read pairs processed; of these: 198 ( 0.00%) short read pairs filtered out after trimming by size control 7209 ( 0.04%) empty read pairs filtered out after trimming by size control 20388659 (99.96%) read pairs available; of these: 2611142 (12.81%) trimmed read pairs available after processing 17777517 (87.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 9 0.00% 20 6 0.00% 21 3 0.00% 22 0 0.00% 23 5 0.00% 24 9 0.00% 25 4 0.00% 26 12 0.00% 27 13 0.00% 28 17 0.00% 29 20 0.00% 30 22 0.00% 31 33 0.00% 32 40 0.00% 33 35 0.00% 34 71 0.00% 35 75 0.00% 36 79 0.00% 37 99 0.00% 38 113 0.00% 39 135 0.00% 40 167 0.00% 41 190 0.00% 42 202 0.00% 43 233 0.00% 44 215 0.00% 45 233 0.00% 46 289 0.00% 47 305 0.00% 48 381 0.00% 49 474 0.00% 50 512 0.00% 51 605 0.00% 52 602 0.00% 53 749 0.00% 54 831 0.00% 55 834 0.00% 56 955 0.00% 57 1056 0.01% 58 1192 0.01% 59 1290 0.01% 60 1498 0.01% 61 1790 0.01% 62 1972 0.01% 63 2144 0.01% 64 2432 0.01% 65 2742 0.01% 66 2967 0.01% 67 3353 0.02% 68 3752 0.02% 69 4063 0.02% 70 4622 0.02% 71 5251 0.03% 72 6039 0.03% 73 6947 0.03% 74 7765 0.04% 75 8633 0.04% 76 9756 0.05% 77 10860 0.05% 78 11773 0.06% 79 13591 0.07% 80 15061 0.07% 81 16742 0.08% 82 18825 0.09% 83 20937 0.10% 84 23143 0.11% 85 26449 0.13% 86 29421 0.14% 87 32490 0.16% 88 35975 0.18% 89 39234 0.19% 90 42647 0.21% 91 46900 0.23% 92 50992 0.25% 93 55710 0.27% 94 61546 0.30% 95 67141 0.33% 96 72500 0.36% 97 79819 0.39% 98 84812 0.42% 99 90985 0.45% 100 97616 0.48% 101 103370 0.51% 102 109002 0.53% 103 117043 0.57% 104 122328 0.60% 105 130187 0.64% 106 137386 0.67% 107 144768 0.71% 108 150058 0.74% 109 159135 0.78% 110 163967 0.80% 111 168377 0.83% 112 173830 0.85% 113 178639 0.88% 114 182830 0.90% 115 190270 0.93% 116 195715 0.96% 117 198070 0.97% 118 203467 1.00% 119 205677 1.01% 120 208738 1.02% 121 240512 1.18% 122 213563 1.05% 123 214747 1.05% 124 219640 1.08% 125 15124326 74.18% criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=36 prefix-density=0.20 prefix-fanout=2.1 sequence=CCCCTCGAGAACCT criterion=fanout-score sequence-density=0.06 sequence-density-rank=35 fanout-score=204.64 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=20.5 sequence=CCGGCGGCGGCAACTGGAGGGAGTGAATGGTGGGGCCCCTCGTGGCCAGTTATCCTTGTTACCTTTTATCTGTGATGTTATCGCTCCCGAGTATCCTAGATCTCGCTCCATCGCGTAGGGTTTGAGATGTTTAAGGGTTACCATTAGGTGTTTGTCCGTGATGCTACCTGTCGTGTGTTCCTGTTCTGTTCCGTTCGCTATCCCTATGAATGAATGAAAAAAGAATGAG criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=33 prefix-density=0.38 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGC criterion=fanout-score sequence-density=0.13 sequence-density-rank=12 fanout-score=194.54 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=25.6 sequence=CTTCTTCTTCTC SRR3691903 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:05:00 Started mapping on | Dec 10 00:05:00 Finished on | Dec 10 00:06:09 Mapping speed, Million of reads per hour | 1257.24 Number of input reads | 24097035 Average input read length | 242 UNIQUE READS: Uniquely mapped reads number | 23112926 Uniquely mapped reads % | 95.92% Average mapped length | 241.63 Number of splices: Total | 16734738 Number of splices: Annotated (sjdb) | 15691153 Number of splices: GT/AG | 16507298 Number of splices: GC/AG | 197676 Number of splices: AT/AC | 8265 Number of splices: Non-canonical | 21499 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.09 Insertion rate per base | 0.01% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 317352 % of reads mapped to multiple loci | 1.32% Number of reads mapped to too many loci | 43546 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.92% % of reads unmapped: other | 0.67% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 666890 666890 666890 N_multimapping 317352 317352 317352 N_noFeature 625838 858147 22442249 N_ambiguous 501962 63447 2269 UnstrandedReadsAssigned:21985126 PositiveStrandReadsAssigned:22191332 NegativeStrandReadsAssigned:668408 Dataset is classified positive stranded MeadianReadLen=125 20thPercentileLength=119 echo kmer=115 SRR3691903 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3691903-trimmed-pair1.fastq SRR3691903-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,097,035 reads, 22,569,809 reads pseudoaligned [quant] estimated average fragment length: 157.749 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,294 rounds 52973 SRR3691903.ke.tsv 35125 SRR3691903.se.tsv 88098 total ==> SRR3691903.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 779.414 11.4683 0.918222 PNS24247 1044 887.251 110.739 7.78876 PNS24249 1928 1771.25 352.489 12.4188 PNS24246 1044 887.251 110.739 7.78876 PNS24248 1044 887.251 110.739 7.78876 PNS24244 1471 1314.25 71.8265 3.41052 PNS24243 293 141.434 0 0 KQK14069 1603 1446.25 50035.7 2158.99 KQK14071 474 318.655 4527.36 886.622 ==> SRR3691903.se.tsv <== BRADI_1g14170v3 57040 BRADI_1g53295v3 28 BRADI_1g59795v3 945 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 233 BRADI_1g74790v3 314 BRADI_1g09890v3 0 BRADI_1g77505v3 392 BRADI_1g48960v3 0 SRR3691903 completed mapping pipeline successfully