Starting /dee2/code/volunteer_pipeline.sh SRR3691906 current disk space = 1523589177344 free memory = 1571370748 SRR3691906 SRAfilesize 5ed172523d41e8144e81d64910ef9be8 SRR3691906.sra SRR3691906.sra file validated SRR3691906 is paired end SRR3691906 is conventional basespace SRR3691906 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691906_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6925 34.0 33.0 34.0 32.0 34.0 2 33.18175 34.0 33.0 34.0 32.0 34.0 3 33.17225 34.0 33.0 34.0 32.0 34.0 4 33.26425 34.0 33.0 34.0 32.0 34.0 5 33.25925 34.0 33.0 34.0 32.0 34.0 6 36.71675 38.0 37.0 38.0 34.0 38.0 7 37.20725 38.0 38.0 38.0 36.0 38.0 8 37.3495 38.0 38.0 38.0 37.0 38.0 9 37.416 38.0 38.0 38.0 37.0 38.0 10-11 37.461875 38.0 38.0 38.0 37.0 38.0 12-13 37.40175 38.0 38.0 38.0 37.0 38.0 14-15 37.370625 38.0 38.0 38.0 37.0 38.0 16-17 37.473749999999995 38.0 38.0 38.0 37.5 38.0 18-19 37.477500000000006 38.0 38.0 38.0 37.0 38.0 20-21 37.449375 38.0 38.0 38.0 37.0 38.0 22-23 37.4725 38.0 38.0 38.0 38.0 38.0 24-25 37.454750000000004 38.0 38.0 38.0 37.0 38.0 26-27 37.4485 38.0 38.0 38.0 37.0 38.0 28-29 37.45625 38.0 38.0 38.0 37.0 38.0 30-31 37.406125 38.0 38.0 38.0 37.0 38.0 32-33 37.398250000000004 38.0 38.0 38.0 37.0 38.0 34-35 37.429249999999996 38.0 38.0 38.0 37.0 38.0 36-37 37.350875 38.0 38.0 38.0 37.0 38.0 38-39 37.368375 38.0 38.0 38.0 37.0 38.0 40-41 37.25025 38.0 38.0 38.0 37.0 38.0 42-43 37.298875 38.0 38.0 38.0 37.0 38.0 44-45 37.293625000000006 38.0 38.0 38.0 37.0 38.0 46-47 37.285 38.0 38.0 38.0 37.0 38.0 48-49 37.2725 38.0 38.0 38.0 37.0 38.0 50-51 37.2485 38.0 38.0 38.0 37.0 38.0 52-53 37.275999999999996 38.0 38.0 38.0 37.0 38.0 54-55 37.258375 38.0 38.0 38.0 36.5 38.0 56-57 37.222375 38.0 38.0 38.0 36.0 38.0 58-59 37.24025 38.0 38.0 38.0 36.5 38.0 60-61 37.20825 38.0 38.0 38.0 36.0 38.0 62-63 37.24275 38.0 38.0 38.0 36.5 38.0 64-65 37.207875 38.0 38.0 38.0 36.5 38.0 66-67 37.21325 38.0 38.0 38.0 36.0 38.0 68-69 37.14175 38.0 38.0 38.0 36.0 38.0 70-71 37.177125000000004 38.0 38.0 38.0 36.0 38.0 72-73 37.133125 38.0 38.0 38.0 36.0 38.0 74-75 37.196 38.0 38.0 38.0 36.0 38.0 76-77 37.124624999999995 38.0 38.0 38.0 36.0 38.0 78-79 37.092625 38.0 38.0 38.0 36.0 38.0 80-81 37.121624999999995 38.0 38.0 38.0 36.0 38.0 82-83 37.008625 38.0 38.0 38.0 36.0 38.0 84-85 37.018249999999995 38.0 38.0 38.0 35.5 38.0 86-87 37.032875 38.0 38.0 38.0 36.0 38.0 88-89 36.997 38.0 38.0 38.0 36.0 38.0 90-91 37.02275 38.0 38.0 38.0 35.5 38.0 92-93 36.9345 38.0 38.0 38.0 35.0 38.0 94-95 36.99525 38.0 38.0 38.0 36.0 38.0 96-97 36.917 38.0 38.0 38.0 35.0 38.0 98-99 36.841375 38.0 38.0 38.0 35.0 38.0 100-101 36.824749999999995 38.0 38.0 38.0 35.0 38.0 102-103 36.867000000000004 38.0 38.0 38.0 35.0 38.0 104-105 36.856125000000006 38.0 38.0 38.0 35.0 38.0 106-107 36.8825 38.0 38.0 38.0 35.0 38.0 108-109 36.8745 38.0 38.0 38.0 35.0 38.0 110-111 36.738375000000005 38.0 38.0 38.0 35.0 38.0 112-113 36.71525 38.0 38.0 38.0 34.5 38.0 114-115 36.6035 38.0 38.0 38.0 34.0 38.0 116-117 36.581625 38.0 38.0 38.0 34.0 38.0 118-119 36.4705 38.0 38.0 38.0 34.0 38.0 120-121 36.43925 38.0 38.0 38.0 34.0 38.0 122-123 36.462374999999994 38.0 38.0 38.0 34.0 38.0 124-125 36.382000000000005 38.0 38.0 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10-11 0.0 2309 12-13 0.0 2309 14-15 0.0 2309 16-17 0.0 2309 18-19 0.0 2309 20-21 0.0 2309 22-23 0.0 2309 24-25 0.0 2309 26-27 0.0 2309 28-29 0.0 2309 30-31 0.0 2309 32-33 0.0 2309 34-35 0.0 2309 36-37 0.0 2309 38-39 0.0 2309 40-41 0.0 2309 42-43 0.0 2309 44-45 0.0 2309 46-47 0.0 2309 48-49 0.0 2309 50-51 0.0 2309 52-53 0.0 2309 54-55 0.0 2309 56-57 0.0 2309 58-59 0.0 2309 60-61 0.0 2309 62-63 0.0 2309 64-65 0.0 2309 66-67 0.0 2309 68-69 0.0 2309 70-71 0.0 2309 72-73 0.0 2309 74-75 0.0 2309 76-77 0.0 2309 78-79 0.0 2309 80-81 0.0 2309 82-83 0.0 2309 84-85 0.0 2309 86-87 0.0 2309 88-89 0.0 2309 90-91 0.0 2309 92-93 0.0 2309 94-95 0.0 2309 96-97 0.0 2309 98-99 0.0 2309 100-101 0.0 2309 102-103 0.0 2309 104-105 0.0 2309 106-107 0.0 2309 108-109 0.0 2309 110-111 0.0 2309 112-113 0.0 2309 114-115 0.0 2309 116-117 0.0 2309 118-119 0.0 2309 120-121 0.0 2309 122-123 0.0 2309 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 9.0 25 5.0 26 6.0 27 9.0 28 22.0 29 22.0 30 33.0 31 34.0 32 40.0 33 78.0 34 107.0 35 158.0 36 377.0 37 3098.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.45686574783053 10.234813680449209 7.605921388463502 36.70239918325676 2 22.85 14.875 33.5 28.775000000000002 3 22.85 19.400000000000002 24.075 33.675 4 27.025 25.974999999999998 22.025 24.975 5 26.200000000000003 30.2 22.325 21.275 6 21.435717858929465 33.366683341670836 23.311655827913956 21.885942971485743 7 17.349999999999998 23.075000000000003 38.0 21.575 8 19.650000000000002 23.175 30.5 26.674999999999997 9 20.025000000000002 22.675 32.975 24.325 10-11 23.3375 29.6375 22.8 24.224999999999998 12-13 23.2625 24.349999999999998 26.3625 26.025 14-15 22.8875 25.15 26.9625 25.0 16-17 24.075 25.9625 24.725 25.2375 18-19 22.7625 26.900000000000002 24.8625 25.474999999999998 20-21 22.8375 26.174999999999997 25.387500000000003 25.6 22-23 23.7 25.587500000000002 25.2625 25.45 24-25 23.3125 25.4625 24.75 26.474999999999998 26-27 22.912499999999998 26.5125 25.8125 24.762500000000003 28-29 23.400000000000002 25.775 25.15 25.674999999999997 30-31 23.265408176022003 25.815726965870734 25.465683210401302 25.453181647705964 32-33 23.4375 25.4 25.624999999999996 25.5375 34-35 23.925 24.962500000000002 26.087500000000002 25.025 36-37 23.2375 25.6 25.1 26.0625 38-39 23.25 24.95 26.0 25.8 40-41 23.8625 25.5 25.162499999999998 25.474999999999998 42-43 23.49043630453807 24.953119139892486 25.640705088136016 25.91573946743343 44-45 22.8875 25.8 25.7 25.6125 46-47 22.975 26.237500000000004 24.975 25.8125 48-49 22.95 25.937500000000004 24.887500000000003 26.224999999999998 50-51 23.3 25.6 25.374999999999996 25.724999999999998 52-53 23.775 25.650000000000002 25.5125 25.0625 54-55 23.200000000000003 25.174999999999997 26.1 25.525 56-57 22.912499999999998 25.575 25.6125 25.900000000000002 58-59 24.45 26.1125 23.974999999999998 25.4625 60-61 22.8875 26.0125 25.15 25.95 62-63 23.05 25.775 25.374999999999996 25.8 64-65 24.025 25.825 25.0375 25.112499999999997 66-67 22.802850356294538 25.803225403175396 25.078134766845857 26.31578947368421 68-69 23.225 24.3125 26.087500000000002 26.375 70-71 24.2 25.137500000000003 25.45 25.2125 72-73 24.4 25.687500000000004 24.1875 25.724999999999998 74-75 23.275000000000002 25.7375 25.2375 25.75 76-77 24.0625 25.55 24.7375 25.650000000000002 78-79 23.0375 25.575 24.725 26.6625 80-81 23.8125 24.762500000000003 25.05 26.375 82-83 24.025 24.9125 25.0125 26.05 84-85 24.2375 24.762500000000003 24.8625 26.137500000000003 86-87 24.5125 25.5375 24.6875 25.2625 88-89 24.125 26.224999999999998 24.1625 25.4875 90-91 24.1875 25.575 24.45 25.7875 92-93 24.7375 25.2375 23.8375 26.187500000000004 94-95 25.7625 25.637500000000003 23.9375 24.6625 96-97 24.762500000000003 26.075 24.275 24.887500000000003 98-99 24.625 25.825 24.275 25.275 100-101 24.5375 25.775 24.4 25.2875 102-103 24.75 26.2125 23.962500000000002 25.074999999999996 104-105 24.525 26.400000000000002 23.849999999999998 25.224999999999998 106-107 24.8 26.1 24.099999999999998 25.0 108-109 24.9375 25.8625 23.45 25.75 110-111 24.474999999999998 25.9625 24.125 25.4375 112-113 25.112499999999997 26.224999999999998 23.3875 25.275 114-115 24.9875 26.6 22.6375 25.775 116-117 24.625 27.1 22.725 25.55 118-119 24.925 26.900000000000002 22.8125 25.362499999999997 120-121 25.3 26.987499999999997 22.125 25.587500000000002 122-123 24.837500000000002 27.9375 22.112499999999997 25.112499999999997 124-125 24.45 27.3 22.725 25.525 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 1.0 26 2.5 27 3.5 28 2.5 29 4.5 30 7.0 31 10.0 32 16.5 33 29.0 34 42.0 35 46.0 36 58.5 37 75.0 38 89.5 39 102.0 40 123.5 41 154.5 42 165.5 43 169.5 44 187.5 45 187.0 46 184.5 47 190.0 48 195.5 49 176.5 50 142.5 51 130.0 52 111.0 53 108.0 54 114.0 55 112.5 56 102.5 57 86.5 58 75.0 59 64.5 60 64.5 61 71.5 62 71.0 63 70.5 64 65.0 65 49.0 66 43.5 67 48.5 68 44.0 69 36.0 70 31.5 71 29.0 72 23.0 73 24.0 74 20.5 75 11.0 76 9.5 77 5.5 78 3.0 79 2.0 80 2.5 81 1.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0125 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0125 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.32499999999999996 0.0 0.0 0.0 0.0 76-77 0.475 0.0 0.0 0.0 0.0 78-79 0.525 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.875 0.0 0.0 0.0 0.0 84-85 1.0875 0.0 0.0 0.0 0.0 86-87 1.3 0.0 0.0 0.0 0.0 88-89 1.6749999999999998 0.0 0.0 0.0 0.0 90-91 2.275 0.0 0.0 0.0 0.0 92-93 2.925 0.0 0.0 0.0 0.0 94-95 3.5 0.0 0.0 0.0 0.0 96-97 4.125 0.0 0.0 0.0 0.0 98-99 4.8375 0.0 0.0 0.0 0.0 100-101 5.8125 0.0 0.0 0.0 0.0 102-103 6.775 0.0 0.0 0.0 0.0 104-105 7.925 0.0 0.0 0.0 0.0 106-107 9.4 0.0 0.0 0.0 0.0 108-109 10.775 0.0 0.0 0.0 0.0 110-111 12.5625 0.0 0.0 0.0 0.0 112-113 14.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3691906 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691906_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96125 33.0 33.0 34.0 32.0 34.0 2 33.0235 34.0 33.0 34.0 32.0 34.0 3 33.063 34.0 33.0 34.0 32.0 34.0 4 32.99175 34.0 33.0 34.0 32.0 34.0 5 32.96325 34.0 33.0 34.0 32.0 34.0 6 37.0905 38.0 38.0 38.0 36.0 38.0 7 37.09175 38.0 38.0 38.0 36.0 38.0 8 37.178 38.0 38.0 38.0 37.0 38.0 9 37.1125 38.0 38.0 38.0 37.0 38.0 10-11 37.176875 38.0 38.0 38.0 37.0 38.0 12-13 37.143 38.0 38.0 38.0 37.0 38.0 14-15 37.048500000000004 38.0 38.0 38.0 36.0 38.0 16-17 37.167 38.0 38.0 38.0 36.5 38.0 18-19 37.104124999999996 38.0 38.0 38.0 36.5 38.0 20-21 37.193 38.0 38.0 38.0 37.0 38.0 22-23 37.195625 38.0 38.0 38.0 37.0 38.0 24-25 37.199375 38.0 38.0 38.0 37.0 38.0 26-27 37.233625 38.0 38.0 38.0 37.0 38.0 28-29 37.178625 38.0 38.0 38.0 37.0 38.0 30-31 37.154624999999996 38.0 38.0 38.0 37.0 38.0 32-33 37.244249999999994 38.0 38.0 38.0 37.0 38.0 34-35 37.244375 38.0 38.0 38.0 37.0 38.0 36-37 37.200374999999994 38.0 38.0 38.0 37.0 38.0 38-39 37.240625 38.0 38.0 38.0 37.0 38.0 40-41 37.234125000000006 38.0 38.0 38.0 37.0 38.0 42-43 37.199875 38.0 38.0 38.0 36.5 38.0 44-45 37.171875 38.0 38.0 38.0 37.0 38.0 46-47 37.105625 38.0 38.0 38.0 37.0 38.0 48-49 37.21025 38.0 38.0 38.0 37.0 38.0 50-51 37.15075 38.0 38.0 38.0 36.5 38.0 52-53 37.086749999999995 38.0 38.0 38.0 37.0 38.0 54-55 37.111625000000004 38.0 38.0 38.0 36.0 38.0 56-57 37.15375 38.0 38.0 38.0 37.0 38.0 58-59 37.052625 38.0 38.0 38.0 36.5 38.0 60-61 37.103875 38.0 38.0 38.0 36.5 38.0 62-63 37.135875 38.0 38.0 38.0 36.0 38.0 64-65 37.206125 38.0 38.0 38.0 37.0 38.0 66-67 37.106375 38.0 38.0 38.0 36.5 38.0 68-69 37.15525 38.0 38.0 38.0 36.5 38.0 70-71 37.112625 38.0 38.0 38.0 36.0 38.0 72-73 37.07075 38.0 38.0 38.0 36.0 38.0 74-75 36.953125 38.0 38.0 38.0 36.0 38.0 76-77 37.029375 38.0 38.0 38.0 36.0 38.0 78-79 37.018 38.0 38.0 38.0 36.0 38.0 80-81 37.054249999999996 38.0 38.0 38.0 36.0 38.0 82-83 37.022 38.0 38.0 38.0 36.0 38.0 84-85 36.88425 38.0 38.0 38.0 35.5 38.0 86-87 36.890625 38.0 38.0 38.0 36.0 38.0 88-89 36.91125 38.0 38.0 38.0 36.0 38.0 90-91 36.915125 38.0 38.0 38.0 35.5 38.0 92-93 36.844750000000005 38.0 38.0 38.0 35.0 38.0 94-95 36.857749999999996 38.0 38.0 38.0 35.0 38.0 96-97 36.834500000000006 38.0 38.0 38.0 35.0 38.0 98-99 36.885875 38.0 38.0 38.0 35.0 38.0 100-101 36.819 38.0 38.0 38.0 35.0 38.0 102-103 36.78575 38.0 38.0 38.0 35.0 38.0 104-105 36.643375 38.0 38.0 38.0 34.5 38.0 106-107 36.545625 38.0 38.0 38.0 34.0 38.0 108-109 36.64425 38.0 38.0 38.0 34.5 38.0 110-111 36.460375 38.0 38.0 38.0 34.0 38.0 112-113 36.322500000000005 38.0 38.0 38.0 34.0 38.0 114-115 36.336124999999996 38.0 38.0 38.0 33.0 38.0 116-117 36.363875 38.0 38.0 38.0 33.0 38.0 118-119 36.215375 38.0 38.0 38.0 33.0 38.0 120-121 36.349125 38.0 38.0 38.0 33.0 38.0 122-123 36.150999999999996 38.0 38.0 38.0 32.5 38.0 124-125 36.085875 38.0 38.0 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10-11 0.0 2309 12-13 0.0 2309 14-15 0.0 2309 16-17 0.0 2309 18-19 0.0 2309 20-21 0.0 2309 22-23 0.0 2309 24-25 0.0 2309 26-27 0.0 2309 28-29 0.0 2309 30-31 0.0 2309 32-33 0.0 2309 34-35 0.0 2309 36-37 0.0 2309 38-39 0.0 2309 40-41 0.0 2309 42-43 0.0 2309 44-45 0.0 2309 46-47 0.0 2309 48-49 0.0 2309 50-51 0.0 2309 52-53 0.0 2309 54-55 0.0 2309 56-57 0.0 2309 58-59 0.0 2309 60-61 0.0 2309 62-63 0.0 2309 64-65 0.0 2309 66-67 0.0 2309 68-69 0.0 2309 70-71 0.0 2309 72-73 0.0 2309 74-75 0.0 2309 76-77 0.0 2309 78-79 0.0 2309 80-81 0.0 2309 82-83 0.0 2309 84-85 0.0 2309 86-87 0.0 2309 88-89 0.0 2309 90-91 0.0 2309 92-93 0.0 2309 94-95 0.0 2309 96-97 0.0 2309 98-99 0.0 2309 100-101 0.0 2309 102-103 0.0 2309 104-105 0.0 2309 106-107 0.0 2309 108-109 0.0 2309 110-111 0.0 2309 112-113 0.0 2309 114-115 0.0 2309 116-117 0.0 2309 118-119 0.0 2309 120-121 0.0 2309 122-123 0.0 2309 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 3.0 19 2.0 20 2.0 21 2.0 22 4.0 23 6.0 24 7.0 25 5.0 26 19.0 27 18.0 28 19.0 29 32.0 30 41.0 31 44.0 32 66.0 33 69.0 34 85.0 35 150.0 36 322.0 37 3102.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.720860430215104 18.584292146073036 10.405202601300651 29.289644822411205 2 29.739869934967484 22.26113056528264 28.189094547273637 19.809904952476238 3 22.436218109054526 24.712356178089045 29.089544772386194 23.761880940470235 4 26.96348174087044 30.84042021010505 19.484742371185593 22.71135567783892 5 28.83941970985493 33.96698349174587 18.05902951475738 19.13456728364182 6 23.21160580290145 33.84192096048024 20.810405202601302 22.136068034017008 7 23.736868434217108 18.90945472736368 33.41670835417709 23.936968484242122 8 23.186593296648326 21.235617808904454 25.56278139069535 30.015007503751878 9 23.71185592796398 21.635817908954476 28.264132066033014 26.388194097048522 10-11 27.03851925962982 27.651325662831418 20.647823911955978 24.662331165582792 12-13 26.263131565782892 23.06153076538269 24.987493746873437 25.68784392196098 14-15 25.53776888444222 25.50025012506253 25.03751875937969 23.92446223111556 16-17 26.538269134567283 24.92496248124062 23.58679339669835 24.949974987493746 18-19 26.28814407203602 24.112056028014006 24.499749874937468 25.100050025012504 20-21 25.22511255627814 25.012506253126567 25.887943971985994 23.874437218609305 22-23 26.28485682130799 25.934725522070778 23.983993997749156 23.796423658872076 24-25 26.013006503251624 24.187093546773387 25.137568784392194 24.662331165582792 26-27 25.07503751875938 25.287643821910955 25.287643821910955 24.349674837418707 28-29 26.663331665832917 24.912456228114056 24.92496248124062 23.499249624812407 30-31 25.737868934467233 24.349674837418707 25.100050025012504 24.81240620310155 32-33 25.050025012506254 25.26263131565783 24.72486243121561 24.96248124062031 34-35 26.450725362681343 24.437218609304654 24.324662331165584 24.787393696848426 36-37 25.468867216804203 25.143785946486624 24.118529632408105 25.268817204301076 38-39 25.206301575393848 25.6064016004001 24.568642160540136 24.618654663665918 40-41 26.750875437718857 24.662331165582792 24.72486243121561 23.861930965482742 42-43 26.163081540770385 24.524762381190595 25.18759379689845 24.12456228114057 44-45 26.063031515757878 24.399699849924964 25.287643821910955 24.249624812406203 46-47 26.18809404702351 24.674837418709355 25.287643821910955 23.84942471235618 48-49 26.350675337668832 24.69984992496248 25.125062531265634 23.82441220610305 50-51 25.662831415707853 25.87543771885943 24.68734367183592 23.774387193596798 52-53 25.937968984492244 24.937468734367183 24.087043521760883 25.03751875937969 54-55 25.887943971985994 24.212106053026513 26.138069034517258 23.761880940470235 56-57 25.512756378189096 25.50025012506253 25.062531265632813 23.92446223111556 58-59 25.83791895947974 25.200100050025014 25.012506253126567 23.949474737368686 60-61 25.72536268134067 24.562281140570285 25.50025012506253 24.212106053026513 62-63 25.887943971985994 25.012506253126567 25.200100050025014 23.899449724862432 64-65 26.76338169084542 25.062531265632813 24.23711855927964 23.936968484242122 66-67 25.700350175087543 25.087543771885944 25.325162581290645 23.88694347173587 68-69 26.313156578289142 24.599799899949975 25.86293146573287 23.224112056028016 70-71 25.87543771885943 25.15007503751876 24.787393696848426 24.187093546773387 72-73 25.83791895947974 25.22511255627814 25.775387693846923 23.1615807903952 74-75 25.65032516258129 25.162581290645324 25.737868934467233 23.449224612306153 76-77 25.950475237618807 26.125562781390695 24.712356178089045 23.21160580290145 78-79 26.76338169084542 24.68734367183592 24.787393696848426 23.761880940470235 80-81 25.56278139069535 25.60030015007504 24.88744372186093 23.949474737368686 82-83 26.525762881440716 26.263131565782892 24.187093546773387 23.024012006003 84-85 25.950475237618807 25.18759379689845 25.78789394697349 23.074037018509255 86-87 25.80040020010005 25.26263131565783 25.53776888444222 23.3991995997999 88-89 26.21310655327664 26.525762881440716 23.836918459229615 23.424212106053027 90-91 25.387693846923458 25.437718859429715 25.78789394697349 23.386693346673336 92-93 26.25062531265633 25.937968984492244 25.45022511255628 22.36118059029515 94-95 26.825912956478238 25.6128064032016 24.512256128064035 23.04902451225613 96-97 26.150575287643825 26.513256628314156 24.424712356178087 22.911455727863935 98-99 27.66383191595798 25.587793896948476 24.487243621810904 22.26113056528264 100-101 26.25062531265633 26.20060030015007 24.787393696848426 22.761380690345174 102-103 25.962981490745374 26.025512756378188 24.68734367183592 23.32416208104052 104-105 26.80090045022511 26.375687843921963 24.637318659329665 22.18609304652326 106-107 27.138569284642323 25.53776888444222 24.712356178089045 22.611305652826413 108-109 27.326163081540773 26.713356678339167 23.47423711855928 22.486243121560783 110-111 27.813906953476735 26.93846923461731 23.58679339669835 21.660830415207606 112-113 28.8144072036018 26.500750375187593 23.224112056028016 21.46073036518259 114-115 28.23911955977989 26.038019009504755 23.836918459229615 21.885942971485743 116-117 27.813906953476735 27.33866933466733 23.074037018509255 21.773386693346673 118-119 29.139569784892444 26.075537768884445 23.374187093546773 21.410705352676338 120-121 29.189594797398698 26.425712856428213 23.611805902951478 20.772886443221612 122-123 30.202601300650322 27.56378189094547 22.761380690345174 19.47223611805903 124-125 30.86543271635818 26.28814407203602 22.998999499749875 19.847423711855928 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 0.5 24 1.5 25 2.0 26 1.5 27 2.5 28 4.5 29 6.5 30 6.0 31 8.0 32 15.5 33 19.5 34 24.0 35 33.5 36 52.5 37 71.0 38 80.0 39 97.0 40 125.5 41 144.0 42 144.5 43 159.0 44 177.0 45 175.5 46 173.0 47 189.0 48 203.5 49 173.0 50 148.0 51 140.0 52 132.0 53 127.5 54 119.5 55 107.0 56 101.0 57 89.5 58 85.0 59 86.0 60 69.5 61 69.5 62 72.5 63 67.0 64 57.5 65 50.5 66 53.5 67 57.5 68 54.5 69 45.0 70 37.5 71 32.5 72 22.0 73 19.0 74 19.5 75 13.5 76 8.0 77 8.0 78 6.0 79 3.0 80 1.5 81 1.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.05 5 0.05 6 0.05 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.0375 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.025 38-39 0.025 40-41 0.05 42-43 0.05 44-45 0.05 46-47 0.05 48-49 0.05 50-51 0.05 52-53 0.05 54-55 0.05 56-57 0.05 58-59 0.05 60-61 0.05 62-63 0.05 64-65 0.05 66-67 0.05 68-69 0.05 70-71 0.05 72-73 0.05 74-75 0.05 76-77 0.05 78-79 0.05 80-81 0.05 82-83 0.05 84-85 0.05 86-87 0.05 88-89 0.05 90-91 0.05 92-93 0.05 94-95 0.05 96-97 0.05 98-99 0.05 100-101 0.05 102-103 0.05 104-105 0.05 106-107 0.05 108-109 0.05 110-111 0.05 112-113 0.05 114-115 0.05 116-117 0.05 118-119 0.05 120-121 0.05 122-123 0.05 124-125 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.32499999999999996 0.0 0.0 0.0 0.0 76-77 0.475 0.0 0.0 0.0 0.0 78-79 0.525 0.0 0.0 0.0 0.0 80-81 0.6375 0.0 0.0 0.0 0.0 82-83 0.8875 0.0 0.0 0.0 0.0 84-85 1.1 0.0 0.0 0.0 0.0 86-87 1.3 0.0 0.0 0.0 0.0 88-89 1.65 0.0 0.0 0.0 0.0 90-91 2.225 0.0 0.0 0.0 0.0 92-93 2.8625 0.0 0.0 0.0 0.0 94-95 3.45 0.0 0.0 0.0 0.0 96-97 4.0375 0.0 0.0 0.0 0.0 98-99 4.762499999999999 0.0 0.0 0.0 0.0 100-101 5.75 0.0 0.0 0.0 0.0 102-103 6.725 0.0 0.0 0.0 0.0 104-105 7.875 0.0 0.0 0.0 0.0 106-107 9.3 0.0 0.0 0.0 0.0 108-109 10.6 0.0 0.0 0.0 0.0 110-111 12.4 0.0 0.0 0.0 0.0 112-113 14.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1129616 spots for SRR3691906.sra Written 1129616 spots for SRR3691906.sra Read 1129616 spots for SRR3691906.sra Written 1129616 spots for SRR3691906.sra Read 1129616 spots for SRR3691906.sra Written 1129616 spots for SRR3691906.sra Read 1129616 spots for SRR3691906.sra Written 1129616 spots for SRR3691906.sra Read 1129616 spots for SRR3691906.sra Written 1129616 spots for SRR3691906.sra Read 1129616 spots for SRR3691906.sra Written 1129616 spots for SRR3691906.sra Read 1129616 spots for SRR3691906.sra Written 1129616 spots for SRR3691906.sra Read 1129616 spots for SRR3691906.sra Written 1129616 spots for SRR3691906.sra Read 1129616 spots for SRR3691906.sra Written 1129616 spots for SRR3691906.sra Read 1129616 spots for SRR3691906.sra Written 1129616 spots for SRR3691906.sra Read 1129616 spots for SRR3691906.sra Written 1129616 spots for SRR3691906.sra Read 1129616 spots for SRR3691906.sra Written 1129616 spots for SRR3691906.sra Read 1129616 spots for SRR3691906.sra Written 1129616 spots for SRR3691906.sra Read 1129616 spots for SRR3691906.sra Written 1129616 spots for SRR3691906.sra Read 1129628 spots for SRR3691906.sra Written 1129628 spots for SRR3691906.sra Read 1129616 spots for SRR3691906.sra Written 1129616 spots for SRR3691906.sra Read 1129616 spots for SRR3691906.sra Written 1129616 spots for SRR3691906.sra Read 1129616 spots for SRR3691906.sra Written 1129616 spots for SRR3691906.sra Read 1129616 spots for SRR3691906.sra Written 1129616 spots for SRR3691906.sra Read 1129616 spots for SRR3691906.sra Written 1129616 spots for SRR3691906.sra SRR ids: ['SRR3691906.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cpjgp74t SRR3691906.sra spots: 22592332 blocks: [[1, 1129616], [1129617, 2259232], [2259233, 3388848], [3388849, 4518464], [4518465, 5648080], [5648081, 6777696], [6777697, 7907312], [7907313, 9036928], [9036929, 10166544], [10166545, 11296160], [11296161, 12425776], [12425777, 13555392], [13555393, 14685008], [14685009, 15814624], [15814625, 16944240], [16944241, 18073856], [18073857, 19203472], [19203473, 20333088], [20333089, 21462704], [21462705, 22592332]] SRR3691906 file size 7192330 SRR3691906 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3691906 SRR3691906_1.fastq SRR3691906_2.fastq Input file: SRR3691906_1.fastq Paired file: SRR3691906_2.fastq trimmed: SRR3691906-trimmed-pair1.fastq, SRR3691906-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:05:06 2024 >> started Tue Dec 10 00:05:30 2024 >> done (23.954s) 22592332 read pairs processed; of these: 101 ( 0.00%) short read pairs filtered out after trimming by size control 2748 ( 0.01%) empty read pairs filtered out after trimming by size control 22589483 (99.99%) read pairs available; of these: 4815599 (21.32%) trimmed read pairs available after processing 17773884 (78.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 2 0.00% 20 0 0.00% 21 6 0.00% 22 0 0.00% 23 0 0.00% 24 3 0.00% 25 2 0.00% 26 1 0.00% 27 6 0.00% 28 11 0.00% 29 9 0.00% 30 8 0.00% 31 12 0.00% 32 14 0.00% 33 20 0.00% 34 23 0.00% 35 27 0.00% 36 23 0.00% 37 29 0.00% 38 50 0.00% 39 73 0.00% 40 77 0.00% 41 77 0.00% 42 86 0.00% 43 93 0.00% 44 108 0.00% 45 131 0.00% 46 152 0.00% 47 170 0.00% 48 218 0.00% 49 262 0.00% 50 357 0.00% 51 341 0.00% 52 380 0.00% 53 437 0.00% 54 459 0.00% 55 488 0.00% 56 547 0.00% 57 649 0.00% 58 662 0.00% 59 853 0.00% 60 993 0.00% 61 1122 0.00% 62 1197 0.01% 63 1454 0.01% 64 1605 0.01% 65 1737 0.01% 66 1926 0.01% 67 2051 0.01% 68 2210 0.01% 69 2606 0.01% 70 3092 0.01% 71 3607 0.02% 72 4237 0.02% 73 4720 0.02% 74 5402 0.02% 75 5986 0.03% 76 6369 0.03% 77 7055 0.03% 78 7831 0.03% 79 8716 0.04% 80 9748 0.04% 81 11460 0.05% 82 12926 0.06% 83 14820 0.07% 84 16891 0.07% 85 18380 0.08% 86 19960 0.09% 87 21511 0.10% 88 23547 0.10% 89 25256 0.11% 90 27651 0.12% 91 31161 0.14% 92 34846 0.15% 93 38116 0.17% 94 42235 0.19% 95 45648 0.20% 96 48619 0.22% 97 51764 0.23% 98 53818 0.24% 99 56980 0.25% 100 61185 0.27% 101 64883 0.29% 102 69751 0.31% 103 75935 0.34% 104 79792 0.35% 105 85570 0.38% 106 87503 0.39% 107 89600 0.40% 108 91545 0.41% 109 94421 0.42% 110 97396 0.43% 111 108108 0.48% 112 208142 0.92% 113 217254 0.96% 114 225536 1.00% 115 236392 1.05% 116 239804 1.06% 117 239963 1.06% 118 239948 1.06% 119 237651 1.05% 120 239749 1.06% 121 278244 1.23% 122 246651 1.09% 123 253898 1.12% 124 260553 1.15% 125 17773884 78.68% 22589483 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=32 prefix-density=0.21 prefix-fanout=2.2 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=281.28 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=17.6 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=35 prefix-density=0.16 prefix-fanout=2.1 sequence=TGCATGTACGTAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=15 fanout-score=189.43 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=23.2 sequence=CAAGAAGAAGGT SRR3691906 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:06:16 Started mapping on | Dec 10 00:06:16 Finished on | Dec 10 00:07:43 Mapping speed, Million of reads per hour | 934.74 Number of input reads | 22589483 Average input read length | 244 UNIQUE READS: Uniquely mapped reads number | 20422800 Uniquely mapped reads % | 90.41% Average mapped length | 241.67 Number of splices: Total | 15354583 Number of splices: Annotated (sjdb) | 14436171 Number of splices: GT/AG | 15142516 Number of splices: GC/AG | 180417 Number of splices: AT/AC | 7730 Number of splices: Non-canonical | 23920 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.01 Insertion rate per base | 0.01% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 405600 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 68530 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.25% % of reads unmapped: other | 1.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1761345 1761345 1761345 N_multimapping 405600 405600 405600 N_noFeature 896054 10812961 10120245 N_ambiguous 450662 36772 30432 UnstrandedReadsAssigned:19076084 PositiveStrandReadsAssigned:9573067 NegativeStrandReadsAssigned:10272123 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=117 echo kmer=113 SRR3691906 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3691906-trimmed-pair1.fastq SRR3691906-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,589,483 reads, 20,565,485 reads pseudoaligned [quant] estimated average fragment length: 151.079 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52973 SRR3691906.ke.tsv 35125 SRR3691906.se.tsv 88098 total ==> SRR3691906.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 786.003 0 0 PNS24247 1044 893.921 82.5176 6.70304 PNS24249 1928 1777.92 238.714 9.74967 PNS24246 1044 893.921 82.5176 6.70304 PNS24248 1044 893.921 82.5176 6.70304 PNS24244 1471 1320.92 124.733 6.85694 PNS24243 293 145.92 10 4.97635 KQK14069 1603 1452.92 36124.9 1805.46 KQK14071 474 325.199 2207.98 493.026 ==> SRR3691906.se.tsv <== BRADI_1g14170v3 40236 BRADI_1g53295v3 38 BRADI_1g59795v3 1294 BRADI_1g07683v3 0 BRADI_1g00485v3 28 BRADI_1g20270v3 186 BRADI_1g74790v3 218 BRADI_1g09890v3 0 BRADI_1g77505v3 326 BRADI_1g48960v3 0 SRR3691906 completed mapping pipeline successfully