Starting /dee2/code/volunteer_pipeline.sh SRR3691908 current disk space = 1523589177344 free memory = 1571363596 SRR3691908 SRAfilesize 9c46618fdeda1fe1cd4fb9e6f7a7d470 SRR3691908.sra SRR3691908.sra file validated SRR3691908 is paired end SRR3691908 is conventional basespace SRR3691908 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691908_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0025 33.0 33.0 34.0 32.0 34.0 2 33.04225 34.0 33.0 34.0 32.0 34.0 3 33.05425 34.0 33.0 34.0 32.0 34.0 4 32.9945 34.0 33.0 34.0 32.0 34.0 5 33.039 34.0 33.0 34.0 32.0 34.0 6 37.15475 38.0 38.0 38.0 37.0 38.0 7 37.205 38.0 38.0 38.0 37.0 38.0 8 37.12025 38.0 38.0 38.0 37.0 38.0 9 37.18075 38.0 38.0 38.0 37.0 38.0 10-11 37.097125 38.0 38.0 38.0 36.5 38.0 12-13 37.123374999999996 38.0 38.0 38.0 36.5 38.0 14-15 37.073625 38.0 38.0 38.0 36.0 38.0 16-17 37.146125 38.0 38.0 38.0 37.0 38.0 18-19 37.061499999999995 38.0 38.0 38.0 36.0 38.0 20-21 37.205124999999995 38.0 38.0 38.0 37.0 38.0 22-23 37.157875000000004 38.0 38.0 38.0 37.0 38.0 24-25 37.167500000000004 38.0 38.0 38.0 37.0 38.0 26-27 37.1875 38.0 38.0 38.0 37.0 38.0 28-29 37.166375 38.0 38.0 38.0 36.5 38.0 30-31 37.19799999999999 38.0 38.0 38.0 37.0 38.0 32-33 37.17075 38.0 38.0 38.0 37.0 38.0 34-35 37.22 38.0 38.0 38.0 37.0 38.0 36-37 37.13725 38.0 38.0 38.0 37.0 38.0 38-39 37.161625 38.0 38.0 38.0 37.0 38.0 40-41 37.234125 38.0 38.0 38.0 37.0 38.0 42-43 37.173125 38.0 38.0 38.0 37.0 38.0 44-45 37.156625 38.0 38.0 38.0 37.0 38.0 46-47 37.094375 38.0 38.0 38.0 37.0 38.0 48-49 37.092625 38.0 38.0 38.0 36.5 38.0 50-51 37.123999999999995 38.0 38.0 38.0 37.0 38.0 52-53 37.161375 38.0 38.0 38.0 37.0 38.0 54-55 37.144999999999996 38.0 38.0 38.0 36.5 38.0 56-57 37.087125 38.0 38.0 38.0 36.5 38.0 58-59 37.08025 38.0 38.0 38.0 36.5 38.0 60-61 37.015 38.0 38.0 38.0 36.0 38.0 62-63 37.000375 38.0 38.0 38.0 36.0 38.0 64-65 37.098375000000004 38.0 38.0 38.0 36.5 38.0 66-67 37.047625 38.0 38.0 38.0 36.5 38.0 68-69 37.077 38.0 38.0 38.0 36.5 38.0 70-71 37.012375000000006 38.0 38.0 38.0 36.0 38.0 72-73 37.09675 38.0 38.0 38.0 36.0 38.0 74-75 37.01825 38.0 38.0 38.0 36.0 38.0 76-77 37.08825 38.0 38.0 38.0 36.5 38.0 78-79 37.081500000000005 38.0 38.0 38.0 36.0 38.0 80-81 36.976 38.0 38.0 38.0 36.0 38.0 82-83 36.944125 38.0 38.0 38.0 36.0 38.0 84-85 36.879625000000004 38.0 38.0 38.0 36.0 38.0 86-87 36.886624999999995 38.0 38.0 38.0 35.0 38.0 88-89 36.86687499999999 38.0 38.0 38.0 35.5 38.0 90-91 36.90275 38.0 38.0 38.0 35.5 38.0 92-93 36.809625 38.0 38.0 38.0 35.0 38.0 94-95 36.848 38.0 38.0 38.0 35.0 38.0 96-97 36.789 38.0 38.0 38.0 35.0 38.0 98-99 36.864625000000004 38.0 38.0 38.0 35.0 38.0 100-101 36.700874999999996 38.0 38.0 38.0 35.0 38.0 102-103 36.747875 38.0 38.0 38.0 35.0 38.0 104-105 36.60725 38.0 38.0 38.0 34.5 38.0 106-107 36.5685 38.0 38.0 38.0 34.0 38.0 108-109 36.589875 38.0 38.0 38.0 34.5 38.0 110-111 36.417 38.0 38.0 38.0 34.0 38.0 112-113 36.335 38.0 38.0 38.0 34.0 38.0 114-115 36.3545 38.0 38.0 38.0 33.0 38.0 116-117 36.312749999999994 38.0 38.0 38.0 32.5 38.0 118-119 36.1125 38.0 38.0 38.0 32.5 38.0 120-121 36.04875 38.0 38.0 38.0 32.0 38.0 122-123 35.942 38.0 38.0 38.0 31.5 38.0 124-125 35.832625 38.0 38.0 38.0 31.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10-11 0.0 2309 12-13 0.0 2309 14-15 0.0 2309 16-17 0.0 2309 18-19 0.0 2309 20-21 0.0 2309 22-23 0.0 2309 24-25 0.0 2309 26-27 0.0 2309 28-29 0.0 2309 30-31 0.0 2309 32-33 0.0 2309 34-35 0.0 2309 36-37 0.0 2309 38-39 0.0 2309 40-41 0.0 2309 42-43 0.0 2309 44-45 0.0 2309 46-47 0.0 2309 48-49 0.0 2309 50-51 0.0 2309 52-53 0.0 2309 54-55 0.0 2309 56-57 0.0 2309 58-59 0.0 2309 60-61 0.0 2309 62-63 0.0 2309 64-65 0.0 2309 66-67 0.0 2309 68-69 0.0 2309 70-71 0.0 2309 72-73 0.0 2309 74-75 0.0 2309 76-77 0.0 2309 78-79 0.0 2309 80-81 0.0 2309 82-83 0.0 2309 84-85 0.0 2309 86-87 0.0 2309 88-89 0.0 2309 90-91 0.0 2309 92-93 0.0 2309 94-95 0.0 2309 96-97 0.0 2309 98-99 0.0 2309 100-101 0.0 2309 102-103 0.0 2309 104-105 0.0 2309 106-107 0.0 2309 108-109 0.0 2309 110-111 0.0 2309 112-113 0.0 2309 114-115 0.0 2309 116-117 0.0 2309 118-119 0.0 2309 120-121 0.0 2309 122-123 0.0 2309 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 2.0 19 6.0 20 2.0 21 6.0 22 3.0 23 10.0 24 5.0 25 11.0 26 18.0 27 20.0 28 23.0 29 31.0 30 31.0 31 52.0 32 50.0 33 87.0 34 86.0 35 137.0 36 328.0 37 3091.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.45 19.375 12.45 29.725 2 29.175 23.1 27.150000000000002 20.575 3 24.625 24.25 27.775 23.35 4 27.125 31.175000000000004 19.875 21.825 5 27.474999999999998 31.574999999999996 19.55 21.4 6 23.275000000000002 33.95 21.099999999999998 21.675 7 21.9 17.549999999999997 37.0 23.549999999999997 8 22.95 22.45 24.5 30.099999999999998 9 22.975 22.575 26.924999999999997 27.525 10-11 26.35 28.499999999999996 20.5 24.65 12-13 26.0375 23.875 24.9375 25.15 14-15 25.025 25.937500000000004 24.587500000000002 24.45 16-17 25.374999999999996 25.362499999999997 24.975 24.2875 18-19 26.1625 25.05 24.4125 24.375 20-21 24.9 25.374999999999996 24.462500000000002 25.2625 22-23 25.674999999999997 25.412499999999998 24.3875 24.525 24-25 25.7875 25.112499999999997 24.6625 24.4375 26-27 25.837500000000002 24.7 25.75 23.7125 28-29 25.324999999999996 25.05 25.074999999999996 24.55 30-31 25.05 25.2 25.775 23.974999999999998 32-33 24.9375 25.424999999999997 25.45 24.1875 34-35 26.087500000000002 24.3625 25.25 24.3 36-37 25.3 25.4 24.725 24.575 38-39 25.412499999999998 25.9875 24.525 24.075 40-41 25.85 25.374999999999996 25.2125 23.5625 42-43 25.4375 25.137500000000003 25.0375 24.3875 44-45 24.8 25.224999999999998 25.8625 24.1125 46-47 26.075 24.9375 24.4875 24.5 48-49 24.9875 24.8125 25.900000000000002 24.3 50-51 25.374999999999996 24.8125 25.8125 24.0 52-53 25.112499999999997 24.4125 25.900000000000002 24.575 54-55 25.2125 25.650000000000002 25.624999999999996 23.5125 56-57 25.174999999999997 25.7125 24.925 24.1875 58-59 25.687500000000004 24.8125 25.124999999999996 24.375 60-61 25.75 25.025 25.2125 24.0125 62-63 24.6125 25.224999999999998 26.075 24.087500000000002 64-65 25.45 25.7875 24.837500000000002 23.925 66-67 25.724999999999998 25.15 25.85 23.275000000000002 68-69 25.0375 25.55 25.2125 24.2 70-71 26.075 25.3 24.887500000000003 23.7375 72-73 25.112499999999997 25.7375 24.975 24.175 74-75 23.7875 26.2875 26.2125 23.7125 76-77 26.1625 24.6125 25.624999999999996 23.599999999999998 78-79 25.2125 25.837500000000002 25.6 23.35 80-81 25.7875 25.8625 25.3125 23.0375 82-83 26.200000000000003 25.474999999999998 24.25 24.075 84-85 25.362499999999997 26.437500000000004 25.5125 22.6875 86-87 25.3125 26.775 24.587500000000002 23.325000000000003 88-89 25.587500000000002 26.687499999999996 24.7375 22.9875 90-91 24.962500000000002 25.837500000000002 25.337500000000002 23.8625 92-93 26.6625 25.587500000000002 25.074999999999996 22.675 94-95 26.3 27.1375 24.6 21.9625 96-97 26.237500000000004 26.5375 24.962500000000002 22.2625 98-99 26.5125 26.150000000000002 24.6875 22.650000000000002 100-101 27.487499999999997 25.4 24.337500000000002 22.775000000000002 102-103 25.75 28.1375 23.7375 22.375 104-105 26.825 27.925 23.175 22.075 106-107 27.150000000000002 26.237500000000004 24.4375 22.175 108-109 27.5625 26.525 23.962500000000002 21.95 110-111 27.9375 27.650000000000002 23.025000000000002 21.3875 112-113 28.537499999999998 27.462500000000002 23.2125 20.7875 114-115 29.1625 26.8 23.0 21.0375 116-117 29.75 27.675 22.4875 20.0875 118-119 30.325000000000003 27.1125 22.525000000000002 20.0375 120-121 30.55 27.575 22.537499999999998 19.3375 122-123 30.7 27.725 21.975 19.6 124-125 32.1 27.400000000000002 22.037499999999998 18.462500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 3.0 27 5.5 28 7.0 29 6.5 30 8.5 31 11.0 32 15.0 33 19.5 34 26.0 35 42.0 36 59.0 37 76.5 38 99.5 39 112.5 40 135.0 41 154.0 42 157.5 43 168.0 44 178.5 45 191.5 46 193.5 47 183.0 48 168.5 49 154.0 50 151.0 51 135.5 52 129.5 53 130.0 54 103.5 55 91.0 56 90.5 57 84.0 58 82.0 59 74.5 60 67.5 61 74.5 62 79.0 63 64.5 64 56.5 65 54.0 66 53.5 67 53.0 68 39.5 69 34.0 70 34.0 71 29.0 72 25.0 73 25.0 74 22.0 75 16.5 76 9.0 77 3.5 78 3.0 79 3.5 80 1.5 81 1.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.16249999999999998 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.325 0.0 0.0 0.0 0.0 68-69 0.35 0.0 0.0 0.0 0.0 70-71 0.4125 0.0 0.0 0.0 0.0 72-73 0.475 0.0 0.0 0.0 0.0 74-75 0.6000000000000001 0.0 0.0 0.0 0.0 76-77 0.825 0.0 0.0 0.0 0.0 78-79 1.1375000000000002 0.0 0.0 0.0 0.0 80-81 1.4 0.0 0.0 0.0 0.0 82-83 1.625 0.0 0.0 0.0 0.0 84-85 1.975 0.0 0.0 0.0 0.0 86-87 2.5875 0.0 0.0 0.0 0.0 88-89 3.1125 0.0 0.0 0.0 0.0 90-91 3.5999999999999996 0.0 0.0 0.0 0.0 92-93 4.362500000000001 0.0 0.0 0.0 0.0 94-95 5.4 0.0 0.0 0.0 0.0 96-97 6.6375 0.0 0.0 0.0 0.0 98-99 7.75 0.0 0.0 0.0 0.0 100-101 9.0 0.0 0.0 0.0 0.0 102-103 10.7125 0.0 0.0 0.0 0.0 104-105 12.675 0.0 0.0 0.0 0.0 106-107 14.7 0.0 0.0 0.0 0.0 108-109 17.0 0.0 0.0 0.0 0.0 110-111 19.3125 0.0 0.0 0.0 0.0 112-113 21.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3691908 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691908_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.667 34.0 33.0 34.0 32.0 34.0 2 33.1985 34.0 33.0 34.0 32.0 34.0 3 33.1995 34.0 33.0 34.0 32.0 34.0 4 33.21975 34.0 33.0 34.0 32.0 34.0 5 33.2665 34.0 33.0 34.0 33.0 34.0 6 36.771 38.0 37.0 38.0 35.0 38.0 7 37.13575 38.0 38.0 38.0 36.0 38.0 8 37.433 38.0 38.0 38.0 37.0 38.0 9 37.39775 38.0 38.0 38.0 37.0 38.0 10-11 37.399874999999994 38.0 38.0 38.0 37.0 38.0 12-13 37.349625 38.0 38.0 38.0 37.0 38.0 14-15 37.351 38.0 38.0 38.0 37.0 38.0 16-17 37.4015 38.0 38.0 38.0 37.0 38.0 18-19 37.39775 38.0 38.0 38.0 37.0 38.0 20-21 37.40325 38.0 38.0 38.0 37.0 38.0 22-23 37.424499999999995 38.0 38.0 38.0 37.0 38.0 24-25 37.44425 38.0 38.0 38.0 37.0 38.0 26-27 37.405874999999995 38.0 38.0 38.0 37.0 38.0 28-29 37.360749999999996 38.0 38.0 38.0 37.0 38.0 30-31 37.363 38.0 38.0 38.0 37.0 38.0 32-33 37.399875 38.0 38.0 38.0 37.5 38.0 34-35 37.363749999999996 38.0 38.0 38.0 37.0 38.0 36-37 37.356750000000005 38.0 38.0 38.0 37.0 38.0 38-39 37.329750000000004 38.0 38.0 38.0 37.0 38.0 40-41 37.23225 38.0 38.0 38.0 37.0 38.0 42-43 37.173875 38.0 38.0 38.0 37.0 38.0 44-45 37.237375 38.0 38.0 38.0 37.0 38.0 46-47 37.220124999999996 38.0 38.0 38.0 36.5 38.0 48-49 37.261125 38.0 38.0 38.0 37.0 38.0 50-51 37.27525 38.0 38.0 38.0 37.0 38.0 52-53 37.294875 38.0 38.0 38.0 37.0 38.0 54-55 37.1875 38.0 38.0 38.0 37.0 38.0 56-57 37.182249999999996 38.0 38.0 38.0 37.0 38.0 58-59 37.212 38.0 38.0 38.0 36.5 38.0 60-61 37.231375 38.0 38.0 38.0 37.0 38.0 62-63 37.18875 38.0 38.0 38.0 36.5 38.0 64-65 37.16175 38.0 38.0 38.0 36.5 38.0 66-67 37.1635 38.0 38.0 38.0 36.0 38.0 68-69 37.095625 38.0 38.0 38.0 36.0 38.0 70-71 37.125125 38.0 38.0 38.0 36.0 38.0 72-73 37.135374999999996 38.0 38.0 38.0 36.0 38.0 74-75 37.155375 38.0 38.0 38.0 36.0 38.0 76-77 37.1145 38.0 38.0 38.0 36.0 38.0 78-79 37.09325 38.0 38.0 38.0 36.0 38.0 80-81 37.14075 38.0 38.0 38.0 36.0 38.0 82-83 37.01375 38.0 38.0 38.0 36.0 38.0 84-85 36.95625 38.0 38.0 38.0 36.0 38.0 86-87 37.037125 38.0 38.0 38.0 36.0 38.0 88-89 37.008125 38.0 38.0 38.0 36.0 38.0 90-91 36.9525 38.0 38.0 38.0 35.5 38.0 92-93 36.923875 38.0 38.0 38.0 35.0 38.0 94-95 36.969875 38.0 38.0 38.0 35.5 38.0 96-97 36.798 38.0 38.0 38.0 35.0 38.0 98-99 36.85875 38.0 38.0 38.0 35.0 38.0 100-101 36.858375 38.0 38.0 38.0 35.0 38.0 102-103 36.828875 38.0 38.0 38.0 35.0 38.0 104-105 36.751625000000004 38.0 38.0 38.0 35.0 38.0 106-107 36.800875 38.0 38.0 38.0 35.0 38.0 108-109 36.840625 38.0 38.0 38.0 35.0 38.0 110-111 36.769625000000005 38.0 38.0 38.0 34.5 38.0 112-113 36.731875 38.0 38.0 38.0 35.0 38.0 114-115 36.611625000000004 38.0 38.0 38.0 34.0 38.0 116-117 36.505125 38.0 38.0 38.0 34.0 38.0 118-119 36.317875 38.0 38.0 38.0 34.0 38.0 120-121 36.370625000000004 38.0 38.0 38.0 34.0 38.0 122-123 36.40575 38.0 38.0 38.0 34.0 38.0 124-125 36.3475 38.0 38.0 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10-11 0.0 2309 12-13 0.0 2309 14-15 0.0 2309 16-17 0.0 2309 18-19 0.0 2309 20-21 0.0 2309 22-23 0.0 2309 24-25 0.0 2309 26-27 0.0 2309 28-29 0.0 2309 30-31 0.0 2309 32-33 0.0 2309 34-35 0.0 2309 36-37 0.0 2309 38-39 0.0 2309 40-41 0.0 2309 42-43 0.0 2309 44-45 0.0 2309 46-47 0.0 2309 48-49 0.0 2309 50-51 0.0 2309 52-53 0.0 2309 54-55 0.0 2309 56-57 0.0 2309 58-59 0.0 2309 60-61 0.0 2309 62-63 0.0 2309 64-65 0.0 2309 66-67 0.0 2309 68-69 0.0 2309 70-71 0.0 2309 72-73 0.0 2309 74-75 0.0 2309 76-77 0.0 2309 78-79 0.0 2309 80-81 0.0 2309 82-83 0.0 2309 84-85 0.0 2309 86-87 0.0 2309 88-89 0.0 2309 90-91 0.0 2309 92-93 0.0 2309 94-95 0.0 2309 96-97 0.0 2309 98-99 0.0 2309 100-101 0.0 2309 102-103 0.0 2309 104-105 0.0 2309 106-107 0.0 2309 108-109 0.0 2309 110-111 0.0 2309 112-113 0.0 2309 114-115 0.0 2309 116-117 0.0 2309 118-119 0.0 2309 120-121 0.0 2309 122-123 0.0 2309 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 4.0 24 6.0 25 4.0 26 9.0 27 16.0 28 22.0 29 25.0 30 34.0 31 41.0 32 53.0 33 87.0 34 77.0 35 153.0 36 316.0 37 3149.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.67108618052014 9.38296787353391 7.90413054563998 38.041815400305964 2 25.6 12.225 32.15 30.025000000000002 3 24.25 18.275 23.474999999999998 34.0 4 28.525 25.025 21.0 25.45 5 28.325 28.199999999999996 22.575 20.9 6 23.65 31.324999999999996 23.150000000000002 21.875 7 17.8 22.3 41.75 18.15 8 21.625 23.200000000000003 29.775000000000002 25.4 9 21.275 21.975 32.225 24.525 10-11 22.9625 29.9875 24.637500000000003 22.412499999999998 12-13 23.799999999999997 23.0 28.249999999999996 24.95 14-15 22.625 25.5375 27.750000000000004 24.087500000000002 16-17 22.625 26.0125 25.624999999999996 25.7375 18-19 24.4875 25.974999999999998 24.224999999999998 25.3125 20-21 23.2625 26.200000000000003 25.575 24.962500000000002 22-23 23.0125 26.5 26.025 24.462500000000002 24-25 23.0625 25.825 25.7375 25.374999999999996 26-27 23.8375 25.362499999999997 25.5625 25.2375 28-29 23.575 25.5125 25.8 25.112499999999997 30-31 23.202900362545318 25.87823477934742 25.978247280910118 24.94061757719715 32-33 23.775 26.487500000000004 25.337500000000002 24.4 34-35 23.5 26.775 24.6125 25.112499999999997 36-37 23.8625 24.775 25.874999999999996 25.4875 38-39 23.45 24.85 26.4625 25.2375 40-41 23.8625 25.362499999999997 25.3 25.474999999999998 42-43 23.39042380297537 25.62820352544068 24.85310663832979 26.128266033254157 44-45 23.625 25.974999999999998 25.525 24.875 46-47 23.4375 26.2125 25.25 25.1 48-49 24.1375 25.912499999999998 25.4 24.55 50-51 23.6125 25.35 25.3 25.7375 52-53 23.5375 26.387500000000003 23.9875 26.087500000000002 54-55 23.724999999999998 25.0625 25.5375 25.674999999999997 56-57 23.9125 25.0625 25.912499999999998 25.112499999999997 58-59 23.9 25.887500000000003 24.887500000000003 25.324999999999996 60-61 24.825 25.45 24.5375 25.1875 62-63 24.0125 25.7 25.0 25.2875 64-65 23.724999999999998 25.85 25.025 25.4 66-67 23.868467116779193 25.743935983995996 25.35633908477119 25.03125781445361 68-69 23.32791598949869 25.240655081885237 25.828228528566072 25.603200400050007 70-71 24.253031628953618 25.378172271533945 25.653206650831358 24.715589448681087 72-73 24.5 25.5625 24.275 25.662499999999998 74-75 24.025 25.525 25.3125 25.137500000000003 76-77 23.962500000000002 25.724999999999998 25.2625 25.05 78-79 24.087500000000002 25.637500000000003 25.337500000000002 24.9375 80-81 24.425 25.124999999999996 24.712500000000002 25.7375 82-83 23.962500000000002 25.924999999999997 24.275 25.837500000000002 84-85 24.224999999999998 25.7 24.975 25.1 86-87 23.75 26.437500000000004 24.6625 25.15 88-89 24.224999999999998 26.150000000000002 24.1625 25.4625 90-91 24.0 25.825 24.775 25.4 92-93 25.2 25.8625 24.2375 24.7 94-95 23.7625 26.0625 24.9375 25.2375 96-97 25.2875 25.5 24.5625 24.65 98-99 25.0125 25.5625 24.325 25.1 100-101 24.9125 25.924999999999997 24.5125 24.65 102-103 25.074999999999996 26.85 23.974999999999998 24.099999999999998 104-105 25.8125 25.474999999999998 24.0125 24.7 106-107 24.825 26.4625 24.087500000000002 24.625 108-109 25.5375 27.5875 23.2875 23.5875 110-111 25.2625 26.724999999999998 23.3875 24.625 112-113 24.9375 27.275 22.9375 24.85 114-115 24.712500000000002 27.237499999999997 23.1625 24.887500000000003 116-117 25.662499999999998 27.85 22.0625 24.425 118-119 24.3875 28.825 21.85 24.9375 120-121 25.337500000000002 26.8375 22.575 25.25 122-123 24.5375 28.1375 22.0875 25.2375 124-125 24.7375 28.125 21.837500000000002 25.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 2.0 25 2.0 26 2.0 27 4.5 28 5.0 29 4.5 30 8.5 31 12.0 32 14.5 33 24.5 34 31.5 35 42.0 36 62.5 37 74.0 38 93.5 39 113.0 40 126.5 41 152.0 42 163.0 43 182.0 44 199.0 45 194.5 46 194.0 47 192.0 48 167.0 49 157.0 50 163.0 51 145.5 52 125.0 53 112.0 54 104.0 55 94.5 56 85.0 57 77.5 58 75.0 59 71.0 60 71.5 61 77.0 62 69.5 63 57.0 64 59.0 65 62.0 66 54.0 67 45.0 68 39.5 69 36.0 70 33.0 71 29.0 72 22.0 73 16.0 74 16.0 75 13.0 76 6.5 77 6.0 78 5.5 79 2.5 80 1.5 81 1.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0125 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.025 68-69 0.0125 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.16249999999999998 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.325 0.0 0.0 0.0 0.0 68-69 0.35 0.0 0.0 0.0 0.0 70-71 0.4125 0.0 0.0 0.0 0.0 72-73 0.475 0.0 0.0 0.0 0.0 74-75 0.6000000000000001 0.0 0.0 0.0 0.0 76-77 0.8125 0.0 0.0 0.0 0.0 78-79 1.1124999999999998 0.0 0.0 0.0 0.0 80-81 1.375 0.0 0.0 0.0 0.0 82-83 1.6125 0.0 0.0 0.0 0.0 84-85 1.9875 0.0 0.0 0.0 0.0 86-87 2.5625 0.0 0.0 0.0 0.0 88-89 3.1125 0.0 0.0 0.0 0.0 90-91 3.625 0.0 0.0 0.0 0.0 92-93 4.4 0.0 0.0 0.0 0.0 94-95 5.425 0.0 0.0 0.0 0.0 96-97 6.699999999999999 0.0 0.0 0.0 0.0 98-99 7.8 0.0 0.0 0.0 0.0 100-101 9.1 0.0 0.0 0.0 0.0 102-103 10.8125 0.0 0.0 0.0 0.0 104-105 12.8 0.0 0.0 0.0 0.0 106-107 14.837499999999999 0.0 0.0 0.0 0.0 108-109 17.1125 0.0 0.0 0.0 0.0 110-111 19.487499999999997 0.0 0.0 0.0 0.0 112-113 22.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCTTG 15 0.004088022 59.4875 74-75 >>END_MODULE Read 1136285 spots for SRR3691908.sra Written 1136285 spots for SRR3691908.sra Read 1136285 spots for SRR3691908.sra Written 1136285 spots for SRR3691908.sra Read 1136285 spots for SRR3691908.sra Written 1136285 spots for SRR3691908.sra Read 1136285 spots for SRR3691908.sra Written 1136285 spots for SRR3691908.sra Read 1136285 spots for SRR3691908.sra Written 1136285 spots for SRR3691908.sra Read 1136285 spots for SRR3691908.sra Written 1136285 spots for SRR3691908.sra Read 1136285 spots for SRR3691908.sra Written 1136285 spots for SRR3691908.sra Read 1136285 spots for SRR3691908.sra Written 1136285 spots for SRR3691908.sra Read 1136285 spots for SRR3691908.sra Written 1136285 spots for SRR3691908.sra Read 1136285 spots for SRR3691908.sra Written 1136285 spots for SRR3691908.sra Read 1136285 spots for SRR3691908.sra Written 1136285 spots for SRR3691908.sra Read 1136285 spots for SRR3691908.sra Written 1136285 spots for SRR3691908.sra Read 1136285 spots for SRR3691908.sra Written 1136285 spots for SRR3691908.sra Read 1136285 spots for SRR3691908.sra Written 1136285 spots for SRR3691908.sra Read 1136290 spots for SRR3691908.sra Written 1136290 spots for SRR3691908.sra Read 1136285 spots for SRR3691908.sra Written 1136285 spots for SRR3691908.sra Read 1136285 spots for SRR3691908.sra Written 1136285 spots for SRR3691908.sra Read 1136285 spots for SRR3691908.sra Written 1136285 spots for SRR3691908.sra Read 1136285 spots for SRR3691908.sra Written 1136285 spots for SRR3691908.sra Read 1136285 spots for SRR3691908.sra Written 1136285 spots for SRR3691908.sra SRR ids: ['SRR3691908.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o3pep87t SRR3691908.sra spots: 22725705 blocks: [[1, 1136285], [1136286, 2272570], [2272571, 3408855], [3408856, 4545140], [4545141, 5681425], [5681426, 6817710], [6817711, 7953995], [7953996, 9090280], [9090281, 10226565], [10226566, 11362850], [11362851, 12499135], [12499136, 13635420], [13635421, 14771705], [14771706, 15907990], [15907991, 17044275], [17044276, 18180560], [18180561, 19316845], [19316846, 20453130], [20453131, 21589415], [21589416, 22725705]] SRR3691908 file size 7234858 SRR3691908 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3691908 SRR3691908_1.fastq SRR3691908_2.fastq Input file: SRR3691908_1.fastq Paired file: SRR3691908_2.fastq trimmed: SRR3691908-trimmed-pair1.fastq, SRR3691908-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:04:45 2024 >> started Tue Dec 10 00:05:10 2024 >> done (24.892s) 22725705 read pairs processed; of these: 94 ( 0.00%) short read pairs filtered out after trimming by size control 6885 ( 0.03%) empty read pairs filtered out after trimming by size control 22718726 (99.97%) read pairs available; of these: 6815286 (30.00%) trimmed read pairs available after processing 15903440 (70.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 1 0.00% 21 1 0.00% 22 2 0.00% 23 2 0.00% 24 6 0.00% 25 2 0.00% 26 3 0.00% 27 9 0.00% 28 15 0.00% 29 17 0.00% 30 28 0.00% 31 20 0.00% 32 33 0.00% 33 33 0.00% 34 35 0.00% 35 40 0.00% 36 44 0.00% 37 65 0.00% 38 97 0.00% 39 108 0.00% 40 117 0.00% 41 145 0.00% 42 152 0.00% 43 190 0.00% 44 181 0.00% 45 231 0.00% 46 238 0.00% 47 264 0.00% 48 366 0.00% 49 424 0.00% 50 528 0.00% 51 568 0.00% 52 606 0.00% 53 649 0.00% 54 744 0.00% 55 741 0.00% 56 804 0.00% 57 897 0.00% 58 1130 0.00% 59 1298 0.01% 60 1554 0.01% 61 1838 0.01% 62 2094 0.01% 63 2246 0.01% 64 2461 0.01% 65 2582 0.01% 66 2831 0.01% 67 3266 0.01% 68 3541 0.02% 69 4111 0.02% 70 4819 0.02% 71 5586 0.02% 72 6495 0.03% 73 7659 0.03% 74 8400 0.04% 75 9030 0.04% 76 9775 0.04% 77 10729 0.05% 78 11697 0.05% 79 13255 0.06% 80 15067 0.07% 81 17325 0.08% 82 20181 0.09% 83 22898 0.10% 84 25678 0.11% 85 28354 0.12% 86 30215 0.13% 87 32264 0.14% 88 35181 0.15% 89 38069 0.17% 90 41507 0.18% 91 47041 0.21% 92 52554 0.23% 93 58561 0.26% 94 64843 0.29% 95 69145 0.30% 96 73210 0.32% 97 76951 0.34% 98 80204 0.35% 99 84257 0.37% 100 89456 0.39% 101 96213 0.42% 102 103497 0.46% 103 113475 0.50% 104 118605 0.52% 105 125770 0.55% 106 128789 0.57% 107 130257 0.57% 108 132430 0.58% 109 135655 0.60% 110 140359 0.62% 111 160824 0.71% 112 299315 1.32% 113 312504 1.38% 114 323483 1.42% 115 332769 1.46% 116 336524 1.48% 117 333620 1.47% 118 330253 1.45% 119 325890 1.43% 120 327601 1.44% 121 355841 1.57% 122 333829 1.47% 123 340479 1.50% 124 349533 1.54% 125 15903440 70.00% 22718726 reads passed initial QC criterion=sequence-density sequence-density=20.41 sequence-density-rank=1 fanout-score=33.67 fanout-score-rank=1 prefix-density=20.57 prefix-fanout=33.4 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAA criterion=fanout-score sequence-density=20.41 sequence-density-rank=1 fanout-score=33.67 fanout-score-rank=1 prefix-density=20.57 prefix-fanout=33.4 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAA criterion=sequence-density sequence-density=20.51 sequence-density-rank=1 fanout-score=46.23 fanout-score-rank=1 prefix-density=20.61 prefix-fanout=46.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=20.51 sequence-density-rank=1 fanout-score=46.23 fanout-score-rank=1 prefix-density=20.61 prefix-fanout=46.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAA -y AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3691908 SRR3691908_1.fastq SRR3691908_2.fastq Input file: SRR3691908_1.fastq Paired file: SRR3691908_2.fastq trimmed: SRR3691908-trimmed-pair1.fastq, SRR3691908-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:08:53 2024 >> started Tue Dec 10 00:10:22 2024 >> done (88.445s) 20555038 read pairs processed; of these: 76 ( 0.00%) short read pairs filtered out after trimming by size control 5675 ( 0.03%) empty read pairs filtered out after trimming by size control 20549287 (99.97%) read pairs available; of these: 2225801 (10.83%) trimmed read pairs available after processing 18323486 (89.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 3 0.00% 21 3 0.00% 22 3 0.00% 23 8 0.00% 24 7 0.00% 25 6 0.00% 26 10 0.00% 27 13 0.00% 28 25 0.00% 29 26 0.00% 30 44 0.00% 31 54 0.00% 32 61 0.00% 33 63 0.00% 34 77 0.00% 35 73 0.00% 36 107 0.00% 37 164 0.00% 38 174 0.00% 39 209 0.00% 40 225 0.00% 41 266 0.00% 42 277 0.00% 43 322 0.00% 44 344 0.00% 45 410 0.00% 46 417 0.00% 47 475 0.00% 48 609 0.00% 49 750 0.00% 50 924 0.00% 51 1016 0.00% 52 1137 0.01% 53 1202 0.01% 54 1348 0.01% 55 1388 0.01% 56 1413 0.01% 57 1642 0.01% 58 2031 0.01% 59 2382 0.01% 60 2815 0.01% 61 3338 0.02% 62 3769 0.02% 63 4131 0.02% 64 4563 0.02% 65 4673 0.02% 66 5115 0.02% 67 5872 0.03% 68 6340 0.03% 69 7503 0.04% 70 8796 0.04% 71 10113 0.05% 72 11677 0.06% 73 13552 0.07% 74 14975 0.07% 75 16263 0.08% 76 17781 0.09% 77 19429 0.09% 78 21241 0.10% 79 23742 0.12% 80 27067 0.13% 81 31177 0.15% 82 36702 0.18% 83 41412 0.20% 84 46489 0.23% 85 51131 0.25% 86 54948 0.27% 87 58639 0.29% 88 63470 0.31% 89 68676 0.33% 90 75433 0.37% 91 85144 0.41% 92 95139 0.46% 93 105592 0.51% 94 117018 0.57% 95 124612 0.61% 96 131833 0.64% 97 139070 0.68% 98 144385 0.70% 99 151126 0.74% 100 161555 0.79% 101 173345 0.84% 102 186127 0.91% 103 203693 0.99% 104 214626 1.04% 105 225968 1.10% 106 232215 1.13% 107 235659 1.15% 108 239357 1.16% 109 244685 1.19% 110 249592 1.21% 111 258382 1.26% 112 270902 1.32% 113 282434 1.37% 114 292607 1.42% 115 300880 1.46% 116 304711 1.48% 117 301732 1.47% 118 298712 1.45% 119 294927 1.44% 120 296073 1.44% 121 319880 1.56% 122 302077 1.47% 123 307834 1.50% 124 315890 1.54% 125 12160955 59.18% criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.40 fanout-score-rank=31 prefix-density=0.14 prefix-fanout=2.7 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=19 fanout-score=200.01 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=24.1 sequence=AGCAGCAGCAGC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=37 prefix-density=0.14 prefix-fanout=2.6 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=20 fanout-score=221.99 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=25.5 sequence=AGCAGCAGCAGC SRR3691908 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:12:19 Started mapping on | Dec 10 00:12:19 Finished on | Dec 10 00:13:56 Mapping speed, Million of reads per hour | 842.96 Number of input reads | 22712975 Average input read length | 236 UNIQUE READS: Uniquely mapped reads number | 21310961 Uniquely mapped reads % | 93.83% Average mapped length | 235.80 Number of splices: Total | 15698882 Number of splices: Annotated (sjdb) | 14743990 Number of splices: GT/AG | 15488966 Number of splices: GC/AG | 176754 Number of splices: AT/AC | 8125 Number of splices: Non-canonical | 25037 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.03 Insertion rate per base | 0.01% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 466730 % of reads mapped to multiple loci | 2.05% Number of reads mapped to too many loci | 89285 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.46% % of reads unmapped: other | 1.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 935424 935424 935424 N_multimapping 466730 466730 466730 N_noFeature 984082 11006675 10892573 N_ambiguous 450473 28997 28145 UnstrandedReadsAssigned:19876406 PositiveStrandReadsAssigned:10275289 NegativeStrandReadsAssigned:10390243 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=110 echo kmer=105 SRR3691908 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3691908-trimmed-pair1.fastq SRR3691908-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,712,975 reads, 20,747,205 reads pseudoaligned [quant] estimated average fragment length: 135.14 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52973 SRR3691908.ke.tsv 35125 SRR3691908.se.tsv 88098 total ==> SRR3691908.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 802.026 0 0 PNS24247 1044 909.86 84.8901 6.84343 PNS24249 1928 1793.86 200.983 8.21793 PNS24246 1044 909.86 84.8901 6.84343 PNS24248 1044 909.86 84.8901 6.84343 PNS24244 1471 1336.86 152.346 8.35867 PNS24243 293 160.56 12 5.48194 KQK14069 1603 1468.86 30450.9 1520.58 KQK14071 474 341.122 2777.9 597.308 ==> SRR3691908.se.tsv <== BRADI_1g14170v3 38581 BRADI_1g53295v3 33 BRADI_1g59795v3 1325 BRADI_1g07683v3 0 BRADI_1g00485v3 26 BRADI_1g20270v3 170 BRADI_1g74790v3 207 BRADI_1g09890v3 0 BRADI_1g77505v3 304 BRADI_1g48960v3 0 SRR3691908 completed mapping pipeline successfully