Starting /dee2/code/volunteer_pipeline.sh SRR3691905 current disk space = 1523529056256 free memory = 1601594104 SRR3691905 SRAfilesize b205e5075a75e4cdc8e41fd7d8ea6c59 SRR3691905.sra SRR3691905.sra file validated SRR3691905 is paired end SRR3691905 is conventional basespace SRR3691905 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691905_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.871 33.0 33.0 34.0 32.0 34.0 2 32.97275 34.0 33.0 34.0 32.0 34.0 3 32.92975 34.0 33.0 34.0 32.0 34.0 4 32.79675 34.0 33.0 34.0 32.0 34.0 5 32.8555 34.0 33.0 34.0 32.0 34.0 6 36.9725 38.0 38.0 38.0 36.0 38.0 7 36.924 38.0 38.0 38.0 36.0 38.0 8 37.03825 38.0 38.0 38.0 36.0 38.0 9 36.9805 38.0 38.0 38.0 36.0 38.0 10-11 36.964375000000004 38.0 38.0 38.0 36.0 38.0 12-13 36.943749999999994 38.0 38.0 38.0 36.0 38.0 14-15 36.923249999999996 38.0 38.0 38.0 36.0 38.0 16-17 36.971374999999995 38.0 38.0 38.0 36.0 38.0 18-19 36.96575 38.0 38.0 38.0 36.5 38.0 20-21 37.021375 38.0 38.0 38.0 36.0 38.0 22-23 36.989000000000004 38.0 38.0 38.0 36.0 38.0 24-25 37.0215 38.0 38.0 38.0 36.0 38.0 26-27 37.088499999999996 38.0 38.0 38.0 36.0 38.0 28-29 37.02675 38.0 38.0 38.0 36.0 38.0 30-31 37.086875 38.0 38.0 38.0 36.0 38.0 32-33 37.12525 38.0 38.0 38.0 36.5 38.0 34-35 37.097125 38.0 38.0 38.0 37.0 38.0 36-37 37.092124999999996 38.0 38.0 38.0 37.0 38.0 38-39 37.121125 38.0 38.0 38.0 37.0 38.0 40-41 37.13875 38.0 38.0 38.0 37.0 38.0 42-43 37.079375 38.0 38.0 38.0 36.5 38.0 44-45 37.053125 38.0 38.0 38.0 36.5 38.0 46-47 37.02675 38.0 38.0 38.0 36.0 38.0 48-49 36.979 38.0 38.0 38.0 36.0 38.0 50-51 37.013875 38.0 38.0 38.0 36.0 38.0 52-53 37.022375 38.0 38.0 38.0 36.0 38.0 54-55 36.978625 38.0 38.0 38.0 36.0 38.0 56-57 37.013000000000005 38.0 38.0 38.0 36.0 38.0 58-59 36.97125 38.0 38.0 38.0 36.0 38.0 60-61 36.962125 38.0 38.0 38.0 36.0 38.0 62-63 36.95375 38.0 38.0 38.0 36.0 38.0 64-65 37.010125 38.0 38.0 38.0 36.0 38.0 66-67 36.921 38.0 38.0 38.0 36.0 38.0 68-69 36.9165 38.0 38.0 38.0 36.0 38.0 70-71 36.90325 38.0 38.0 38.0 36.0 38.0 72-73 36.87325 38.0 38.0 38.0 36.0 38.0 74-75 36.83675 38.0 38.0 38.0 36.0 38.0 76-77 36.8815 38.0 38.0 38.0 35.5 38.0 78-79 36.876125 38.0 38.0 38.0 35.5 38.0 80-81 36.866375000000005 38.0 38.0 38.0 35.5 38.0 82-83 36.833125 38.0 38.0 38.0 35.5 38.0 84-85 36.77075 38.0 38.0 38.0 35.0 38.0 86-87 36.770250000000004 38.0 38.0 38.0 35.0 38.0 88-89 36.778875 38.0 38.0 38.0 35.0 38.0 90-91 36.772625000000005 38.0 38.0 38.0 35.0 38.0 92-93 36.680875 38.0 38.0 38.0 35.0 38.0 94-95 36.641875 38.0 38.0 38.0 35.0 38.0 96-97 36.625625 38.0 38.0 38.0 35.0 38.0 98-99 36.70125 38.0 38.0 38.0 35.0 38.0 100-101 36.62375 38.0 38.0 38.0 34.5 38.0 102-103 36.4925 38.0 38.0 38.0 34.0 38.0 104-105 36.456125 38.0 38.0 38.0 34.0 38.0 106-107 36.4375 38.0 38.0 38.0 34.0 38.0 108-109 36.51475 38.0 38.0 38.0 34.0 38.0 110-111 36.357375000000005 38.0 38.0 38.0 34.0 38.0 112-113 36.235749999999996 38.0 38.0 38.0 33.5 38.0 114-115 36.188 38.0 38.0 38.0 33.0 38.0 116-117 36.126 38.0 38.0 38.0 32.5 38.0 118-119 36.052125 38.0 38.0 38.0 32.5 38.0 120-121 36.083375000000004 38.0 38.0 38.0 32.0 38.0 122-123 35.964875 38.0 38.0 38.0 31.5 38.0 124-125 35.958875 38.0 38.0 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10-11 0.0 2309 12-13 0.0 2309 14-15 0.0 2309 16-17 0.0 2309 18-19 0.0 2309 20-21 0.0 2309 22-23 0.0 2309 24-25 0.0 2309 26-27 0.0 2309 28-29 0.0 2309 30-31 0.0 2309 32-33 0.0 2309 34-35 0.0 2309 36-37 0.0 2309 38-39 0.0 2309 40-41 0.0 2309 42-43 0.0 2309 44-45 0.0 2309 46-47 0.0 2309 48-49 0.0 2309 50-51 0.0 2309 52-53 0.0 2309 54-55 0.0 2309 56-57 0.0 2309 58-59 0.0 2309 60-61 0.0 2309 62-63 0.0 2309 64-65 0.0 2309 66-67 0.0 2309 68-69 0.0 2309 70-71 0.0 2309 72-73 0.0 2309 74-75 0.0 2309 76-77 0.0 2309 78-79 0.0 2309 80-81 0.0 2309 82-83 0.0 2309 84-85 0.0 2309 86-87 0.0 2309 88-89 0.0 2309 90-91 0.0 2309 92-93 0.0 2309 94-95 0.0 2309 96-97 0.0 2309 98-99 0.0 2309 100-101 0.0 2309 102-103 0.0 2309 104-105 0.0 2309 106-107 0.0 2309 108-109 0.0 2309 110-111 0.0 2309 112-113 0.0 2309 114-115 0.0 2309 116-117 0.0 2309 118-119 0.0 2309 120-121 0.0 2309 122-123 0.0 2309 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 6.0 17 3.0 18 4.0 19 6.0 20 2.0 21 2.0 22 7.0 23 8.0 24 11.0 25 15.0 26 16.0 27 24.0 28 26.0 29 29.0 30 37.0 31 55.0 32 57.0 33 76.0 34 92.0 35 167.0 36 316.0 37 3041.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.85 18.825 8.75 28.575 2 28.225 22.15 29.825000000000003 19.8 3 23.525 25.074999999999996 27.075 24.325 4 27.675 29.799999999999997 20.424999999999997 22.1 5 30.825000000000003 31.15 18.6 19.425 6 22.475 35.099999999999994 19.900000000000002 22.525000000000002 7 22.650000000000002 19.625 33.900000000000006 23.825 8 24.175 21.475 24.85 29.5 9 22.900000000000002 22.75 27.175 27.175 10-11 27.44436109027257 26.85671417854464 21.305326331582897 24.3935983995999 12-13 26.36909227306827 21.8304576144036 25.29382345586397 26.506626656664167 14-15 25.406351587896975 24.793698424606152 25.481370342585645 24.318579644911228 16-17 27.206801700425103 24.33108277069267 23.143285821455365 25.318829707426854 18-19 27.17839729966246 24.1780222527816 24.69058632329041 23.952994124265533 20-21 25.85 25.45 23.5625 25.137500000000003 22-23 27.187499999999996 24.2 23.5625 25.05 24-25 26.0625 23.6125 24.8125 25.5125 26-27 26.474999999999998 25.224999999999998 23.674999999999997 24.625 28-29 26.3625 24.637500000000003 24.1125 24.887500000000003 30-31 26.503312914114264 24.00300037504688 25.065633204150515 24.428053506688336 32-33 25.674999999999997 24.637500000000003 24.9125 24.775 34-35 26.5125 24.75 24.2625 24.474999999999998 36-37 25.5375 23.625 25.674999999999997 25.162499999999998 38-39 26.150000000000002 24.5625 24.5 24.7875 40-41 26.7125 24.0625 24.25 24.975 42-43 26.674999999999997 24.5125 24.349999999999998 24.462500000000002 44-45 26.2625 24.95 24.425 24.3625 46-47 26.187500000000004 24.2625 23.599999999999998 25.95 48-49 25.240655081885237 24.390548818602326 25.55319414926866 24.815601950243778 50-51 26.131532883220803 25.29382345586397 24.081020255063766 24.493623405851466 52-53 27.065883235404424 24.290536317039628 24.24053006625828 24.40305038129766 54-55 26.406601650412604 24.10602650662666 25.168792198049513 24.318579644911228 56-57 25.890736342042754 24.765595699462434 25.028128516064506 24.315539442430303 58-59 26.690836354544317 24.00300037504688 23.940492561570196 25.365670708838607 60-61 26.944236059014752 24.081020255063766 24.406101525381345 24.568642160540136 62-63 26.24078009751219 25.26565820727591 24.878109763720467 23.615451931491435 64-65 26.0125 24.425 24.9125 24.65 66-67 27.200000000000003 24.625 24.075 24.099999999999998 68-69 26.387500000000003 24.7875 24.075 24.75 70-71 26.5375 24.0125 25.087500000000002 24.3625 72-73 26.187500000000004 24.825 24.775 24.212500000000002 74-75 25.575 24.2 25.3 24.925 76-77 26.137500000000003 24.762500000000003 25.224999999999998 23.875 78-79 26.174999999999997 23.9 24.3625 25.5625 80-81 26.787499999999998 24.7 25.05 23.4625 82-83 27.47843480435054 24.515564445555693 23.740467558444806 24.265533191648956 84-85 26.6816704176044 24.18104526131533 25.09377344336084 24.043510877719427 86-87 25.668917229307326 25.206301575393848 25.006251562890725 24.118529632408105 88-89 25.756439109777446 25.49387346836709 24.868717179294826 23.88097024256064 90-91 26.03150787696924 25.11877969492373 24.69367341835459 24.15603900975244 92-93 27.04426106526632 25.63140785196299 24.493623405851466 22.83070767691923 94-95 27.319329832458116 25.056264066016503 24.043510877719427 23.58089522380595 96-97 27.44436109027257 24.618654663665918 23.793448362090523 24.143535883970994 98-99 27.319329832458116 25.693923480870218 23.23080770192548 23.755938984746187 100-101 27.74443610902726 25.481370342585645 23.25581395348837 23.518379594898725 102-103 27.994498624656167 23.85596399099775 24.418604651162788 23.730932733183295 104-105 26.93173293323331 25.531382845711427 24.056014003500874 23.48087021755439 106-107 27.315914489311165 24.56557069633704 24.478059757469683 23.64045505688211 108-109 27.619404851212803 24.06851712928232 24.356089022255563 23.95598899724931 110-111 26.056514128532132 25.70642660665166 24.74368592148037 23.493373343335833 112-113 27.781945486371594 25.081270317579396 23.455863965991497 23.680920230057513 114-115 27.494373593398347 25.593898474618655 24.268567141785446 22.643160790197552 116-117 27.85696424106027 25.95648912228057 24.468617154288573 21.717929482370593 118-119 27.981995498874717 26.819204801200303 22.943235808952238 22.255563890972745 120-121 27.969492373093274 26.081520380095025 23.455863965991497 22.493123280820203 122-123 28.232058014503625 26.981745436359088 22.980745186296573 21.80545136284071 124-125 28.457114278569644 26.619154788697173 22.455613903475868 22.468117029257314 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 1.5 24 1.0 25 3.0 26 4.0 27 4.0 28 3.0 29 4.5 30 8.5 31 10.0 32 13.0 33 19.0 34 24.0 35 28.0 36 46.0 37 57.0 38 65.5 39 92.0 40 106.5 41 113.0 42 136.0 43 155.0 44 161.0 45 176.0 46 184.5 47 180.0 48 166.5 49 161.0 50 162.5 51 151.0 52 128.5 53 115.5 54 120.5 55 113.5 56 105.5 57 92.0 58 83.5 59 90.5 60 80.0 61 72.0 62 73.0 63 69.5 64 71.0 65 66.0 66 55.5 67 57.5 68 59.0 69 58.0 70 53.0 71 43.5 72 37.5 73 31.0 74 28.0 75 17.5 76 9.5 77 11.5 78 8.5 79 4.0 80 1.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.0125 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0125 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0125 50-51 0.025 52-53 0.0125 54-55 0.025 56-57 0.0125 58-59 0.0125 60-61 0.025 62-63 0.0125 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0125 84-85 0.025 86-87 0.025 88-89 0.025 90-91 0.025 92-93 0.025 94-95 0.025 96-97 0.025 98-99 0.025 100-101 0.025 102-103 0.025 104-105 0.025 106-107 0.0125 108-109 0.025 110-111 0.025 112-113 0.025 114-115 0.025 116-117 0.025 118-119 0.025 120-121 0.025 122-123 0.025 124-125 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34525308486528 98.625 2 0.579199194157643 1.15 3 0.07554772097708386 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.6625000000000001 0.0 0.0 0.0 0.0 88-89 0.75 0.0 0.0 0.0 0.0 90-91 1.0125 0.0 0.0 0.0 0.0 92-93 1.525 0.0 0.0 0.0 0.0 94-95 1.9375 0.0 0.0 0.0 0.0 96-97 2.425 0.0 0.0 0.0 0.0 98-99 2.925 0.0 0.0 0.0 0.0 100-101 3.5625 0.0 0.0 0.0 0.0 102-103 4.074999999999999 0.0 0.0 0.0 0.0 104-105 4.7125 0.0 0.0 0.0 0.0 106-107 5.475 0.0 0.0 0.0 0.0 108-109 6.3125 0.0 0.0 0.0 0.0 110-111 7.300000000000001 0.0 0.0 0.0 0.0 112-113 8.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3691905 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691905_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.64575 34.0 33.0 34.0 32.0 34.0 2 33.1735 34.0 33.0 34.0 32.0 34.0 3 33.24375 34.0 33.0 34.0 32.0 34.0 4 33.2575 34.0 33.0 34.0 33.0 34.0 5 33.236 34.0 33.0 34.0 33.0 34.0 6 36.8425 38.0 37.0 38.0 35.0 38.0 7 37.18 38.0 38.0 38.0 36.0 38.0 8 37.361 38.0 38.0 38.0 37.0 38.0 9 37.45825 38.0 38.0 38.0 37.0 38.0 10-11 37.379125 38.0 38.0 38.0 37.0 38.0 12-13 37.321375 38.0 38.0 38.0 37.0 38.0 14-15 37.409375 38.0 38.0 38.0 37.0 38.0 16-17 37.40875 38.0 38.0 38.0 37.0 38.0 18-19 37.42975 38.0 38.0 38.0 37.0 38.0 20-21 37.432375 38.0 38.0 38.0 37.0 38.0 22-23 37.443749999999994 38.0 38.0 38.0 37.5 38.0 24-25 37.427375 38.0 38.0 38.0 37.0 38.0 26-27 37.403999999999996 38.0 38.0 38.0 37.0 38.0 28-29 37.392875000000004 38.0 38.0 38.0 37.0 38.0 30-31 37.412875 38.0 38.0 38.0 37.0 38.0 32-33 37.4165 38.0 38.0 38.0 37.0 38.0 34-35 37.359375 38.0 38.0 38.0 37.0 38.0 36-37 37.363375000000005 38.0 38.0 38.0 37.0 38.0 38-39 37.32875 38.0 38.0 38.0 37.0 38.0 40-41 37.18325 38.0 38.0 38.0 36.5 38.0 42-43 37.229124999999996 38.0 38.0 38.0 37.0 38.0 44-45 37.283249999999995 38.0 38.0 38.0 37.0 38.0 46-47 37.246625 38.0 38.0 38.0 37.0 38.0 48-49 37.286125 38.0 38.0 38.0 37.0 38.0 50-51 37.241625 38.0 38.0 38.0 36.5 38.0 52-53 37.2275 38.0 38.0 38.0 37.0 38.0 54-55 37.201875 38.0 38.0 38.0 36.0 38.0 56-57 37.198625 38.0 38.0 38.0 36.0 38.0 58-59 37.196375 38.0 38.0 38.0 36.5 38.0 60-61 37.185625 38.0 38.0 38.0 36.0 38.0 62-63 37.15275 38.0 38.0 38.0 36.0 38.0 64-65 37.177 38.0 38.0 38.0 36.0 38.0 66-67 37.1175 38.0 38.0 38.0 36.0 38.0 68-69 37.113749999999996 38.0 38.0 38.0 36.0 38.0 70-71 37.062125 38.0 38.0 38.0 36.0 38.0 72-73 37.10125 38.0 38.0 38.0 36.0 38.0 74-75 37.095 38.0 38.0 38.0 36.0 38.0 76-77 37.044875000000005 38.0 38.0 38.0 36.0 38.0 78-79 37.085125000000005 38.0 38.0 38.0 36.0 38.0 80-81 36.967 38.0 38.0 38.0 35.5 38.0 82-83 36.817625 38.0 38.0 38.0 35.0 38.0 84-85 36.82825 38.0 38.0 38.0 35.0 38.0 86-87 36.835 38.0 38.0 38.0 35.0 38.0 88-89 36.904875000000004 38.0 38.0 38.0 35.0 38.0 90-91 36.890625 38.0 38.0 38.0 35.0 38.0 92-93 36.833124999999995 38.0 38.0 38.0 34.5 38.0 94-95 36.92575 38.0 38.0 38.0 35.0 38.0 96-97 36.786500000000004 38.0 38.0 38.0 35.0 38.0 98-99 36.82575 38.0 38.0 38.0 35.0 38.0 100-101 36.805125000000004 38.0 38.0 38.0 35.0 38.0 102-103 36.752375 38.0 38.0 38.0 35.0 38.0 104-105 36.679625 38.0 38.0 38.0 34.5 38.0 106-107 36.763875 38.0 38.0 38.0 35.0 38.0 108-109 36.79275 38.0 38.0 38.0 34.5 38.0 110-111 36.648875000000004 38.0 38.0 38.0 34.0 38.0 112-113 36.574124999999995 38.0 38.0 38.0 34.0 38.0 114-115 36.569874999999996 38.0 38.0 38.0 34.0 38.0 116-117 36.459125 38.0 38.0 38.0 34.0 38.0 118-119 36.344375 38.0 38.0 38.0 34.0 38.0 120-121 36.250375 38.0 38.0 38.0 33.5 38.0 122-123 36.30075 38.0 38.0 38.0 33.5 38.0 124-125 36.260000000000005 38.0 38.0 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10-11 0.0 2309 12-13 0.0 2309 14-15 0.0 2309 16-17 0.0 2309 18-19 0.0 2309 20-21 0.0 2309 22-23 0.0 2309 24-25 0.0 2309 26-27 0.0 2309 28-29 0.0 2309 30-31 0.0 2309 32-33 0.0 2309 34-35 0.0 2309 36-37 0.0 2309 38-39 0.0 2309 40-41 0.0 2309 42-43 0.0 2309 44-45 0.0 2309 46-47 0.0 2309 48-49 0.0 2309 50-51 0.0 2309 52-53 0.0 2309 54-55 0.0 2309 56-57 0.0 2309 58-59 0.0 2309 60-61 0.0 2309 62-63 0.0 2309 64-65 0.0 2309 66-67 0.0 2309 68-69 0.0 2309 70-71 0.0 2309 72-73 0.0 2309 74-75 0.0 2309 76-77 0.0 2309 78-79 0.0 2309 80-81 0.0 2309 82-83 0.0 2309 84-85 0.0 2309 86-87 0.0 2309 88-89 0.0 2309 90-91 0.0 2309 92-93 0.0 2309 94-95 0.0 2309 96-97 0.0 2309 98-99 0.0 2309 100-101 0.0 2309 102-103 0.0 2309 104-105 0.0 2309 106-107 0.0 2309 108-109 0.0 2309 110-111 0.0 2309 112-113 0.0 2309 114-115 0.0 2309 116-117 0.0 2309 118-119 0.0 2309 120-121 0.0 2309 122-123 0.0 2309 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 0.0 23 4.0 24 3.0 25 8.0 26 7.0 27 15.0 28 29.0 29 30.0 30 30.0 31 45.0 32 35.0 33 84.0 34 101.0 35 143.0 36 370.0 37 3093.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 50.67688378033206 10.012771392081737 6.666666666666667 32.64367816091954 2 26.150000000000002 12.174999999999999 31.95 29.725 3 23.45 18.675 23.175 34.699999999999996 4 27.450000000000003 24.224999999999998 21.85 26.474999999999998 5 27.55 29.175 22.575 20.7 6 23.0 30.625000000000004 23.875 22.5 7 19.0 21.224999999999998 39.7 20.075000000000003 8 18.5 24.825 29.7 26.974999999999998 9 20.45 20.75 32.550000000000004 26.25 10-11 24.65 29.362500000000004 22.6125 23.375 12-13 23.8125 23.5375 25.974999999999998 26.674999999999997 14-15 21.95 25.624999999999996 26.2875 26.137500000000003 16-17 24.275 24.875 24.975 25.874999999999996 18-19 24.2875 25.35 24.75 25.6125 20-21 24.05 25.6 24.337500000000002 26.0125 22-23 24.2375 25.2 25.7 24.8625 24-25 23.8625 24.4875 24.9375 26.7125 26-27 24.2625 25.2375 24.9375 25.5625 28-29 23.9875 24.525 25.025 26.4625 30-31 23.471301738151805 25.57208953357509 24.65924721770664 26.297361510566464 32-33 23.225 25.2875 25.937500000000004 25.55 34-35 24.2625 25.4 24.9875 25.35 36-37 24.087500000000002 25.412499999999998 24.675 25.825 38-39 23.55294411801475 25.50318789848731 24.928116014501814 26.015751968996128 40-41 23.252906613326665 25.028128516064506 25.14064258032254 26.578322290286287 42-43 23.455863965991497 24.93123280820205 24.36859214803701 27.24431107776944 44-45 23.375 24.675 26.200000000000003 25.75 46-47 23.35 24.95 25.162499999999998 26.5375 48-49 24.01550193774222 25.240655081885237 24.72809101137642 26.015751968996128 50-51 23.3375 24.5625 25.4875 26.6125 52-53 24.087500000000002 24.4375 24.762500000000003 26.7125 54-55 23.8125 25.1875 25.112499999999997 25.887500000000003 56-57 23.35 24.337500000000002 26.2625 26.05 58-59 24.425 24.5375 24.55 26.487500000000004 60-61 23.215401925240656 25.51568946118265 24.603075384423054 26.665833229153645 62-63 24.45 24.474999999999998 24.7875 26.2875 64-65 25.124999999999996 24.4375 24.0375 26.400000000000002 66-67 23.646367387770415 25.497061398024258 23.93397524071527 26.92259597349006 68-69 24.746780042515944 23.93397524071527 24.70926597474053 26.60997874202826 70-71 24.968742185546386 24.33108277069267 24.306076519129782 26.39409852463116 72-73 24.0125 24.725 24.462500000000002 26.8 74-75 23.8625 24.637500000000003 25.15 26.35 76-77 24.525 24.45 25.15 25.874999999999996 78-79 24.275 25.3125 24.75 25.662499999999998 80-81 24.575 24.9 24.775 25.75 82-83 24.9125 25.412499999999998 23.0625 26.6125 84-85 23.95 24.625 24.9375 26.487500000000004 86-87 23.9875 24.95 24.6125 26.450000000000003 88-89 24.625 24.587500000000002 24.275 26.5125 90-91 24.099999999999998 25.124999999999996 24.0 26.775 92-93 24.087500000000002 25.15 24.212500000000002 26.55 94-95 24.9125 24.925 24.5125 25.650000000000002 96-97 24.762500000000003 24.4125 24.4375 26.387500000000003 98-99 24.5125 25.2375 24.25 26.0 100-101 24.6625 25.137500000000003 24.7375 25.4625 102-103 24.66558319789974 24.990623827978496 23.81547693461683 26.52831603950494 104-105 24.625 24.7 24.65 26.025 106-107 25.4375 24.9875 23.549999999999997 26.025 108-109 24.775 24.762500000000003 24.7375 25.724999999999998 110-111 24.5 25.374999999999996 24.525 25.6 112-113 25.55 26.05 23.1875 25.2125 114-115 24.575 26.05 22.825 26.55 116-117 25.35 24.9125 24.075 25.662499999999998 118-119 25.337500000000002 26.05 23.1 25.5125 120-121 26.0625 25.7625 22.3 25.874999999999996 122-123 24.875 27.1 22.6125 25.412499999999998 124-125 24.837500000000002 26.0125 22.775000000000002 26.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 2.0 25 2.5 26 2.0 27 1.5 28 4.0 29 5.0 30 9.0 31 15.0 32 18.0 33 19.0 34 25.5 35 33.5 36 44.5 37 67.0 38 79.5 39 99.5 40 110.0 41 125.0 42 151.0 43 169.5 44 182.5 45 173.5 46 175.5 47 186.0 48 180.0 49 155.0 50 132.5 51 129.0 52 129.0 53 137.0 54 138.0 55 109.0 56 106.0 57 97.5 58 84.5 59 87.0 60 78.5 61 72.5 62 61.0 63 56.5 64 56.0 65 59.5 66 62.5 67 56.0 68 52.0 69 48.0 70 39.5 71 30.5 72 26.0 73 26.0 74 26.0 75 22.5 76 14.0 77 8.5 78 6.0 79 6.5 80 4.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0375 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0125 40-41 0.0125 42-43 0.025 44-45 0.0 46-47 0.0 48-49 0.0125 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0125 62-63 0.0 64-65 0.0 66-67 0.0375 68-69 0.0375 70-71 0.025 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0125 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14228052472251 98.25 2 0.8072653884964682 1.6 3 0.050454086781029264 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.36250000000000004 0.0 0.0 0.0 0.0 80-81 0.45 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.8625 0.0 0.0 0.0 0.0 90-91 1.1875 0.0 0.0 0.0 0.0 92-93 1.7125 0.0 0.0 0.0 0.0 94-95 2.1875 0.0 0.0 0.0 0.0 96-97 2.65 0.0 0.0 0.0 0.0 98-99 3.1875 0.0 0.0 0.0 0.0 100-101 3.7875 0.0 0.0 0.0 0.0 102-103 4.300000000000001 0.0 0.0 0.0 0.0 104-105 4.9 0.0 0.0 0.0 0.0 106-107 5.6125 0.0 0.0 0.0 0.0 108-109 6.425 0.0 0.0 0.0 0.0 110-111 7.4375 0.0 0.0 0.0 0.0 112-113 8.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1215417 spots for SRR3691905.sra Written 1215417 spots for SRR3691905.sra Read 1215417 spots for SRR3691905.sra Written 1215417 spots for SRR3691905.sra Read 1215417 spots for SRR3691905.sra Written 1215417 spots for SRR3691905.sra Read 1215417 spots for SRR3691905.sra Written 1215417 spots for SRR3691905.sra Read 1215417 spots for SRR3691905.sra Written 1215417 spots for SRR3691905.sra Read 1215417 spots for SRR3691905.sra Written 1215417 spots for SRR3691905.sra Read 1215417 spots for SRR3691905.sra Written 1215417 spots for SRR3691905.sra Read 1215417 spots for SRR3691905.sra Written 1215417 spots for SRR3691905.sra Read 1215417 spots for SRR3691905.sra Written 1215417 spots for SRR3691905.sra Read 1215417 spots for SRR3691905.sra Written 1215417 spots for SRR3691905.sra Read 1215417 spots for SRR3691905.sra Written 1215417 spots for SRR3691905.sra Read 1215429 spots for SRR3691905.sra Written 1215429 spots for SRR3691905.sra Read 1215417 spots for SRR3691905.sra Written 1215417 spots for SRR3691905.sra Read 1215417 spots for SRR3691905.sra Written 1215417 spots for SRR3691905.sra Read 1215417 spots for SRR3691905.sra Written 1215417 spots for SRR3691905.sra Read 1215417 spots for SRR3691905.sra Written 1215417 spots for SRR3691905.sra Read 1215417 spots for SRR3691905.sra Written 1215417 spots for SRR3691905.sra Read 1215417 spots for SRR3691905.sra Written 1215417 spots for SRR3691905.sra Read 1215417 spots for SRR3691905.sra Written 1215417 spots for SRR3691905.sra Read 1215417 spots for SRR3691905.sra Written 1215417 spots for SRR3691905.sra SRR ids: ['SRR3691905.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kmp6br_g SRR3691905.sra spots: 24308352 blocks: [[1, 1215417], [1215418, 2430834], [2430835, 3646251], [3646252, 4861668], [4861669, 6077085], [6077086, 7292502], [7292503, 8507919], [8507920, 9723336], [9723337, 10938753], [10938754, 12154170], [12154171, 13369587], [13369588, 14585004], [14585005, 15800421], [15800422, 17015838], [17015839, 18231255], [18231256, 19446672], [19446673, 20662089], [20662090, 21877506], [21877507, 23092923], [23092924, 24308352]] SRR3691905 file size 7739451 SRR3691905 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3691905 SRR3691905_1.fastq SRR3691905_2.fastq Input file: SRR3691905_1.fastq Paired file: SRR3691905_2.fastq trimmed: SRR3691905-trimmed-pair1.fastq, SRR3691905-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:03:32 2024 >> started Tue Dec 10 00:03:56 2024 >> done (24.328s) 24308352 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 979 ( 0.00%) empty read pairs filtered out after trimming by size control 24307371 (100.00%) read pairs available; of these: 2457849 (10.11%) trimmed read pairs available after processing 21849522 (89.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 80 43 0.00% 81 138 0.00% 82 34 0.00% 83 2 0.00% 84 0 0.00% 85 0 0.00% 86 0 0.00% 87 0 0.00% 88 0 0.00% 89 0 0.00% 90 0 0.00% 91 0 0.00% 92 0 0.00% 93 0 0.00% 94 0 0.00% 95 0 0.00% 96 83 0.00% 97 64 0.00% 98 30 0.00% 99 462 0.00% 100 697 0.00% 101 576 0.00% 102 452 0.00% 103 1399 0.01% 104 255 0.00% 105 2003 0.01% 106 9 0.00% 107 8 0.00% 108 53 0.00% 109 645 0.00% 110 1813 0.01% 111 15801 0.07% 112 152606 0.63% 113 157853 0.65% 114 165673 0.68% 115 174186 0.72% 116 181261 0.75% 117 184445 0.76% 118 186245 0.77% 119 188201 0.77% 120 192452 0.79% 121 235399 0.97% 122 198161 0.82% 123 204548 0.84% 124 212252 0.87% 125 21849522 89.89% 24307371 reads passed initial QC criterion=sequence-density sequence-density=8.20 sequence-density-rank=1 fanout-score=33.23 fanout-score-rank=1 prefix-density=8.39 prefix-fanout=32.5 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA criterion=fanout-score sequence-density=8.20 sequence-density-rank=1 fanout-score=33.23 fanout-score-rank=1 prefix-density=8.39 prefix-fanout=32.5 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA criterion=sequence-density sequence-density=8.31 sequence-density-rank=1 fanout-score=42.55 fanout-score-rank=2 prefix-density=8.36 prefix-fanout=42.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=17 fanout-score=229.68 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=14.4 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -y AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3691905 SRR3691905_1.fastq SRR3691905_2.fastq Input file: SRR3691905_1.fastq Paired file: SRR3691905_2.fastq trimmed: SRR3691905-trimmed-pair1.fastq, SRR3691905-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:06:40 2024 >> started Tue Dec 10 00:07:02 2024 >> done (22.750s) 18905733 read pairs processed; of these: 126 ( 0.00%) short read pairs filtered out after trimming by size control 3933 ( 0.02%) empty read pairs filtered out after trimming by size control 18901674 (99.98%) read pairs available; of these: 1698609 ( 8.99%) trimmed read pairs available after processing 17203065 (91.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 2 0.00% 21 3 0.00% 22 1 0.00% 23 3 0.00% 24 3 0.00% 25 0 0.00% 26 5 0.00% 27 4 0.00% 28 12 0.00% 29 8 0.00% 30 10 0.00% 31 6 0.00% 32 23 0.00% 33 20 0.00% 34 25 0.00% 35 31 0.00% 36 38 0.00% 37 60 0.00% 38 59 0.00% 39 58 0.00% 40 63 0.00% 41 99 0.00% 42 117 0.00% 43 89 0.00% 44 101 0.00% 45 106 0.00% 46 117 0.00% 47 156 0.00% 48 189 0.00% 49 225 0.00% 50 282 0.00% 51 276 0.00% 52 335 0.00% 53 350 0.00% 54 395 0.00% 55 362 0.00% 56 449 0.00% 57 452 0.00% 58 583 0.00% 59 663 0.00% 60 844 0.00% 61 933 0.00% 62 1121 0.01% 63 1223 0.01% 64 1285 0.01% 65 1398 0.01% 66 1579 0.01% 67 1812 0.01% 68 1980 0.01% 69 2179 0.01% 70 2642 0.01% 71 2963 0.02% 72 3554 0.02% 73 4011 0.02% 74 4501 0.02% 75 5150 0.03% 76 5543 0.03% 77 6193 0.03% 78 6800 0.04% 79 7682 0.04% 80 8568 0.05% 81 10179 0.05% 82 11446 0.06% 83 13085 0.07% 84 14722 0.08% 85 16476 0.09% 86 17891 0.09% 87 19603 0.10% 88 21864 0.12% 89 23385 0.12% 90 26382 0.14% 91 29301 0.16% 92 32356 0.17% 93 35871 0.19% 94 40174 0.21% 95 44382 0.23% 96 47413 0.25% 97 50974 0.27% 98 53995 0.29% 99 58021 0.31% 100 62947 0.33% 101 66648 0.35% 102 72225 0.38% 103 78304 0.41% 104 82855 0.44% 105 89994 0.48% 106 93401 0.49% 107 96499 0.51% 108 101378 0.54% 109 105739 0.56% 110 109353 0.58% 111 112684 0.60% 112 119044 0.63% 113 122839 0.65% 114 128786 0.68% 115 135658 0.72% 116 140588 0.74% 117 143495 0.76% 118 144958 0.77% 119 146159 0.77% 120 149591 0.79% 121 179252 0.95% 122 154033 0.81% 123 158884 0.84% 124 165019 0.87% 125 15296076 80.92% criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=21 prefix-density=0.29 prefix-fanout=2.5 sequence=CAAGGCTAAATAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=134.34 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=16.5 sequence=CCGGCGGCGGCAACTGGAGGGAGTGAATGGTGGGGCCCCTCGTGGCCAGTTATCCTTGTTACCTTTTATCTGTGATGTTATCGCTCCCGAGTATCCTAGATCTCGCTCCATCGCGTAGGGTTTGAGATGTTTAAGGGTTACCATTAGGTGTTTGTCCGTGATGCTACCTGTCGTGTGTTCCTGTTCTGTTCCGTTCGCTATCCCTATGAATGAATGAAAAAAGAATGA criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=28 prefix-density=0.37 prefix-fanout=2.0 sequence=GTATTTAGCCTTGGACGGAGTCTACCGCCCGATTTGGGCTGCATTCCCAAACAACCCGACTCGTTGACGGCGCCTCGTGGGGCGACAGGGTCCGGGCCGGACGGGGCTCTCACCCTCCCAGGCGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGTCGCTGAGGACGCCTCTCCAGACTACAATTCGGACGGCACGGCCGCCCGATTCTCAAGCTGGGCTGCTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTCTCCTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=247.48 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=14.4 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC SRR3691905 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:07:56 Started mapping on | Dec 10 00:07:56 Finished on | Dec 10 00:09:24 Mapping speed, Million of reads per hour | 994.23 Number of input reads | 24303312 Average input read length | 245 UNIQUE READS: Uniquely mapped reads number | 21336792 Uniquely mapped reads % | 87.79% Average mapped length | 243.94 Number of splices: Total | 15887859 Number of splices: Annotated (sjdb) | 14934153 Number of splices: GT/AG | 15666378 Number of splices: GC/AG | 186427 Number of splices: AT/AC | 8164 Number of splices: Non-canonical | 26890 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.05 Insertion rate per base | 0.01% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 797430 % of reads mapped to multiple loci | 3.28% Number of reads mapped to too many loci | 171535 % of reads mapped to too many loci | 0.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.10% % of reads unmapped: other | 3.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2169237 2169237 2169237 N_multimapping 797430 797430 797430 N_noFeature 1033076 1268004 20700129 N_ambiguous 465261 63648 2504 UnstrandedReadsAssigned:19838455 PositiveStrandReadsAssigned:20005140 NegativeStrandReadsAssigned:634159 Dataset is classified positive stranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR3691905 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3691905-trimmed-pair1.fastq SRR3691905-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,303,312 reads, 20,641,254 reads pseudoaligned [quant] estimated average fragment length: 168.025 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52973 SRR3691905.ke.tsv 35125 SRR3691905.se.tsv 88098 total ==> SRR3691905.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 769.162 0 0 PNS24247 1044 876.975 92.5232 7.37494 PNS24249 1928 1760.98 260.098 10.3248 PNS24246 1044 876.975 92.5232 7.37494 PNS24248 1044 876.975 92.5232 7.37494 PNS24244 1471 1303.98 94.3322 5.05692 PNS24243 293 133.063 0 0 KQK14069 1603 1435.98 35481.3 1727.22 KQK14071 474 308.873 2287.68 517.739 ==> SRR3691905.se.tsv <== BRADI_1g14170v3 40163 BRADI_1g53295v3 37 BRADI_1g59795v3 1291 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 231 BRADI_1g74790v3 226 BRADI_1g09890v3 0 BRADI_1g77505v3 347 BRADI_1g48960v3 0 SRR3691905 completed mapping pipeline successfully