Starting /dee2/code/volunteer_pipeline.sh SRR3691907 current disk space = 1523589177344 free memory = 1571365908 SRR3691907 SRAfilesize 6c0e4ce789e6ed44bf0ede28163bc375 SRR3691907.sra SRR3691907.sra file validated SRR3691907 is paired end SRR3691907 is conventional basespace SRR3691907 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691907_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8555 33.0 33.0 34.0 32.0 34.0 2 32.93875 34.0 33.0 34.0 32.0 34.0 3 33.04525 34.0 33.0 34.0 32.0 34.0 4 32.858 34.0 33.0 34.0 32.0 34.0 5 32.991 34.0 33.0 34.0 32.0 34.0 6 37.11475 38.0 38.0 38.0 36.0 38.0 7 37.1825 38.0 38.0 38.0 37.0 38.0 8 37.1825 38.0 38.0 38.0 37.0 38.0 9 37.08375 38.0 38.0 38.0 37.0 38.0 10-11 37.11175 38.0 38.0 38.0 37.0 38.0 12-13 37.029875000000004 38.0 38.0 38.0 37.0 38.0 14-15 37.071875000000006 38.0 38.0 38.0 36.5 38.0 16-17 37.046625000000006 38.0 38.0 38.0 36.5 38.0 18-19 37.093 38.0 38.0 38.0 37.0 38.0 20-21 37.115 38.0 38.0 38.0 37.0 38.0 22-23 37.036375 38.0 38.0 38.0 36.5 38.0 24-25 37.078375 38.0 38.0 38.0 36.5 38.0 26-27 37.087 38.0 38.0 38.0 36.0 38.0 28-29 37.160375 38.0 38.0 38.0 37.0 38.0 30-31 37.092625 38.0 38.0 38.0 37.0 38.0 32-33 37.105999999999995 38.0 38.0 38.0 36.5 38.0 34-35 37.16475 38.0 38.0 38.0 37.0 38.0 36-37 37.119875 38.0 38.0 38.0 36.5 38.0 38-39 37.116875 38.0 38.0 38.0 37.0 38.0 40-41 37.20825 38.0 38.0 38.0 37.0 38.0 42-43 37.170625 38.0 38.0 38.0 37.0 38.0 44-45 37.132875 38.0 38.0 38.0 37.0 38.0 46-47 37.1415 38.0 38.0 38.0 37.0 38.0 48-49 37.0975 38.0 38.0 38.0 36.5 38.0 50-51 37.06575 38.0 38.0 38.0 36.0 38.0 52-53 37.090500000000006 38.0 38.0 38.0 37.0 38.0 54-55 37.016375 38.0 38.0 38.0 36.5 38.0 56-57 37.006 38.0 38.0 38.0 36.0 38.0 58-59 37.0145 38.0 38.0 38.0 36.0 38.0 60-61 36.971875 38.0 38.0 38.0 36.0 38.0 62-63 37.037375 38.0 38.0 38.0 36.0 38.0 64-65 37.00725 38.0 38.0 38.0 36.0 38.0 66-67 37.0115 38.0 38.0 38.0 36.0 38.0 68-69 36.94375 38.0 38.0 38.0 36.0 38.0 70-71 36.972125 38.0 38.0 38.0 36.0 38.0 72-73 36.979124999999996 38.0 38.0 38.0 36.0 38.0 74-75 36.90175 38.0 38.0 38.0 36.0 38.0 76-77 36.8915 38.0 38.0 38.0 36.0 38.0 78-79 36.933 38.0 38.0 38.0 36.0 38.0 80-81 36.887 38.0 38.0 38.0 35.5 38.0 82-83 36.787000000000006 38.0 38.0 38.0 35.5 38.0 84-85 36.6205 38.0 38.0 38.0 35.0 38.0 86-87 36.729375000000005 38.0 38.0 38.0 35.0 38.0 88-89 36.72425 38.0 38.0 38.0 35.0 38.0 90-91 36.664249999999996 38.0 38.0 38.0 35.0 38.0 92-93 36.6295 38.0 38.0 38.0 35.0 38.0 94-95 36.680625 38.0 38.0 38.0 34.5 38.0 96-97 36.58475 38.0 38.0 38.0 34.5 38.0 98-99 36.438874999999996 38.0 38.0 38.0 34.0 38.0 100-101 36.516000000000005 38.0 38.0 38.0 34.0 38.0 102-103 36.36425 38.0 38.0 38.0 34.0 38.0 104-105 36.4495 38.0 38.0 38.0 34.0 38.0 106-107 36.3725 38.0 38.0 38.0 34.0 38.0 108-109 36.239625000000004 38.0 38.0 38.0 34.0 38.0 110-111 36.29725 38.0 38.0 38.0 34.0 38.0 112-113 36.208875 38.0 38.0 38.0 34.0 38.0 114-115 36.036249999999995 38.0 38.0 38.0 33.0 38.0 116-117 35.959375 38.0 38.0 38.0 32.0 38.0 118-119 35.573499999999996 38.0 37.0 38.0 31.0 38.0 120-121 35.36075 38.0 37.0 38.0 30.0 38.0 122-123 35.2545 38.0 36.5 38.0 29.0 38.0 124-125 35.178375 38.0 36.0 38.0 28.5 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 2.0 18 2.0 19 2.0 20 6.0 21 3.0 22 5.0 23 14.0 24 16.0 25 12.0 26 14.0 27 18.0 28 23.0 29 27.0 30 47.0 31 48.0 32 66.0 33 72.0 34 111.0 35 162.0 36 339.0 37 3004.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.52321204516939 17.390213299874528 11.191969887076537 31.894604767879546 2 29.086357947434294 22.35294117647059 29.311639549436798 19.249061326658325 3 22.252816020025033 25.982478097622025 27.133917396745932 24.63078848560701 4 26.458072590738425 30.58823529411765 21.126408010012515 21.827284105131415 5 27.759699624530665 31.739674593241553 20.95118898623279 19.549436795994993 6 23.84884884884885 34.95995995995996 19.594594594594593 21.596596596596594 7 22.81711283462597 18.388791593695274 34.9762321741306 23.817863397548162 8 23.042281711283465 23.167375531648737 24.468351263447584 29.321991493620214 9 23.923923923923923 21.746746746746748 27.602602602602605 26.726726726726728 10-11 26.18272841051314 27.734668335419272 21.639549436795996 24.44305381727159 12-13 26.69586983729662 21.78973717146433 24.881101376720903 26.633291614518146 14-15 25.632040050062578 25.219023779724658 26.307884856070086 22.84105131414268 16-17 26.9837296620776 24.518147684605758 23.617021276595747 24.881101376720903 18-19 26.633291614518146 24.85607008760951 24.30538172715895 24.20525657071339 20-21 25.46933667083855 25.65707133917397 24.53066332916145 24.342928660826033 22-23 25.806855141356017 26.232174130597947 24.293219914936202 23.667750813109834 24-25 26.09457092819615 24.768576432324245 25.369026770077557 23.767825869402053 26-27 26.025512756378188 24.074537268634316 25.437718859429715 24.462231115557778 28-29 25.39404553415061 25.331498623967974 24.843632724543408 24.430823117338004 30-31 25.334667834355063 25.096959839859878 25.84761666458151 23.72075566120355 32-33 26.238738738738736 25.600600600600597 24.824824824824827 23.335835835835837 34-35 26.147879394470163 25.59739772300763 24.596521956712124 23.658200925810082 36-37 25.472052019507313 25.809678629486054 24.684256596223584 24.034012754783042 38-39 25.584594222833562 24.84681755658372 25.159434788045516 24.409153432537202 40-41 25.634930564243714 25.409733516827227 24.871762792443388 24.083573126485675 42-43 25.068801601200903 25.769326995246434 24.605954465849386 24.55591693770328 44-45 25.172025522332042 25.334667834355063 25.534842987614166 23.958463655698736 46-47 25.797572876266734 24.80920805704992 25.2596021518829 24.133616914800452 48-49 24.65273432611688 25.003128519584532 25.79151545488675 24.55262169941184 50-51 24.96871088861076 24.831038798498124 25.60700876095119 24.593241551939926 52-53 25.444305381727162 25.306633291614517 25.15644555694618 24.09261576971214 54-55 26.458072590738425 25.15644555694618 25.36921151439299 23.016270337922403 56-57 25.36921151439299 25.106382978723403 24.85607008760951 24.668335419274094 58-59 25.55374796646227 26.079339256663747 24.677762482793142 23.68915029408084 60-61 25.53191489361702 25.281602002503128 25.18147684605757 24.005006257822277 62-63 24.84044550118884 25.34100863471405 25.916656238268054 23.901889625829057 64-65 26.069552164123095 25.344008006004504 24.843632724543408 23.742807105328996 66-67 25.331498623967974 25.243932949712285 25.856892669502123 23.567675756817614 68-69 25.85646411602901 25.51887971992998 25.168792198049513 23.455863965991497 70-71 26.91922980745186 25.581395348837212 24.50612653163291 22.99324831207802 72-73 25.747155183193698 25.584594222833562 25.697136426159812 22.97111416781293 74-75 25.3751875937969 25.737868934467233 25.26263131565783 23.62431215607804 76-77 25.587793896948476 25.0 25.48774387193597 23.92446223111556 78-79 26.441525953721072 24.390243902439025 25.728580362726706 23.439649781113197 80-81 25.278298936835526 26.303939962476548 25.203252032520325 23.214509068167605 82-83 26.458072590738425 25.043804755944933 24.543178973717147 23.9549436795995 84-85 25.06883604505632 25.994993742177723 25.319148936170212 23.617021276595747 86-87 25.5819774718398 25.231539424280353 26.12015018773467 23.066332916145182 88-89 25.807259073842303 26.0450563204005 25.093867334167708 23.053817271589487 90-91 25.5819774718398 26.157697121401753 25.519399249061326 22.74092615769712 92-93 25.882352941176475 25.944931163954944 25.00625782227785 23.166458072590736 94-95 26.379677136778877 26.054311099987487 25.090727067951445 22.47528469528219 96-97 25.193992490613265 26.7459324155194 25.281602002503128 22.778473091364205 98-99 26.41462193289935 26.527290936404608 24.32398597896845 22.734101151727593 100-101 26.89948679434222 26.073350857428967 24.946801852547253 22.08036049568156 102-103 26.486418825885593 26.749280260357995 24.533733884090626 22.23056702966579 104-105 27.997496871088863 26.83354192740926 23.31664580725907 21.8523153942428 106-107 27.171464330413013 27.183979974968707 23.717146433041304 21.927409261576972 108-109 27.759699624530665 25.90738423028786 24.167709637046308 22.165206508135167 110-111 28.07259073842303 26.48310387984981 23.30413016270338 22.14017521902378 112-113 29.148936170212764 27.659574468085108 23.31664580725907 19.874843554443054 114-115 28.739516835649013 27.625485041932656 23.23194392289398 20.403054199524345 116-117 29.574468085106382 27.40926157697122 22.95369211514393 20.062578222778473 118-119 30.008815010703945 27.175418713008437 22.969399319984888 19.846366956302735 120-121 30.727593152064454 27.870090634441087 22.268378650553878 19.133937562940584 122-123 30.91252359974827 27.614852108244182 22.215229704216487 19.25739458779106 124-125 30.614300100704934 27.99597180261833 21.991440080563947 19.39828801611279 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 1.5 23 1.5 24 0.5 25 1.0 26 1.0 27 1.0 28 3.5 29 4.5 30 6.5 31 11.0 32 15.0 33 20.0 34 31.0 35 37.0 36 45.0 37 70.0 38 91.5 39 104.0 40 122.0 41 137.5 42 171.0 43 194.5 44 185.5 45 191.5 46 197.0 47 188.5 48 173.0 49 157.5 50 158.5 51 148.5 52 134.0 53 114.5 54 101.0 55 105.0 56 94.0 57 85.5 58 82.5 59 76.0 60 65.5 61 67.0 62 69.0 63 60.5 64 54.0 65 51.0 66 49.5 67 50.5 68 50.5 69 46.0 70 33.5 71 29.0 72 27.5 73 23.0 74 22.0 75 13.0 76 4.5 77 1.5 78 5.0 79 5.0 80 1.0 81 1.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.125 3 0.125 4 0.125 5 0.125 6 0.1 7 0.075 8 0.075 9 0.1 10-11 0.125 12-13 0.125 14-15 0.125 16-17 0.125 18-19 0.125 20-21 0.125 22-23 0.075 24-25 0.075 26-27 0.05 28-29 0.075 30-31 0.08750000000000001 32-33 0.1 34-35 0.08750000000000001 36-37 0.0375 38-39 0.0375 40-41 0.08750000000000001 42-43 0.075 44-45 0.08750000000000001 46-47 0.08750000000000001 48-49 0.11249999999999999 50-51 0.125 52-53 0.125 54-55 0.125 56-57 0.125 58-59 0.11249999999999999 60-61 0.125 62-63 0.11249999999999999 64-65 0.075 66-67 0.075 68-69 0.025 70-71 0.025 72-73 0.0375 74-75 0.05 76-77 0.05 78-79 0.0625 80-81 0.0625 82-83 0.125 84-85 0.125 86-87 0.125 88-89 0.125 90-91 0.125 92-93 0.125 94-95 0.11249999999999999 96-97 0.125 98-99 0.15 100-101 0.13749999999999998 102-103 0.13749999999999998 104-105 0.125 106-107 0.125 108-109 0.125 110-111 0.125 112-113 0.125 114-115 0.13749999999999998 116-117 0.125 118-119 0.7374999999999999 120-121 0.7000000000000001 122-123 0.6875 124-125 0.7000000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.07500000000000001 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.2625 0.0 0.0 0.0 0.0 70-71 0.35 0.0 0.0 0.0 0.0 72-73 0.4375 0.0 0.0 0.0 0.0 74-75 0.5875 0.0 0.0 0.0 0.0 76-77 0.7375 0.0 0.0 0.0 0.0 78-79 0.8500000000000001 0.0 0.0 0.0 0.0 80-81 1.1375 0.0 0.0 0.0 0.0 82-83 1.4375 0.0 0.0 0.0 0.0 84-85 1.775 0.0 0.0 0.0 0.0 86-87 2.1500000000000004 0.0 0.0 0.0 0.0 88-89 2.7375 0.0 0.0 0.0 0.0 90-91 3.275 0.0 0.0 0.0 0.0 92-93 3.8875 0.0 0.0 0.0 0.0 94-95 4.925 0.0 0.0 0.0 0.0 96-97 6.025 0.0 0.0 0.0 0.0 98-99 7.262499999999999 0.0 0.0 0.0 0.0 100-101 8.7625 0.0 0.0 0.0 0.0 102-103 10.2 0.0 0.0 0.0 0.0 104-105 12.1375 0.0 0.0 0.0 0.0 106-107 13.95 0.0 0.0 0.0 0.0 108-109 15.549999999999999 0.0 0.0 0.0 0.0 110-111 17.775 0.0 0.0 0.0 0.0 112-113 19.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3691907 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691907_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.59475 34.0 33.0 34.0 32.0 34.0 2 33.097 34.0 33.0 34.0 32.0 34.0 3 33.21975 34.0 33.0 34.0 32.0 34.0 4 33.1805 34.0 33.0 34.0 32.0 34.0 5 33.1855 34.0 33.0 34.0 32.0 34.0 6 36.91775 38.0 37.0 38.0 36.0 38.0 7 37.33 38.0 38.0 38.0 37.0 38.0 8 37.4175 38.0 38.0 38.0 37.0 38.0 9 37.46175 38.0 38.0 38.0 37.0 38.0 10-11 37.517250000000004 38.0 38.0 38.0 38.0 38.0 12-13 37.481375 38.0 38.0 38.0 38.0 38.0 14-15 37.457375 38.0 38.0 38.0 38.0 38.0 16-17 37.503125 38.0 38.0 38.0 38.0 38.0 18-19 37.434875000000005 38.0 38.0 38.0 37.5 38.0 20-21 37.42025 38.0 38.0 38.0 37.5 38.0 22-23 37.492625000000004 38.0 38.0 38.0 38.0 38.0 24-25 37.483000000000004 38.0 38.0 38.0 38.0 38.0 26-27 37.44475 38.0 38.0 38.0 37.5 38.0 28-29 37.429 38.0 38.0 38.0 37.5 38.0 30-31 37.433 38.0 38.0 38.0 37.0 38.0 32-33 37.389875 38.0 38.0 38.0 37.0 38.0 34-35 37.41 38.0 38.0 38.0 37.0 38.0 36-37 37.372875 38.0 38.0 38.0 37.0 38.0 38-39 37.38875 38.0 38.0 38.0 37.0 38.0 40-41 37.403125 38.0 38.0 38.0 37.0 38.0 42-43 37.318625 38.0 38.0 38.0 37.0 38.0 44-45 37.3465 38.0 38.0 38.0 37.0 38.0 46-47 37.2485 38.0 38.0 38.0 37.0 38.0 48-49 37.247625 38.0 38.0 38.0 37.0 38.0 50-51 37.28 38.0 38.0 38.0 37.0 38.0 52-53 37.27375 38.0 38.0 38.0 37.0 38.0 54-55 37.23375 38.0 38.0 38.0 36.5 38.0 56-57 37.295625 38.0 38.0 38.0 37.0 38.0 58-59 37.197125 38.0 38.0 38.0 36.0 38.0 60-61 37.26525 38.0 38.0 38.0 36.5 38.0 62-63 37.257 38.0 38.0 38.0 37.0 38.0 64-65 37.264875 38.0 38.0 38.0 37.0 38.0 66-67 37.2205 38.0 38.0 38.0 37.0 38.0 68-69 37.17175 38.0 38.0 38.0 36.0 38.0 70-71 37.12625 38.0 38.0 38.0 36.0 38.0 72-73 37.168375 38.0 38.0 38.0 36.0 38.0 74-75 37.144875 38.0 38.0 38.0 36.0 38.0 76-77 37.192625 38.0 38.0 38.0 36.0 38.0 78-79 37.112875 38.0 38.0 38.0 36.0 38.0 80-81 37.081999999999994 38.0 38.0 38.0 36.0 38.0 82-83 37.038124999999994 38.0 38.0 38.0 36.0 38.0 84-85 37.06575 38.0 38.0 38.0 36.0 38.0 86-87 37.044250000000005 38.0 38.0 38.0 36.0 38.0 88-89 36.996875 38.0 38.0 38.0 36.0 38.0 90-91 36.810500000000005 38.0 38.0 38.0 35.0 38.0 92-93 36.913624999999996 38.0 38.0 38.0 35.0 38.0 94-95 36.846625 38.0 38.0 38.0 35.0 38.0 96-97 36.825625 38.0 38.0 38.0 35.0 38.0 98-99 36.83475 38.0 38.0 38.0 35.0 38.0 100-101 36.8305 38.0 38.0 38.0 35.0 38.0 102-103 36.759125 38.0 38.0 38.0 35.0 38.0 104-105 36.680125000000004 38.0 38.0 38.0 34.5 38.0 106-107 36.707 38.0 38.0 38.0 35.0 38.0 108-109 36.588499999999996 38.0 38.0 38.0 34.0 38.0 110-111 36.75125 38.0 38.0 38.0 35.0 38.0 112-113 36.63375 38.0 38.0 38.0 34.5 38.0 114-115 36.567625 38.0 38.0 38.0 34.0 38.0 116-117 36.443 38.0 38.0 38.0 34.0 38.0 118-119 36.374875 38.0 38.0 38.0 34.0 38.0 120-121 36.466750000000005 38.0 38.0 38.0 34.0 38.0 122-123 36.4555 38.0 38.0 38.0 34.0 38.0 124-125 36.384625 38.0 38.0 38.0 33.5 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 3.0 24 4.0 25 6.0 26 7.0 27 17.0 28 17.0 29 27.0 30 38.0 31 42.0 32 49.0 33 65.0 34 109.0 35 135.0 36 323.0 37 3156.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.700715015321755 9.19305413687436 6.588355464759959 42.51787538304392 2 23.549999999999997 12.6 33.525 30.325000000000003 3 22.900000000000002 17.8 22.425 36.875 4 27.474999999999998 24.875 20.375 27.275 5 26.8 29.675 23.1 20.424999999999997 6 21.7 31.974999999999998 22.8 23.525 7 17.0 23.075000000000003 41.9 18.025 8 20.95 21.55 30.9 26.6 9 20.1 20.599999999999998 34.325 24.975 10-11 22.35 30.099999999999998 23.724999999999998 23.825 12-13 22.725 24.462500000000002 27.675 25.137500000000003 14-15 23.225 26.325 25.7 24.75 16-17 24.2625 25.1875 25.912499999999998 24.637500000000003 18-19 24.0125 26.387500000000003 25.2875 24.3125 20-21 22.375 26.8125 25.8625 24.95 22-23 22.925 26.5 25.2125 25.362499999999997 24-25 23.25 25.575 24.9125 26.2625 26-27 22.85 25.674999999999997 25.387500000000003 26.087500000000002 28-29 23.275000000000002 25.25 25.9875 25.4875 30-31 23.474999999999998 25.374999999999996 25.7875 25.362499999999997 32-33 23.1 25.587500000000002 25.775 25.5375 34-35 23.6875 25.124999999999996 25.5375 25.650000000000002 36-37 23.3875 25.15 25.7625 25.7 38-39 22.9375 25.587500000000002 26.1125 25.362499999999997 40-41 23.7375 25.474999999999998 25.4625 25.324999999999996 42-43 23.5125 25.35 25.412499999999998 25.724999999999998 44-45 22.037499999999998 26.174999999999997 26.3625 25.424999999999997 46-47 23.9125 25.4625 25.275 25.35 48-49 23.525 25.7 26.087500000000002 24.6875 50-51 23.3 25.4625 24.875 26.3625 52-53 23.35 25.412499999999998 26.0125 25.224999999999998 54-55 23.599999999999998 25.362499999999997 25.1 25.937500000000004 56-57 23.7375 25.337500000000002 25.687500000000004 25.2375 58-59 23.175 26.0 25.1875 25.637500000000003 60-61 23.974999999999998 24.9375 25.825 25.2625 62-63 23.1125 24.775 26.25 25.8625 64-65 23.7 26.275 24.65 25.374999999999996 66-67 24.087500000000002 25.6 25.087500000000002 25.224999999999998 68-69 24.0375 24.8625 25.25 25.85 70-71 23.3875 25.2375 25.275 26.1 72-73 24.3875 24.9125 25.724999999999998 24.975 74-75 24.1625 25.45 25.362499999999997 25.025 76-77 23.0875 25.337500000000002 25.2375 26.337500000000002 78-79 24.337500000000002 24.6875 24.125 26.85 80-81 23.5 25.7625 25.662499999999998 25.074999999999996 82-83 24.212500000000002 25.5 24.9875 25.3 84-85 23.9875 25.3 25.025 25.687500000000004 86-87 24.6875 24.7375 25.087500000000002 25.4875 88-89 23.5625 24.975 25.775 25.687500000000004 90-91 24.9125 25.0375 23.6875 26.3625 92-93 23.625 25.162499999999998 25.662499999999998 25.55 94-95 24.2 26.25 23.925 25.624999999999996 96-97 24.5375 26.337500000000002 24.1875 24.9375 98-99 23.799999999999997 25.912499999999998 25.0375 25.25 100-101 24.8625 26.487500000000004 23.724999999999998 24.925 102-103 23.799999999999997 26.200000000000003 24.325 25.674999999999997 104-105 25.912499999999998 25.387500000000003 24.462500000000002 24.2375 106-107 24.6 27.1125 23.150000000000002 25.137500000000003 108-109 24.925 26.6125 23.474999999999998 24.9875 110-111 25.162499999999998 26.974999999999998 23.125 24.7375 112-113 25.087500000000002 26.8 23.1375 24.975 114-115 24.9125 27.175 22.725 25.1875 116-117 24.825 28.287499999999998 22.1875 24.7 118-119 24.9875 27.275 22.725 25.0125 120-121 25.45 27.6375 22.1375 24.775 122-123 24.6 27.975 21.6 25.825 124-125 25.162499999999998 27.237499999999997 21.837500000000002 25.7625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 0.5 27 0.5 28 2.5 29 4.0 30 7.5 31 12.0 32 18.0 33 23.5 34 25.5 35 39.0 36 59.0 37 72.5 38 84.0 39 100.0 40 124.0 41 157.5 42 171.0 43 177.0 44 197.0 45 208.5 46 206.0 47 196.5 48 172.5 49 162.5 50 166.5 51 144.0 52 130.5 53 108.5 54 89.5 55 105.5 56 101.5 57 86.0 58 80.5 59 75.0 60 68.5 61 71.0 62 72.0 63 58.0 64 54.0 65 53.0 66 46.0 67 45.5 68 48.5 69 44.0 70 32.0 71 22.0 72 16.5 73 16.0 74 14.5 75 8.5 76 6.5 77 5.0 78 2.0 79 2.0 80 2.0 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57286432160805 99.075 2 0.35175879396984927 0.7000000000000001 3 0.07537688442211055 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.07500000000000001 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.21250000000000002 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.2875 0.0 0.0 0.0 0.0 70-71 0.375 0.0 0.0 0.0 0.0 72-73 0.4625 0.0 0.0 0.0 0.0 74-75 0.6125 0.0 0.0 0.0 0.0 76-77 0.7875 0.0 0.0 0.0 0.0 78-79 0.8999999999999999 0.0 0.0 0.0 0.0 80-81 1.1875 0.0 0.0 0.0 0.0 82-83 1.4875 0.0 0.0 0.0 0.0 84-85 1.825 0.0 0.0 0.0 0.0 86-87 2.2 0.0 0.0 0.0 0.0 88-89 2.8125 0.0 0.0 0.0 0.0 90-91 3.325 0.0 0.0 0.0 0.0 92-93 3.9375 0.0 0.0 0.0 0.0 94-95 4.975 0.0 0.0 0.0 0.0 96-97 6.1 0.0 0.0 0.0 0.0 98-99 7.3375 0.0 0.0 0.0 0.0 100-101 8.85 0.0 0.0 0.0 0.0 102-103 10.274999999999999 0.0 0.0 0.0 0.0 104-105 12.15 0.0 0.0 0.0 0.0 106-107 14.0 0.0 0.0 0.0 0.0 108-109 15.600000000000001 0.0 0.0 0.0 0.0 110-111 17.8875 0.0 0.0 0.0 0.0 112-113 19.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1216263 spots for SRR3691907.sra Written 1216263 spots for SRR3691907.sra Read 1216263 spots for SRR3691907.sra Written 1216263 spots for SRR3691907.sra Read 1216263 spots for SRR3691907.sra Written 1216263 spots for SRR3691907.sra Read 1216263 spots for SRR3691907.sra Written 1216263 spots for SRR3691907.sra Read 1216263 spots for SRR3691907.sra Written 1216263 spots for SRR3691907.sra Read 1216263 spots for SRR3691907.sra Written 1216263 spots for SRR3691907.sra Read 1216263 spots for SRR3691907.sra Written 1216263 spots for SRR3691907.sra Read 1216263 spots for SRR3691907.sra Written 1216263 spots for SRR3691907.sra Read 1216263 spots for SRR3691907.sra Written 1216263 spots for SRR3691907.sra Read 1216263 spots for SRR3691907.sra Written 1216263 spots for SRR3691907.sra Read 1216263 spots for SRR3691907.sra Written 1216263 spots for SRR3691907.sra Read 1216263 spots for SRR3691907.sra Written 1216263 spots for SRR3691907.sra Read 1216263 spots for SRR3691907.sra Written 1216263 spots for SRR3691907.sra Read 1216263 spots for SRR3691907.sra Written 1216263 spots for SRR3691907.sra Read 1216263 spots for SRR3691907.sra Written 1216263 spots for SRR3691907.sra Read 1216263 spots for SRR3691907.sra Written 1216263 spots for SRR3691907.sra Read 1216268 spots for SRR3691907.sra Written 1216268 spots for SRR3691907.sra Read 1216263 spots for SRR3691907.sra Written 1216263 spots for SRR3691907.sra Read 1216263 spots for SRR3691907.sra Written 1216263 spots for SRR3691907.sra Read 1216263 spots for SRR3691907.sra Written 1216263 spots for SRR3691907.sra SRR ids: ['SRR3691907.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zrbwpf8g SRR3691907.sra spots: 24325265 blocks: [[1, 1216263], [1216264, 2432526], [2432527, 3648789], [3648790, 4865052], [4865053, 6081315], [6081316, 7297578], [7297579, 8513841], [8513842, 9730104], [9730105, 10946367], [10946368, 12162630], [12162631, 13378893], [13378894, 14595156], [14595157, 15811419], [15811420, 17027682], [17027683, 18243945], [18243946, 19460208], [19460209, 20676471], [20676472, 21892734], [21892735, 23108997], [23108998, 24325265]] SRR3691907 file size 7744846 SRR3691907 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3691907 SRR3691907_1.fastq SRR3691907_2.fastq Input file: SRR3691907_1.fastq Paired file: SRR3691907_2.fastq trimmed: SRR3691907-trimmed-pair1.fastq, SRR3691907-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:03:59 2024 >> started Tue Dec 10 00:04:32 2024 >> done (33.570s) 24325265 read pairs processed; of these: 126 ( 0.00%) short read pairs filtered out after trimming by size control 4003 ( 0.02%) empty read pairs filtered out after trimming by size control 24321136 (99.98%) read pairs available; of these: 6598370 (27.13%) trimmed read pairs available after processing 17722766 (72.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 0 0.00% 21 3 0.00% 22 4 0.00% 23 3 0.00% 24 3 0.00% 25 3 0.00% 26 8 0.00% 27 8 0.00% 28 15 0.00% 29 16 0.00% 30 28 0.00% 31 23 0.00% 32 31 0.00% 33 29 0.00% 34 37 0.00% 35 49 0.00% 36 60 0.00% 37 58 0.00% 38 67 0.00% 39 106 0.00% 40 116 0.00% 41 158 0.00% 42 152 0.00% 43 166 0.00% 44 165 0.00% 45 171 0.00% 46 225 0.00% 47 261 0.00% 48 375 0.00% 49 462 0.00% 50 511 0.00% 51 583 0.00% 52 625 0.00% 53 639 0.00% 54 715 0.00% 55 713 0.00% 56 820 0.00% 57 973 0.00% 58 1096 0.00% 59 1262 0.01% 60 1443 0.01% 61 1720 0.01% 62 1995 0.01% 63 2214 0.01% 64 2551 0.01% 65 2618 0.01% 66 2865 0.01% 67 3199 0.01% 68 3622 0.01% 69 4190 0.02% 70 4836 0.02% 71 5547 0.02% 72 6439 0.03% 73 7493 0.03% 74 8184 0.03% 75 9018 0.04% 76 9885 0.04% 77 10670 0.04% 78 11917 0.05% 79 13154 0.05% 80 14714 0.06% 81 16800 0.07% 82 19423 0.08% 83 21826 0.09% 84 24668 0.10% 85 27553 0.11% 86 29878 0.12% 87 32125 0.13% 88 35243 0.14% 89 38052 0.16% 90 41777 0.17% 91 45537 0.19% 92 49838 0.20% 93 55514 0.23% 94 61194 0.25% 95 66678 0.27% 96 70916 0.29% 97 75283 0.31% 98 79310 0.33% 99 82644 0.34% 100 88211 0.36% 101 92754 0.38% 102 98742 0.41% 103 106527 0.44% 104 111718 0.46% 105 119319 0.49% 106 123062 0.51% 107 126532 0.52% 108 128698 0.53% 109 133827 0.55% 110 136689 0.56% 111 149721 0.62% 112 286203 1.18% 113 294499 1.21% 114 306164 1.26% 115 317380 1.30% 116 323167 1.33% 117 322464 1.33% 118 323699 1.33% 119 322043 1.32% 120 323045 1.33% 121 361018 1.48% 122 324825 1.34% 123 330344 1.36% 124 334440 1.38% 125 17722766 72.87% 24321136 reads passed initial QC criterion=sequence-density sequence-density=18.77 sequence-density-rank=1 fanout-score=33.78 fanout-score-rank=1 prefix-density=18.92 prefix-fanout=33.5 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA criterion=fanout-score sequence-density=18.77 sequence-density-rank=1 fanout-score=33.78 fanout-score-rank=1 prefix-density=18.92 prefix-fanout=33.5 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA criterion=sequence-density sequence-density=18.91 sequence-density-rank=1 fanout-score=45.44 fanout-score-rank=1 prefix-density=18.98 prefix-fanout=45.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=18.91 sequence-density-rank=1 fanout-score=45.44 fanout-score-rank=1 prefix-density=18.98 prefix-fanout=45.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -y AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3691907 SRR3691907_1.fastq SRR3691907_2.fastq Input file: SRR3691907_1.fastq Paired file: SRR3691907_2.fastq trimmed: SRR3691907-trimmed-pair1.fastq, SRR3691907-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:06:53 2024 >> started Tue Dec 10 00:07:19 2024 >> done (25.053s) 21761017 read pairs processed; of these: 111 ( 0.00%) short read pairs filtered out after trimming by size control 2607 ( 0.01%) empty read pairs filtered out after trimming by size control 21758299 (99.99%) read pairs available; of these: 2149353 ( 9.88%) trimmed read pairs available after processing 19608946 (90.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 3 0.00% 21 2 0.00% 22 7 0.00% 23 4 0.00% 24 4 0.00% 25 8 0.00% 26 12 0.00% 27 14 0.00% 28 21 0.00% 29 26 0.00% 30 42 0.00% 31 47 0.00% 32 62 0.00% 33 46 0.00% 34 83 0.00% 35 90 0.00% 36 112 0.00% 37 163 0.00% 38 148 0.00% 39 197 0.00% 40 213 0.00% 41 283 0.00% 42 279 0.00% 43 320 0.00% 44 327 0.00% 45 312 0.00% 46 422 0.00% 47 503 0.00% 48 645 0.00% 49 790 0.00% 50 859 0.00% 51 1005 0.00% 52 1103 0.01% 53 1200 0.01% 54 1237 0.01% 55 1292 0.01% 56 1492 0.01% 57 1771 0.01% 58 2005 0.01% 59 2250 0.01% 60 2676 0.01% 61 3117 0.01% 62 3613 0.02% 63 3965 0.02% 64 4473 0.02% 65 4648 0.02% 66 5149 0.02% 67 5674 0.03% 68 6513 0.03% 69 7452 0.03% 70 8621 0.04% 71 9814 0.05% 72 11436 0.05% 73 13328 0.06% 74 14692 0.07% 75 16097 0.07% 76 17569 0.08% 77 19231 0.09% 78 21293 0.10% 79 23652 0.11% 80 26504 0.12% 81 30153 0.14% 82 34560 0.16% 83 39406 0.18% 84 44138 0.20% 85 49439 0.23% 86 53744 0.25% 87 57662 0.27% 88 63019 0.29% 89 68008 0.31% 90 74416 0.34% 91 81378 0.37% 92 89372 0.41% 93 99478 0.46% 94 109584 0.50% 95 119145 0.55% 96 127238 0.58% 97 134732 0.62% 98 141305 0.65% 99 147121 0.68% 100 157363 0.72% 101 165633 0.76% 102 175828 0.81% 103 190238 0.87% 104 199841 0.92% 105 212089 0.97% 106 220176 1.01% 107 226688 1.04% 108 230685 1.06% 109 239071 1.10% 110 243058 1.12% 111 248391 1.14% 112 255895 1.18% 113 263214 1.21% 114 274026 1.26% 115 283933 1.30% 116 288810 1.33% 117 288556 1.33% 118 289573 1.33% 119 288013 1.32% 120 289035 1.33% 121 316477 1.45% 122 290480 1.34% 123 295312 1.36% 124 299173 1.37% 125 13713918 63.03% criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=33 prefix-density=0.09 prefix-fanout=2.7 sequence=GGTCGGCAAGGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=17 fanout-score=251.85 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=27.7 sequence=AGCAGCAGCAGC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=3.31 fanout-score-rank=29 prefix-density=0.12 prefix-fanout=2.6 sequence=CCATGTTCGGGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=14 fanout-score=201.37 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=24.5 sequence=AGCAGCAGCAGC SRR3691907 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:08:15 Started mapping on | Dec 10 00:08:15 Finished on | Dec 10 00:09:52 Mapping speed, Million of reads per hour | 902.54 Number of input reads | 24318418 Average input read length | 237 UNIQUE READS: Uniquely mapped reads number | 22829652 Uniquely mapped reads % | 93.88% Average mapped length | 237.15 Number of splices: Total | 17026370 Number of splices: Annotated (sjdb) | 16002779 Number of splices: GT/AG | 16794843 Number of splices: GC/AG | 196175 Number of splices: AT/AC | 9056 Number of splices: Non-canonical | 26296 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.03 Insertion rate per base | 0.01% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 465822 % of reads mapped to multiple loci | 1.92% Number of reads mapped to too many loci | 90636 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.60% % of reads unmapped: other | 1.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1023186 1023186 1023186 N_multimapping 465822 465822 465822 N_noFeature 1034464 11754928 11681734 N_ambiguous 486484 31030 30332 UnstrandedReadsAssigned:21308704 PositiveStrandReadsAssigned:11043694 NegativeStrandReadsAssigned:11117586 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=112 echo kmer=107 SRR3691907 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3691907-trimmed-pair1.fastq SRR3691907-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,318,418 reads, 22,191,351 reads pseudoaligned [quant] estimated average fragment length: 139.653 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52973 SRR3691907.ke.tsv 35125 SRR3691907.se.tsv 88098 total ==> SRR3691907.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 797.453 0 0 PNS24247 1044 905.347 92.8874 7.03168 PNS24249 1928 1789.35 134.568 5.15426 PNS24246 1044 905.347 92.8874 7.03168 PNS24248 1044 905.347 92.8874 7.03168 PNS24244 1471 1332.35 183.769 9.45309 PNS24243 293 156.018 11 4.8321 KQK14069 1603 1464.35 34854.3 1631.29 KQK14071 474 336.445 2256.06 459.573 ==> SRR3691907.se.tsv <== BRADI_1g14170v3 41542 BRADI_1g53295v3 27 BRADI_1g59795v3 1459 BRADI_1g07683v3 0 BRADI_1g00485v3 24 BRADI_1g20270v3 237 BRADI_1g74790v3 206 BRADI_1g09890v3 0 BRADI_1g77505v3 292 BRADI_1g48960v3 0 SRR3691907 completed mapping pipeline successfully