Starting /dee2/code/volunteer_pipeline.sh SRR3691904 current disk space = 1523522314240 free memory = 1601600944 SRR3691904 SRAfilesize a5a3c0af3c5f120c6e5d035bf698fc93 SRR3691904.sra SRR3691904.sra file validated SRR3691904 is paired end SRR3691904 is conventional basespace SRR3691904 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691904_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.74075 34.0 33.0 34.0 32.0 34.0 2 33.13625 34.0 33.0 34.0 32.0 34.0 3 33.1815 34.0 33.0 34.0 32.0 34.0 4 33.2475 34.0 33.0 34.0 32.0 34.0 5 33.29725 34.0 33.0 34.0 33.0 34.0 6 37.0305 38.0 37.0 38.0 36.0 38.0 7 37.3055 38.0 38.0 38.0 37.0 38.0 8 37.45975 38.0 38.0 38.0 37.0 38.0 9 37.539 38.0 38.0 38.0 38.0 38.0 10-11 37.539 38.0 38.0 38.0 38.0 38.0 12-13 37.512625 38.0 38.0 38.0 38.0 38.0 14-15 37.457375 38.0 38.0 38.0 37.5 38.0 16-17 37.5265 38.0 38.0 38.0 38.0 38.0 18-19 37.485875 38.0 38.0 38.0 38.0 38.0 20-21 37.49625 38.0 38.0 38.0 38.0 38.0 22-23 37.512125 38.0 38.0 38.0 38.0 38.0 24-25 37.53425 38.0 38.0 38.0 38.0 38.0 26-27 37.466499999999996 38.0 38.0 38.0 38.0 38.0 28-29 37.450125 38.0 38.0 38.0 37.5 38.0 30-31 37.477999999999994 38.0 38.0 38.0 38.0 38.0 32-33 37.489375 38.0 38.0 38.0 38.0 38.0 34-35 37.5035 38.0 38.0 38.0 38.0 38.0 36-37 37.424625000000006 38.0 38.0 38.0 37.0 38.0 38-39 37.397375 38.0 38.0 38.0 37.0 38.0 40-41 37.402249999999995 38.0 38.0 38.0 37.0 38.0 42-43 37.34525 38.0 38.0 38.0 37.0 38.0 44-45 37.32325 38.0 38.0 38.0 37.0 38.0 46-47 37.295 38.0 38.0 38.0 37.0 38.0 48-49 37.295249999999996 38.0 38.0 38.0 37.0 38.0 50-51 37.3165 38.0 38.0 38.0 37.0 38.0 52-53 37.321375 38.0 38.0 38.0 37.0 38.0 54-55 37.321 38.0 38.0 38.0 37.0 38.0 56-57 37.281375 38.0 38.0 38.0 37.0 38.0 58-59 37.3145 38.0 38.0 38.0 37.0 38.0 60-61 37.293875 38.0 38.0 38.0 36.5 38.0 62-63 37.278999999999996 38.0 38.0 38.0 37.0 38.0 64-65 37.147999999999996 38.0 38.0 38.0 36.0 38.0 66-67 37.2305 38.0 38.0 38.0 37.0 38.0 68-69 37.202875 38.0 38.0 38.0 36.5 38.0 70-71 37.172625 38.0 38.0 38.0 36.5 38.0 72-73 37.24487499999999 38.0 38.0 38.0 36.5 38.0 74-75 37.176 38.0 38.0 38.0 36.0 38.0 76-77 37.180375 38.0 38.0 38.0 36.0 38.0 78-79 37.150125 38.0 38.0 38.0 36.0 38.0 80-81 37.171375 38.0 38.0 38.0 36.0 38.0 82-83 37.103375 38.0 38.0 38.0 36.0 38.0 84-85 37.118624999999994 38.0 38.0 38.0 36.0 38.0 86-87 37.025499999999994 38.0 38.0 38.0 36.0 38.0 88-89 37.036125 38.0 38.0 38.0 36.0 38.0 90-91 36.768625 38.0 38.0 38.0 35.0 38.0 92-93 36.903 38.0 38.0 38.0 35.0 38.0 94-95 36.863375 38.0 38.0 38.0 35.0 38.0 96-97 36.936625 38.0 38.0 38.0 35.0 38.0 98-99 36.8625 38.0 38.0 38.0 35.5 38.0 100-101 36.844125 38.0 38.0 38.0 35.0 38.0 102-103 36.827 38.0 38.0 38.0 35.0 38.0 104-105 36.779875000000004 38.0 38.0 38.0 34.5 38.0 106-107 36.77825 38.0 38.0 38.0 35.0 38.0 108-109 36.711125 38.0 38.0 38.0 35.0 38.0 110-111 36.793000000000006 38.0 38.0 38.0 35.0 38.0 112-113 36.749625 38.0 38.0 38.0 35.0 38.0 114-115 36.63125 38.0 38.0 38.0 35.0 38.0 116-117 36.472875 38.0 38.0 38.0 34.0 38.0 118-119 36.562875 38.0 38.0 38.0 34.0 38.0 120-121 36.462125 38.0 38.0 38.0 34.0 38.0 122-123 36.47475 38.0 38.0 38.0 34.0 38.0 124-125 36.451375 38.0 38.0 38.0 34.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 1.0 25 8.0 26 3.0 27 12.0 28 21.0 29 26.0 30 44.0 31 33.0 32 47.0 33 74.0 34 86.0 35 154.0 36 341.0 37 3148.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.54434250764526 8.129459734964323 7.747196738022426 47.579001019367986 2 22.625 13.900000000000002 36.125 27.35 3 21.625 17.0 23.3 38.074999999999996 4 28.050000000000004 25.174999999999997 19.75 27.025 5 26.3 30.2 23.75 19.75 6 20.225 34.275 24.325 21.175 7 18.55 25.025 37.85 18.575 8 19.175 24.025 30.0 26.8 9 18.7 22.675 34.65 23.974999999999998 10-11 22.3875 31.574999999999996 23.4625 22.575 12-13 22.6875 23.825 27.525 25.9625 14-15 22.162499999999998 25.2125 27.650000000000002 24.975 16-17 23.7875 25.224999999999998 25.7375 25.25 18-19 23.05 25.912499999999998 25.9625 25.074999999999996 20-21 21.85 26.8125 26.0 25.337500000000002 22-23 22.7 26.924999999999997 25.650000000000002 24.725 24-25 22.5625 26.2875 25.2375 25.912499999999998 26-27 22.537499999999998 25.8625 26.8375 24.762500000000003 28-29 23.625 25.55 26.150000000000002 24.675 30-31 22.35 26.387500000000003 25.887500000000003 25.374999999999996 32-33 22.2 26.224999999999998 27.1 24.474999999999998 34-35 23.925 25.974999999999998 26.1625 23.9375 36-37 23.1375 25.900000000000002 25.7625 25.2 38-39 22.475 26.05 25.2875 26.187500000000004 40-41 22.4375 26.937499999999996 25.75 24.875 42-43 23.1375 26.200000000000003 25.0375 25.624999999999996 44-45 22.675 26.187500000000004 26.35 24.7875 46-47 23.5875 26.3125 25.3125 24.7875 48-49 22.662499999999998 26.474999999999998 25.5625 25.3 50-51 22.925 26.0 25.424999999999997 25.650000000000002 52-53 23.4125 26.687499999999996 25.275 24.625 54-55 22.8 26.237500000000004 25.0375 25.924999999999997 56-57 23.1125 26.775 24.337500000000002 25.775 58-59 23.5875 26.8125 25.4 24.2 60-61 23.6375 26.400000000000002 24.9375 25.025 62-63 22.925 26.05 25.525 25.5 64-65 22.4875 26.187500000000004 25.924999999999997 25.4 66-67 24.099999999999998 26.2125 25.1 24.587500000000002 68-69 23.0125 26.387500000000003 25.9875 24.6125 70-71 23.7625 25.4625 25.924999999999997 24.85 72-73 22.775000000000002 26.424999999999997 25.137500000000003 25.662499999999998 74-75 23.7125 24.6625 27.3375 24.2875 76-77 24.1875 25.412499999999998 25.424999999999997 24.975 78-79 23.8375 26.05 25.2 24.9125 80-81 22.775000000000002 26.187500000000004 25.900000000000002 25.137500000000003 82-83 24.5125 26.0625 25.025 24.4 84-85 23.6625 26.1 24.474999999999998 25.7625 86-87 24.1625 26.1 25.662499999999998 24.075 88-89 24.175 26.275 24.925 24.625 90-91 24.8625 26.237500000000004 24.0 24.9 92-93 24.212500000000002 26.474999999999998 24.825 24.4875 94-95 24.5125 26.437500000000004 23.9875 25.0625 96-97 23.525 27.1375 24.325 25.0125 98-99 24.325 27.3625 23.9 24.4125 100-101 24.474999999999998 27.2625 23.375 24.887500000000003 102-103 24.975 27.237499999999997 23.1875 24.6 104-105 24.05 26.8625 24.375 24.712500000000002 106-107 24.625 28.425 23.0375 23.9125 108-109 24.825 27.500000000000004 22.55 25.124999999999996 110-111 25.1 28.599999999999998 22.537499999999998 23.7625 112-113 24.9875 27.875 23.3125 23.825 114-115 24.5375 27.650000000000002 22.3625 25.45 116-117 24.6125 28.499999999999996 22.475 24.4125 118-119 24.6625 28.8875 20.925 25.525 120-121 24.775 28.1125 22.125 24.9875 122-123 25.1 28.1875 21.3125 25.4 124-125 24.775 28.275 21.1625 25.7875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 2.0 26 4.5 27 7.5 28 6.5 29 6.5 30 5.5 31 8.0 32 17.5 33 20.5 34 29.0 35 50.5 36 66.5 37 79.0 38 112.0 39 134.5 40 140.0 41 164.5 42 177.0 43 185.5 44 212.0 45 218.5 46 202.0 47 192.0 48 175.5 49 152.0 50 139.5 51 137.5 52 129.0 53 112.0 54 96.5 55 94.0 56 91.5 57 78.0 58 70.0 59 67.0 60 63.5 61 55.0 62 56.0 63 54.5 64 51.5 65 51.5 66 43.5 67 39.5 68 38.5 69 35.0 70 29.0 71 20.0 72 15.0 73 13.0 74 13.0 75 10.5 76 8.0 77 6.0 78 2.5 79 2.5 80 2.5 81 1.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4274578828262509 0.8500000000000001 3 0.07543374402816193 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.325 0.0 0.0 0.0 0.0 68-69 0.42500000000000004 0.0 0.0 0.0 0.0 70-71 0.5125 0.0 0.0 0.0 0.0 72-73 0.6625000000000001 0.0 0.0 0.0 0.0 74-75 0.8 0.0 0.0 0.0 0.0 76-77 0.9625 0.0 0.0 0.0 0.0 78-79 1.2374999999999998 0.0 0.0 0.0 0.0 80-81 1.5375 0.0 0.0 0.0 0.0 82-83 1.9125 0.0 0.0 0.0 0.0 84-85 2.5999999999999996 0.0 0.0 0.0 0.0 86-87 3.1500000000000004 0.0 0.0 0.0 0.0 88-89 3.9375 0.0 0.0 0.0 0.0 90-91 4.85 0.0 0.0 0.0 0.0 92-93 5.737500000000001 0.0 0.0 0.0 0.0 94-95 6.85 0.0 0.0 0.0 0.0 96-97 8.3625 0.0 0.0 0.0 0.0 98-99 10.0 0.0 0.0 0.0 0.0 100-101 12.0 0.0 0.0 0.0 0.0 102-103 13.9375 0.0 0.0 0.0 0.0 104-105 16.275 0.0 0.0 0.0 0.0 106-107 18.7875 0.0 0.0 0.0 0.0 108-109 21.4125 0.0 0.0 0.0 0.0 110-111 24.1875 0.0 0.0 0.0 0.0 112-113 27.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACGTC 60 0.0011795317 24.791666 118-119 GCACACG 65 0.0018805104 22.884615 116-117 GAGCACA 75 0.0043167206 19.833332 114-115 AAGAGCA 85 0.008898068 17.5 112-113 GATCGGA 135 0.0077185165 13.222222 118-119 >>END_MODULE SRR3691904 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691904_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85875 33.0 33.0 34.0 32.0 34.0 2 33.0725 34.0 33.0 34.0 32.0 34.0 3 33.08275 34.0 33.0 34.0 33.0 34.0 4 32.9795 34.0 33.0 34.0 32.0 34.0 5 33.0425 34.0 33.0 34.0 32.0 34.0 6 37.2575 38.0 38.0 38.0 37.0 38.0 7 37.25075 38.0 38.0 38.0 37.0 38.0 8 37.29275 38.0 38.0 38.0 37.0 38.0 9 37.3035 38.0 38.0 38.0 37.0 38.0 10-11 37.21475 38.0 38.0 38.0 37.0 38.0 12-13 37.207499999999996 38.0 38.0 38.0 37.0 38.0 14-15 37.1985 38.0 38.0 38.0 37.0 38.0 16-17 37.168625 38.0 38.0 38.0 37.0 38.0 18-19 37.20675 38.0 38.0 38.0 37.0 38.0 20-21 37.20075 38.0 38.0 38.0 37.0 38.0 22-23 37.16575 38.0 38.0 38.0 37.0 38.0 24-25 37.192125000000004 38.0 38.0 38.0 37.0 38.0 26-27 37.168625000000006 38.0 38.0 38.0 37.0 38.0 28-29 37.263000000000005 38.0 38.0 38.0 37.0 38.0 30-31 37.26175 38.0 38.0 38.0 37.0 38.0 32-33 37.236125 38.0 38.0 38.0 37.0 38.0 34-35 37.289874999999995 38.0 38.0 38.0 37.0 38.0 36-37 37.20925 38.0 38.0 38.0 37.0 38.0 38-39 37.200374999999994 38.0 38.0 38.0 37.0 38.0 40-41 37.228625 38.0 38.0 38.0 37.0 38.0 42-43 37.195 38.0 38.0 38.0 37.0 38.0 44-45 37.218 38.0 38.0 38.0 37.0 38.0 46-47 37.147 38.0 38.0 38.0 37.0 38.0 48-49 37.101124999999996 38.0 38.0 38.0 37.0 38.0 50-51 37.19375 38.0 38.0 38.0 37.0 38.0 52-53 37.127625 38.0 38.0 38.0 36.5 38.0 54-55 37.137125 38.0 38.0 38.0 36.0 38.0 56-57 37.117125 38.0 38.0 38.0 37.0 38.0 58-59 37.130875 38.0 38.0 38.0 37.0 38.0 60-61 37.1485 38.0 38.0 38.0 37.0 38.0 62-63 37.173500000000004 38.0 38.0 38.0 37.0 38.0 64-65 37.0995 38.0 38.0 38.0 36.0 38.0 66-67 37.101 38.0 38.0 38.0 36.0 38.0 68-69 37.01575 38.0 38.0 38.0 36.0 38.0 70-71 37.05200000000001 38.0 38.0 38.0 36.0 38.0 72-73 37.076125000000005 38.0 38.0 38.0 36.0 38.0 74-75 36.980374999999995 38.0 38.0 38.0 36.0 38.0 76-77 37.01325 38.0 38.0 38.0 36.0 38.0 78-79 36.915625 38.0 38.0 38.0 36.0 38.0 80-81 36.909875 38.0 38.0 38.0 36.0 38.0 82-83 36.895 38.0 38.0 38.0 36.0 38.0 84-85 36.7805 38.0 38.0 38.0 35.0 38.0 86-87 36.76875 38.0 38.0 38.0 35.0 38.0 88-89 36.7645 38.0 38.0 38.0 35.0 38.0 90-91 36.720124999999996 38.0 38.0 38.0 35.0 38.0 92-93 36.71225 38.0 38.0 38.0 35.0 38.0 94-95 36.683125000000004 38.0 38.0 38.0 35.0 38.0 96-97 36.610749999999996 38.0 38.0 38.0 34.5 38.0 98-99 36.54875 38.0 38.0 38.0 34.0 38.0 100-101 36.514250000000004 38.0 38.0 38.0 34.0 38.0 102-103 36.435249999999996 38.0 38.0 38.0 34.0 38.0 104-105 36.41825 38.0 38.0 38.0 34.0 38.0 106-107 36.426625 38.0 38.0 38.0 34.0 38.0 108-109 36.27875 38.0 38.0 38.0 34.0 38.0 110-111 36.238 38.0 38.0 38.0 34.0 38.0 112-113 36.107 38.0 38.0 38.0 33.0 38.0 114-115 35.995375 38.0 38.0 38.0 32.0 38.0 116-117 35.839749999999995 38.0 37.5 38.0 31.0 38.0 118-119 35.373000000000005 38.0 36.5 38.0 30.0 38.0 120-121 35.18325 38.0 36.0 38.0 29.0 38.0 122-123 35.148375 38.0 36.0 38.0 29.0 38.0 124-125 34.857625 38.0 36.0 38.0 26.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 5.0 19 1.0 20 2.0 21 2.0 22 5.0 23 5.0 24 8.0 25 10.0 26 27.0 27 26.0 28 29.0 29 28.0 30 34.0 31 36.0 32 64.0 33 80.0 34 107.0 35 179.0 36 348.0 37 3000.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.162270786234615 17.03089675960814 11.906556141672947 36.9002763124843 2 28.91445722861431 22.161080540270135 30.86543271635818 18.05902951475738 3 23.761880940470235 24.61230615307654 27.03851925962982 24.58729364682341 4 26.813406703351678 31.140570285142573 18.809404702351177 23.23661830915458 5 28.01400700350175 32.341170585292645 19.93496748374187 19.70985492746373 6 22.73068267066767 36.53413353338335 20.05501375343836 20.68017004251063 7 23.055763940985248 17.854463615903978 37.2093023255814 21.880470117529384 8 22.88072018004501 22.655663915978995 26.806701675418854 27.656914228557138 9 23.48087021755439 21.43035758939735 29.257314328582147 25.831457864466117 10-11 25.65032516258129 28.639319659829916 22.39869934967484 23.311655827913956 12-13 25.82541270635318 23.299149574787396 26.125562781390695 24.749874937468736 14-15 25.065666041275797 25.86616635397123 25.178236397748595 23.889931207004377 16-17 26.013006503251624 25.362681340670335 25.18759379689845 23.43671835917959 18-19 25.60030015007504 25.550275137568786 25.012506253126567 23.836918459229615 20-21 24.97186444916844 25.009378516943855 26.00975365762161 24.0090033762661 22-23 24.778097262157768 25.203150393799223 26.02825353169146 23.990498812351543 24-25 25.71892973243311 24.706176544136035 25.906476619154787 23.668417104276067 26-27 25.618904726181547 25.893973493373345 25.131282820705174 23.355838959739934 28-29 25.968992248062015 25.6064016004001 25.068767191797946 23.355838959739934 30-31 25.196948855820935 25.659622358384393 25.75965987245217 23.383768913342504 32-33 24.69367341835459 25.09377344336084 26.319079769942487 23.893473368342086 34-35 25.04376094023506 25.618904726181547 24.85621405351338 24.48112028007002 36-37 24.462500000000002 25.55 26.474999999999998 23.5125 38-39 25.45 25.474999999999998 25.412499999999998 23.6625 40-41 24.8062015503876 26.281570392598148 25.03125781445361 23.88097024256064 42-43 24.943735933983497 25.343835958989747 26.331582895723933 23.380845211302827 44-45 25.13442540952857 25.459547330248846 26.58496936351132 22.821057896711267 46-47 24.943735933983497 26.331582895723933 25.28132033008252 23.443360840210055 48-49 24.059022133299987 26.147305239464803 26.072277103913965 23.721395523321245 50-51 24.64982491245623 26.263131565782892 25.400200100050025 23.686843421710854 52-53 26.038019009504755 25.45022511255628 25.72536268134067 22.786393196598297 54-55 24.72486243121561 25.52526263131566 25.41270635317659 24.337168584292147 56-57 25.71285642821411 26.038019009504755 26.113056528264135 22.136068034017008 58-59 25.909716143553833 24.70926597474053 25.809678629486054 23.571339252219584 60-61 24.571714392897338 26.04726772539702 25.934725522070778 23.446292359634864 62-63 25.647117669125922 25.28448168063024 26.20982868575716 22.858571964486682 64-65 24.756189047261813 26.231557889472366 26.144036009002253 22.868217054263564 66-67 26.144036009002253 25.30632658164541 25.456364091022753 23.093273318329583 68-69 25.074999999999996 25.55 25.5625 23.8125 70-71 24.525 26.35 24.95 24.175 72-73 26.1 25.662499999999998 25.75 22.4875 74-75 25.75 25.837500000000002 26.0125 22.400000000000002 76-77 24.675 25.424999999999997 26.450000000000003 23.45 78-79 24.956239059764943 25.85646411602901 25.681420355088775 23.50587646911728 80-81 24.603075384423054 25.340667583447928 26.690836354544317 23.365420677584698 82-83 25.32199574840565 25.847192697261473 25.63461297986745 23.196198574465424 84-85 25.87543771885943 25.53776888444222 26.32566283141571 22.26113056528264 86-87 26.638319159579787 26.18809404702351 25.22511255627814 21.94847423711856 88-89 26.563281640820406 25.76288144072036 25.65032516258129 22.02351175587794 90-91 25.63781890945473 25.912956478239117 25.56278139069535 22.886443221610804 92-93 26.113056528264135 26.500750375187593 25.775387693846923 21.61080540270135 94-95 26.02225834688008 26.5474552957359 25.221958234337876 22.208328123046144 96-97 26.232174130597947 26.607455591693768 23.95546659994996 23.204903677758317 98-99 26.520650813516895 27.284105131414265 24.93116395494368 21.264080100125156 100-101 26.821026282853566 27.359198998748436 24.09261576971214 21.727158948685858 102-103 27.25225225225225 27.7027027027027 24.086586586586588 20.95845845845846 104-105 26.91682301438399 27.091932457786115 24.652908067542214 21.338336460287678 106-107 27.826413206603302 27.126063031515756 23.92446223111556 21.123061530765384 108-109 28.901950975487743 27.988994497248626 23.23661830915458 19.872436218109055 110-111 28.680425265791122 28.13008130081301 23.464665415884927 19.724828017510944 112-113 29.347010257693267 28.083562672004003 22.27920940705529 20.290217663247436 114-115 30.501688977855622 27.086200425372205 22.982609783560616 19.429500813211558 116-117 29.843652282676675 28.993120700437775 22.201375859912446 18.961851156973108 118-119 31.343095177985358 27.631911133552133 21.78742741731886 19.23756627114365 120-121 30.233438485804413 28.000000000000004 22.561514195583594 19.205047318611985 122-123 31.67654850510912 27.879399520625707 22.631512552037343 17.81253942222783 124-125 31.949526813880126 28.000000000000004 21.981072555205046 18.069400630914824 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.5 25 3.0 26 4.0 27 5.0 28 4.0 29 2.5 30 7.5 31 14.5 32 20.5 33 24.5 34 29.5 35 40.5 36 55.0 37 79.0 38 97.5 39 107.5 40 147.0 41 184.5 42 182.5 43 180.5 44 206.0 45 213.5 46 186.0 47 182.0 48 184.0 49 160.0 50 143.0 51 140.5 52 126.5 53 104.5 54 96.5 55 94.0 56 88.0 57 86.0 58 79.0 59 75.5 60 73.5 61 63.0 62 53.5 63 45.5 64 53.0 65 58.0 66 45.5 67 42.5 68 44.0 69 33.0 70 22.5 71 21.5 72 22.5 73 21.0 74 16.5 75 9.5 76 5.0 77 2.0 78 2.5 79 3.0 80 1.0 81 1.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.05 3 0.05 4 0.05 5 0.05 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.05 12-13 0.05 14-15 0.0625 16-17 0.05 18-19 0.05 20-21 0.0375 22-23 0.0125 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.0375 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.025 42-43 0.025 44-45 0.0375 46-47 0.025 48-49 0.0375 50-51 0.05 52-53 0.05 54-55 0.05 56-57 0.05 58-59 0.0375 60-61 0.0375 62-63 0.0375 64-65 0.025 66-67 0.025 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.025 80-81 0.0125 82-83 0.0375 84-85 0.05 86-87 0.05 88-89 0.05 90-91 0.05 92-93 0.05 94-95 0.0375 96-97 0.075 98-99 0.125 100-101 0.125 102-103 0.1 104-105 0.0625 106-107 0.05 108-109 0.05 110-111 0.0625 112-113 0.075 114-115 0.08750000000000001 116-117 0.0625 118-119 0.975 120-121 0.9375 122-123 0.9125 124-125 0.9375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.025 0.025 0.0 0.0 0.0 52-53 0.025 0.025 0.0 0.0 0.0 54-55 0.025 0.025 0.0 0.0 0.0 56-57 0.037500000000000006 0.025 0.0 0.0 0.0 58-59 0.05 0.025 0.0 0.0 0.0 60-61 0.05 0.025 0.0 0.0 0.0 62-63 0.1375 0.025 0.0 0.0 0.0 64-65 0.25 0.025 0.0 0.0 0.0 66-67 0.325 0.025 0.0 0.0 0.0 68-69 0.42500000000000004 0.025 0.0 0.0 0.0 70-71 0.5125 0.025 0.0 0.0 0.0 72-73 0.6625000000000001 0.025 0.0 0.0 0.0 74-75 0.8 0.025 0.0 0.0 0.0 76-77 0.9375 0.025 0.0 0.0 0.0 78-79 1.1875 0.025 0.0 0.0 0.0 80-81 1.4875 0.025 0.0 0.0 0.0 82-83 1.8625 0.025 0.0 0.0 0.0 84-85 2.55 0.025 0.0 0.0 0.0 86-87 3.075 0.025 0.0 0.0 0.0 88-89 3.8875 0.025 0.0 0.0 0.0 90-91 4.800000000000001 0.025 0.0 0.0 0.0 92-93 5.6625 0.025 0.0 0.0 0.0 94-95 6.75 0.025 0.0 0.0 0.0 96-97 8.275 0.025 0.0 0.0 0.0 98-99 9.9 0.025 0.0 0.0 0.0 100-101 11.8625 0.025 0.0 0.0 0.0 102-103 13.7875 0.025 0.0 0.0 0.0 104-105 16.112499999999997 0.025 0.0 0.0 0.0 106-107 18.625 0.025 0.0 0.0 0.0 108-109 21.225 0.025 0.0 0.0 0.0 110-111 23.95 0.025 0.0 0.0 0.0 112-113 26.775 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGTGT 70 0.0028932008 21.25 118-119 GCGTCGT 70 0.0028932008 21.25 116-117 GAGCGTC 75 0.0043167206 19.833332 114-115 GAGATCG 75 0.0043167206 19.833332 116-117 >>END_MODULE Read 1119753 spots for SRR3691904.sra Written 1119753 spots for SRR3691904.sra Read 1119753 spots for SRR3691904.sra Written 1119753 spots for SRR3691904.sra Read 1119753 spots for SRR3691904.sra Written 1119753 spots for SRR3691904.sra Read 1119753 spots for SRR3691904.sra Written 1119753 spots for SRR3691904.sra Read 1119753 spots for SRR3691904.sra Written 1119753 spots for SRR3691904.sra Read 1119753 spots for SRR3691904.sra Written 1119753 spots for SRR3691904.sra Read 1119753 spots for SRR3691904.sra Written 1119753 spots for SRR3691904.sra Read 1119753 spots for SRR3691904.sra Written 1119753 spots for SRR3691904.sra Read 1119753 spots for SRR3691904.sra Written 1119753 spots for SRR3691904.sra Read 1119753 spots for SRR3691904.sra Written 1119753 spots for SRR3691904.sra Read 1119753 spots for SRR3691904.sra Written 1119753 spots for SRR3691904.sra Read 1119754 spots for SRR3691904.sra Written 1119754 spots for SRR3691904.sra Read 1119753 spots for SRR3691904.sra Written 1119753 spots for SRR3691904.sra Read 1119753 spots for SRR3691904.sra Written 1119753 spots for SRR3691904.sra Read 1119753 spots for SRR3691904.sra Written 1119753 spots for SRR3691904.sra Read 1119753 spots for SRR3691904.sra Written 1119753 spots for SRR3691904.sra Read 1119753 spots for SRR3691904.sra Written 1119753 spots for SRR3691904.sra Read 1119753 spots for SRR3691904.sra Written 1119753 spots for SRR3691904.sra Read 1119753 spots for SRR3691904.sra Written 1119753 spots for SRR3691904.sra Read 1119753 spots for SRR3691904.sra Written 1119753 spots for SRR3691904.sra SRR ids: ['SRR3691904.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gu503h36 SRR3691904.sra spots: 22395061 blocks: [[1, 1119753], [1119754, 2239506], [2239507, 3359259], [3359260, 4479012], [4479013, 5598765], [5598766, 6718518], [6718519, 7838271], [7838272, 8958024], [8958025, 10077777], [10077778, 11197530], [11197531, 12317283], [12317284, 13437036], [13437037, 14556789], [14556790, 15676542], [15676543, 16796295], [16796296, 17916048], [17916049, 19035801], [19035802, 20155554], [20155555, 21275307], [21275308, 22395061]] SRR3691904 file size 7129436 SRR3691904 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3691904 SRR3691904_1.fastq SRR3691904_2.fastq Input file: SRR3691904_1.fastq Paired file: SRR3691904_2.fastq trimmed: SRR3691904-trimmed-pair1.fastq, SRR3691904-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:00:44 2024 >> started Tue Dec 10 00:01:08 2024 >> done (23.930s) 22395061 read pairs processed; of these: 178 ( 0.00%) short read pairs filtered out after trimming by size control 4043 ( 0.02%) empty read pairs filtered out after trimming by size control 22390840 (99.98%) read pairs available; of these: 7616915 (34.02%) trimmed read pairs available after processing 14773925 (65.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 1 0.00% 20 4 0.00% 21 1 0.00% 22 3 0.00% 23 7 0.00% 24 7 0.00% 25 9 0.00% 26 18 0.00% 27 13 0.00% 28 19 0.00% 29 34 0.00% 30 41 0.00% 31 42 0.00% 32 54 0.00% 33 73 0.00% 34 76 0.00% 35 99 0.00% 36 82 0.00% 37 108 0.00% 38 119 0.00% 39 169 0.00% 40 222 0.00% 41 262 0.00% 42 284 0.00% 43 292 0.00% 44 305 0.00% 45 359 0.00% 46 381 0.00% 47 501 0.00% 48 536 0.00% 49 678 0.00% 50 799 0.00% 51 927 0.00% 52 1000 0.00% 53 1084 0.00% 54 1107 0.00% 55 1224 0.01% 56 1292 0.01% 57 1436 0.01% 58 1762 0.01% 59 1984 0.01% 60 2272 0.01% 61 2603 0.01% 62 2920 0.01% 63 3246 0.01% 64 3509 0.02% 65 4042 0.02% 66 4270 0.02% 67 4663 0.02% 68 5278 0.02% 69 5857 0.03% 70 6821 0.03% 71 7571 0.03% 72 8453 0.04% 73 10031 0.04% 74 11077 0.05% 75 12429 0.06% 76 13708 0.06% 77 14835 0.07% 78 16242 0.07% 79 18080 0.08% 80 19865 0.09% 81 22429 0.10% 82 25534 0.11% 83 28202 0.13% 84 32243 0.14% 85 35732 0.16% 86 39040 0.17% 87 42349 0.19% 88 46440 0.21% 89 49989 0.22% 90 54192 0.24% 91 58647 0.26% 92 63502 0.28% 93 69798 0.31% 94 75568 0.34% 95 82971 0.37% 96 87975 0.39% 97 94763 0.42% 98 99704 0.45% 99 103421 0.46% 100 110241 0.49% 101 114336 0.51% 102 120641 0.54% 103 128059 0.57% 104 132604 0.59% 105 140957 0.63% 106 146630 0.65% 107 150806 0.67% 108 154249 0.69% 109 160114 0.72% 110 164663 0.74% 111 182512 0.82% 112 331805 1.48% 113 336882 1.50% 114 342523 1.53% 115 354879 1.58% 116 361676 1.62% 117 364342 1.63% 118 362908 1.62% 119 360891 1.61% 120 357140 1.60% 121 380430 1.70% 122 349838 1.56% 123 350047 1.56% 124 350052 1.56% 125 14773925 65.98% 22390840 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=29 prefix-density=0.20 prefix-fanout=2.2 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGCTTCTGGGTCTTCAGCAAGGCCCAGTGGGTCGAAGCT criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=249.93 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=15.3 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=29 prefix-density=0.26 prefix-fanout=2.7 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=198.91 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=15.6 sequence=TCAAGAAGGAGAACGATTTTCAGCAGTCTGGGGAGAGGTACCGGAGCTGGGCGCCGGATCGGCAGGACCGGTTTGTGAAGAGGTTCGCGGATGCTTTGGGGCATCCCAAGGTTAGCCATGAGCTCCGCGCTATCTGGGTCAACTTTCTCTCCCAGTGTGATAAGTCGTGTGGGATGAAGGTTGCGAACCGGCTCAACGTGAAGCCGAGCATGTGATCCATGAGAGTACAGTGGATATGCATCGACTGCCATGGATTGGATGGATGGATATGCTGTGGGACAGTCGGAAATAAAAGTATGTTAAGCTGGATGGCCGTAAGCTTTGTGCTCTTCTCCCTGGACCAGGAGGATGGTAATAAGAGACCACATCGATCCAGATCTGACGTATATGGATCATGTGGCCAACTGTGTGTTTGTCTTCCTTTTTTCCTTCTTTGGAATTTGGAACAAGGCCGGCCAGTGTATTGTCATCATCTTCTCGTCGTTGTT SRR3691904 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:01:53 Started mapping on | Dec 10 00:01:53 Finished on | Dec 10 00:03:48 Mapping speed, Million of reads per hour | 700.93 Number of input reads | 22390840 Average input read length | 240 UNIQUE READS: Uniquely mapped reads number | 19675039 Uniquely mapped reads % | 87.87% Average mapped length | 235.47 Number of splices: Total | 14131669 Number of splices: Annotated (sjdb) | 13240801 Number of splices: GT/AG | 13932563 Number of splices: GC/AG | 166677 Number of splices: AT/AC | 7743 Number of splices: Non-canonical | 24686 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.00 Insertion rate per base | 0.01% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 451224 % of reads mapped to multiple loci | 2.02% Number of reads mapped to too many loci | 66784 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.74% % of reads unmapped: other | 1.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2264751 2264751 2264751 N_multimapping 451224 451224 451224 N_noFeature 936486 10723769 9501290 N_ambiguous 448695 37138 27556 UnstrandedReadsAssigned:18289858 PositiveStrandReadsAssigned:8914132 NegativeStrandReadsAssigned:10146193 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=107 echo kmer=103 SRR3691904 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3691904-trimmed-pair1.fastq SRR3691904-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,390,840 reads, 20,328,660 reads pseudoaligned [quant] estimated average fragment length: 130.774 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,210 rounds 52973 SRR3691904.ke.tsv 35125 SRR3691904.se.tsv 88098 total ==> SRR3691904.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 806.33 0 0 PNS24247 1044 914.226 60.1226 4.917 PNS24249 1928 1798.23 161.151 6.70045 PNS24246 1044 914.226 60.1226 4.917 PNS24248 1044 914.226 60.1226 4.917 PNS24244 1471 1341.23 179.482 10.0054 PNS24243 293 164.476 5 2.27292 KQK14069 1603 1473.23 33617.2 1706.11 KQK14071 474 345.069 2148.65 465.56 ==> SRR3691904.se.tsv <== BRADI_1g14170v3 37318 BRADI_1g53295v3 37 BRADI_1g59795v3 1502 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 163 BRADI_1g74790v3 163 BRADI_1g09890v3 0 BRADI_1g77505v3 423 BRADI_1g48960v3 0 SRR3691904 completed mapping pipeline successfully