Starting /dee2/code/volunteer_pipeline.sh SRR3691909 current disk space = 1523602636800 free memory = 1397141960 SRR3691909 SRAfilesize 71443e820f2502fa3b8642e488014ffb SRR3691909.sra SRR3691909.sra file validated SRR3691909 is paired end SRR3691909 is conventional basespace SRR3691909 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691909_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.49975 34.0 33.0 34.0 32.0 34.0 2 33.01875 34.0 33.0 34.0 32.0 34.0 3 33.1285 34.0 33.0 34.0 32.0 34.0 4 33.11275 34.0 33.0 34.0 32.0 34.0 5 33.25675 34.0 33.0 34.0 32.0 34.0 6 36.8365 38.0 37.0 38.0 35.0 38.0 7 37.28925 38.0 38.0 38.0 36.0 38.0 8 37.33625 38.0 38.0 38.0 37.0 38.0 9 37.3695 38.0 38.0 38.0 37.0 38.0 10-11 37.3895 38.0 38.0 38.0 37.0 38.0 12-13 37.396625 38.0 38.0 38.0 37.0 38.0 14-15 37.418125 38.0 38.0 38.0 37.0 38.0 16-17 37.443 38.0 38.0 38.0 37.0 38.0 18-19 37.399874999999994 38.0 38.0 38.0 37.0 38.0 20-21 37.397375 38.0 38.0 38.0 37.0 38.0 22-23 37.419125 38.0 38.0 38.0 37.0 38.0 24-25 37.346875 38.0 38.0 38.0 37.0 38.0 26-27 37.358374999999995 38.0 38.0 38.0 37.0 38.0 28-29 37.323499999999996 38.0 38.0 38.0 37.0 38.0 30-31 37.3085 38.0 38.0 38.0 37.0 38.0 32-33 37.335 38.0 38.0 38.0 37.0 38.0 34-35 37.346000000000004 38.0 38.0 38.0 37.0 38.0 36-37 37.35425 38.0 38.0 38.0 37.0 38.0 38-39 37.309124999999995 38.0 38.0 38.0 37.0 38.0 40-41 37.30325 38.0 38.0 38.0 37.0 38.0 42-43 37.269125 38.0 38.0 38.0 37.0 38.0 44-45 37.209999999999994 38.0 38.0 38.0 36.5 38.0 46-47 37.149875 38.0 38.0 38.0 36.0 38.0 48-49 37.204875 38.0 38.0 38.0 36.0 38.0 50-51 37.171 38.0 38.0 38.0 36.0 38.0 52-53 37.121624999999995 38.0 38.0 38.0 36.0 38.0 54-55 37.15375 38.0 38.0 38.0 36.0 38.0 56-57 37.0845 38.0 38.0 38.0 36.0 38.0 58-59 37.15025 38.0 38.0 38.0 36.0 38.0 60-61 37.188625 38.0 38.0 38.0 36.0 38.0 62-63 37.14775 38.0 38.0 38.0 36.0 38.0 64-65 37.090625 38.0 38.0 38.0 36.0 38.0 66-67 37.080875 38.0 38.0 38.0 36.0 38.0 68-69 37.075374999999994 38.0 38.0 38.0 36.0 38.0 70-71 37.053625 38.0 38.0 38.0 36.0 38.0 72-73 37.055375 38.0 38.0 38.0 36.0 38.0 74-75 37.03075 38.0 38.0 38.0 36.0 38.0 76-77 37.078125 38.0 38.0 38.0 36.0 38.0 78-79 36.979125 38.0 38.0 38.0 35.5 38.0 80-81 36.94425 38.0 38.0 38.0 35.5 38.0 82-83 36.940375 38.0 38.0 38.0 35.5 38.0 84-85 36.91925 38.0 38.0 38.0 35.0 38.0 86-87 36.845 38.0 38.0 38.0 35.0 38.0 88-89 36.819874999999996 38.0 38.0 38.0 35.0 38.0 90-91 36.606625 38.0 38.0 38.0 34.0 38.0 92-93 36.78775 38.0 38.0 38.0 35.0 38.0 94-95 36.717875 38.0 38.0 38.0 34.5 38.0 96-97 36.647375 38.0 38.0 38.0 34.0 38.0 98-99 36.711125 38.0 38.0 38.0 35.0 38.0 100-101 36.71325 38.0 38.0 38.0 34.5 38.0 102-103 36.632625000000004 38.0 38.0 38.0 34.5 38.0 104-105 36.526875000000004 38.0 38.0 38.0 34.0 38.0 106-107 36.509249999999994 38.0 38.0 38.0 34.0 38.0 108-109 36.472125 38.0 38.0 38.0 34.0 38.0 110-111 36.625625 38.0 38.0 38.0 34.0 38.0 112-113 36.533500000000004 38.0 38.0 38.0 34.0 38.0 114-115 36.385125 38.0 38.0 38.0 34.0 38.0 116-117 36.281875 38.0 38.0 38.0 33.5 38.0 118-119 36.194125 38.0 37.5 38.0 33.5 38.0 120-121 36.325500000000005 38.0 38.0 38.0 34.0 38.0 122-123 36.270375 38.0 38.0 38.0 33.5 38.0 124-125 36.222375 38.0 37.5 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 3.0 24 2.0 25 6.0 26 10.0 27 14.0 28 30.0 29 23.0 30 39.0 31 60.0 32 48.0 33 88.0 34 104.0 35 173.0 36 388.0 37 3010.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.78240859115316 12.247507031449757 8.949117872666838 38.02096650473025 2 25.074999999999996 15.2 32.125 27.6 3 23.425 20.025000000000002 24.375 32.175 4 26.1 26.674999999999997 21.725 25.5 5 27.325 30.3 22.2 20.175 6 22.425 31.574999999999996 23.825 22.175 7 18.65 23.425 37.525 20.4 8 21.275 23.0 28.549999999999997 27.175 9 19.900000000000002 21.9 32.15 26.05 10-11 23.849999999999998 30.0375 22.037499999999998 24.075 12-13 23.025000000000002 24.712500000000002 26.437500000000004 25.825 14-15 23.225 25.5 25.412499999999998 25.8625 16-17 23.65 25.55 25.7375 25.0625 18-19 24.45 25.8125 25.137500000000003 24.6 20-21 22.8 26.200000000000003 25.624999999999996 25.374999999999996 22-23 23.825 25.95 24.975 25.25 24-25 23.6875 26.387500000000003 24.525 25.4 26-27 23.974999999999998 25.55 25.087500000000002 25.387500000000003 28-29 22.9625 25.674999999999997 24.7375 26.625 30-31 23.8125 25.5 25.0375 25.650000000000002 32-33 23.5 25.5 26.0 25.0 34-35 23.849999999999998 25.825 25.1 25.224999999999998 36-37 24.0125 25.412499999999998 25.424999999999997 25.15 38-39 23.474999999999998 26.187500000000004 24.525 25.8125 40-41 23.875 25.275 25.1 25.75 42-43 24.0625 25.324999999999996 24.8625 25.75 44-45 23.2875 25.387500000000003 25.424999999999997 25.900000000000002 46-47 23.3625 26.8625 24.65 25.124999999999996 48-49 23.5125 25.0375 25.4625 25.9875 50-51 23.3375 25.2625 24.775 26.625 52-53 24.099999999999998 25.05 24.962500000000002 25.887500000000003 54-55 22.662499999999998 25.85 24.7375 26.75 56-57 23.150000000000002 25.474999999999998 25.074999999999996 26.3 58-59 24.775 25.337500000000002 25.112499999999997 24.775 60-61 23.6375 25.6 25.137500000000003 25.624999999999996 62-63 24.1125 25.825 25.8 24.2625 64-65 24.1375 25.0125 24.875 25.974999999999998 66-67 23.7375 25.5125 25.25 25.5 68-69 23.5125 25.95 24.875 25.662499999999998 70-71 23.925 26.1125 24.887500000000003 25.074999999999996 72-73 23.6125 25.4875 25.2 25.7 74-75 24.2625 24.962500000000002 26.387500000000003 24.3875 76-77 24.4875 24.6125 25.2625 25.637500000000003 78-79 23.825 25.825 25.124999999999996 25.224999999999998 80-81 23.1 25.55 24.887500000000003 26.4625 82-83 24.712500000000002 26.174999999999997 24.224999999999998 24.887500000000003 84-85 23.3875 26.3125 24.6 25.7 86-87 24.15 25.324999999999996 25.162499999999998 25.362499999999997 88-89 23.8875 25.6 24.5375 25.974999999999998 90-91 24.675 25.3 24.4375 25.587500000000002 92-93 23.425 25.112499999999997 24.8 26.6625 94-95 24.65 24.9875 25.374999999999996 24.9875 96-97 24.7 25.55 23.0625 26.687499999999996 98-99 23.7375 26.174999999999997 24.962500000000002 25.124999999999996 100-101 24.5 25.9875 23.8125 25.7 102-103 23.150000000000002 26.487500000000004 24.325 26.0375 104-105 24.587500000000002 26.7125 23.849999999999998 24.85 106-107 25.3 25.912499999999998 23.4125 25.374999999999996 108-109 24.9375 26.487500000000004 23.0375 25.5375 110-111 25.587500000000002 26.424999999999997 22.95 25.0375 112-113 25.75 25.587500000000002 24.075 24.587500000000002 114-115 24.85 26.625 22.8 25.724999999999998 116-117 25.45 26.987499999999997 23.1 24.462500000000002 118-119 25.1 26.825 22.2125 25.8625 120-121 24.875 27.025 22.6875 25.412499999999998 122-123 25.5125 27.55 21.3125 25.624999999999996 124-125 25.587500000000002 27.275 21.675 25.4625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 0.5 27 1.5 28 4.0 29 6.0 30 11.0 31 15.5 32 19.0 33 29.0 34 35.5 35 36.0 36 49.0 37 81.0 38 97.0 39 115.0 40 145.0 41 145.5 42 145.5 43 162.5 44 193.5 45 197.0 46 182.0 47 189.0 48 171.0 49 156.0 50 150.5 51 137.5 52 127.5 53 111.0 54 109.5 55 105.0 56 95.5 57 87.5 58 76.0 59 76.5 60 69.5 61 60.5 62 59.0 63 55.5 64 58.5 65 55.0 66 53.5 67 55.5 68 44.0 69 41.0 70 41.0 71 32.5 72 26.0 73 22.0 74 19.0 75 14.0 76 9.5 77 7.0 78 5.0 79 2.5 80 0.5 81 0.0 82 0.0 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.575 0.0 0.0 0.0 0.0 80-81 0.7625 0.0 0.0 0.0 0.0 82-83 0.9874999999999999 0.0 0.0 0.0 0.0 84-85 1.1375000000000002 0.0 0.0 0.0 0.0 86-87 1.4500000000000002 0.0 0.0 0.0 0.0 88-89 1.8250000000000002 0.0 0.0 0.0 0.0 90-91 2.2874999999999996 0.0 0.0 0.0 0.0 92-93 2.8875 0.0 0.0 0.0 0.0 94-95 3.525 0.0 0.0 0.0 0.0 96-97 4.4 0.0 0.0 0.0 0.0 98-99 5.325 0.0 0.0 0.0 0.0 100-101 6.1125 0.0 0.0 0.0 0.0 102-103 7.0 0.0 0.0 0.0 0.0 104-105 8.3375 0.0 0.0 0.0 0.0 106-107 10.0125 0.0 0.0 0.0 0.0 108-109 11.6125 0.0 0.0 0.0 0.0 110-111 13.1125 0.0 0.0 0.0 0.0 112-113 14.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3691909 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691909_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6785 33.0 33.0 34.0 32.0 34.0 2 32.7515 33.0 33.0 34.0 32.0 34.0 3 32.731 34.0 33.0 34.0 32.0 34.0 4 32.54475 34.0 33.0 34.0 32.0 34.0 5 32.615 34.0 33.0 34.0 32.0 34.0 6 36.7215 38.0 38.0 38.0 35.0 38.0 7 36.84725 38.0 38.0 38.0 36.0 38.0 8 36.83325 38.0 38.0 38.0 36.0 38.0 9 36.801 38.0 38.0 38.0 36.0 38.0 10-11 36.72825 38.0 38.0 38.0 35.0 38.0 12-13 36.72825 38.0 38.0 38.0 35.5 38.0 14-15 36.759625 38.0 38.0 38.0 35.5 38.0 16-17 36.738249999999994 38.0 38.0 38.0 35.5 38.0 18-19 36.807375 38.0 38.0 38.0 36.0 38.0 20-21 36.828 38.0 38.0 38.0 36.0 38.0 22-23 36.738875 38.0 38.0 38.0 35.5 38.0 24-25 36.768375 38.0 38.0 38.0 35.5 38.0 26-27 36.715875 38.0 38.0 38.0 35.5 38.0 28-29 36.7705 38.0 38.0 38.0 36.0 38.0 30-31 36.795 38.0 38.0 38.0 36.0 38.0 32-33 36.79 38.0 38.0 38.0 36.0 38.0 34-35 36.738375000000005 38.0 38.0 38.0 35.5 38.0 36-37 36.69175 38.0 38.0 38.0 35.0 38.0 38-39 36.74525 38.0 38.0 38.0 35.5 38.0 40-41 36.75125 38.0 38.0 38.0 35.5 38.0 42-43 36.741375 38.0 38.0 38.0 36.0 38.0 44-45 36.728624999999994 38.0 38.0 38.0 35.5 38.0 46-47 36.7535 38.0 38.0 38.0 35.5 38.0 48-49 36.78925 38.0 38.0 38.0 35.0 38.0 50-51 36.721875 38.0 38.0 38.0 35.5 38.0 52-53 36.7785 38.0 38.0 38.0 35.0 38.0 54-55 36.688125 38.0 38.0 38.0 35.0 38.0 56-57 36.595625 38.0 38.0 38.0 35.0 38.0 58-59 36.587 38.0 38.0 38.0 35.0 38.0 60-61 36.560874999999996 38.0 38.0 38.0 34.0 38.0 62-63 36.672250000000005 38.0 38.0 38.0 35.0 38.0 64-65 36.622125 38.0 38.0 38.0 34.5 38.0 66-67 36.5955 38.0 38.0 38.0 35.0 38.0 68-69 36.52875 38.0 38.0 38.0 34.5 38.0 70-71 36.484625 38.0 38.0 38.0 34.5 38.0 72-73 36.541375 38.0 38.0 38.0 34.0 38.0 74-75 36.459875 38.0 38.0 38.0 34.5 38.0 76-77 36.45675 38.0 38.0 38.0 34.0 38.0 78-79 36.433375 38.0 38.0 38.0 34.5 38.0 80-81 36.44499999999999 38.0 38.0 38.0 34.0 38.0 82-83 36.42425 38.0 38.0 38.0 34.0 38.0 84-85 36.2275 38.0 38.0 38.0 34.0 38.0 86-87 36.2585 38.0 38.0 38.0 34.0 38.0 88-89 36.2265 38.0 38.0 38.0 34.0 38.0 90-91 36.230875 38.0 38.0 38.0 34.0 38.0 92-93 36.141000000000005 38.0 38.0 38.0 33.5 38.0 94-95 36.076499999999996 38.0 38.0 38.0 33.0 38.0 96-97 36.04125 38.0 38.0 38.0 33.0 38.0 98-99 35.940625 38.0 38.0 38.0 33.0 38.0 100-101 35.947874999999996 38.0 38.0 38.0 33.0 38.0 102-103 35.948375 38.0 38.0 38.0 33.0 38.0 104-105 36.012125 38.0 38.0 38.0 33.0 38.0 106-107 35.879374999999996 38.0 38.0 38.0 33.0 38.0 108-109 35.805875 38.0 37.5 38.0 31.0 38.0 110-111 35.752375 38.0 37.0 38.0 31.0 38.0 112-113 35.62825 38.0 37.0 38.0 31.0 38.0 114-115 35.69375 38.0 37.0 38.0 31.0 38.0 116-117 35.52575 38.0 37.0 38.0 30.0 38.0 118-119 35.074 38.0 36.0 38.0 27.5 38.0 120-121 34.828 38.0 36.0 38.0 25.5 38.0 122-123 34.82525 38.0 36.0 38.0 26.0 38.0 124-125 34.71875 38.0 35.0 38.0 25.5 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 2.0 16 4.0 17 24.0 18 12.0 19 9.0 20 9.0 21 6.0 22 5.0 23 14.0 24 12.0 25 21.0 26 24.0 27 23.0 28 30.0 29 40.0 30 45.0 31 63.0 32 68.0 33 87.0 34 107.0 35 190.0 36 362.0 37 2839.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.503386004514674 17.63230499122147 12.239779282668675 30.624529721595184 2 29.46182728410513 22.27784730913642 27.2090112640801 21.051314142678347 3 22.753441802252816 25.406758448060074 28.28535669586984 23.554443053817273 4 28.410513141426787 30.387984981226534 20.750938673341675 20.450563204005007 5 29.43679599499374 31.414267834793492 18.02252816020025 21.126408010012515 6 23.517638228671505 34.35076307230423 19.83987990993245 22.291718789091817 7 23.267450587940957 18.263697773329998 34.82611958969227 23.642732049036777 8 25.01876407305479 21.891418563922944 24.468351263447584 28.621466099574683 9 23.767825869402053 23.167375531648737 26.8951713785339 26.169627220415308 10-11 27.168064072081094 27.918908772368916 20.83594043298711 24.077086722562882 12-13 25.632040050062578 22.90362953692115 25.193992490613265 26.270337922403 14-15 25.193992490613265 25.381727158948685 24.355444305381727 25.06883604505632 16-17 27.146433041301627 24.518147684605758 24.23028785982478 24.105131414267834 18-19 26.057571964956196 25.081351689612013 24.4180225281602 24.44305381727159 20-21 25.7007007007007 24.874874874874877 24.286786786786788 25.13763763763764 22-23 26.42901813633521 24.202626641651033 25.328330206378986 24.04002501563477 24-25 26.09457092819615 24.74355766825119 25.093820365273956 24.06805103827871 26-27 26.14133833646029 25.37836147592245 24.72795497185741 23.75234521575985 28-29 25.293970477858394 24.818613960470355 25.31898924193145 24.568426319739807 30-31 25.600600600600597 24.587087087087088 25.350350350350347 24.46196196196196 32-33 25.459777305142 25.13449268109596 25.534842987614166 23.87088702614788 34-35 26.957718288716535 24.843632724543408 24.25569176882662 23.942957217913435 36-37 25.422033262473427 25.334500437664126 24.84681755658372 24.39664874327873 38-39 26.275637818909452 24.987493746873437 25.125062531265634 23.611805902951478 40-41 26.160390341548855 24.92180658075816 24.183660703115226 24.734142374577754 42-43 25.268951713785338 24.59344508381286 25.331498623967974 24.806104578433825 44-45 26.360565494807958 24.646565745026898 25.509821093456775 23.48304766670837 46-47 25.547353934692858 24.92180658075816 25.284624046040282 24.246215438508695 48-49 25.178325616318357 24.502565386059317 25.954198473282442 24.364910524339884 50-51 26.23279098873592 25.344180225281605 25.06883604505632 23.35419274092616 52-53 25.716430984857965 25.403579026404703 24.427480916030532 24.452509072706796 54-55 25.03128911138924 25.594493116395494 25.919899874843555 23.454317897371716 56-57 26.23279098873592 24.63078848560701 24.668335419274094 24.46808510638298 58-59 25.975975975975974 24.93743743743744 24.56206206206206 24.524524524524523 60-61 25.591290201476664 24.790389187836315 25.62883243649105 23.98948817419597 62-63 25.33783783783784 25.212712712712715 24.374374374374376 25.075075075075077 64-65 25.94445834375782 25.544158118588946 25.13134851138354 23.380035026269702 66-67 25.74430823117338 24.931198398799097 25.369026770077557 23.95546659994996 68-69 26.20982868575716 25.5220707765412 24.621733149931224 23.646367387770415 70-71 26.372389646117295 24.771789421032885 24.871826935100664 23.983993997749156 72-73 25.700350175087543 24.949974987493746 25.07503751875938 24.274637318659327 74-75 25.175087543771884 25.68784392196098 25.100050025012504 24.037018509254626 76-77 25.250125062531264 25.587793896948476 25.26263131565783 23.899449724862432 78-79 24.68101075806855 24.618463847885916 26.99524643482612 23.705278959219413 80-81 25.531648736552416 24.756067050287715 26.019514635976982 23.692769577182887 82-83 26.016768864973095 25.62883243649105 24.978100362908272 23.37629833562758 84-85 26.320400500625784 24.793491864831037 25.00625782227785 23.879849812265334 86-87 25.219023779724658 26.220275344180227 25.00625782227785 23.554443053817273 88-89 25.64455569461827 25.256570713391742 25.594493116395494 23.504380475594495 90-91 24.90613266583229 25.14392991239049 25.494367959949937 24.455569461827285 92-93 26.420525657071337 25.306633291614517 24.780976220275345 23.491864831038797 94-95 25.753973219872357 25.103241146289573 25.62883243649105 23.513953197347014 96-97 25.744680851063826 26.708385481852314 24.918648310387987 22.62828535669587 98-99 26.733416770963704 26.12015018773467 24.69336670838548 22.453066332916144 100-101 26.207759699624532 25.33166458072591 25.431789737171464 23.028785982478098 102-103 26.921151439299123 25.33166458072591 24.918648310387987 22.828535669586984 104-105 27.384230287859822 26.020025031289112 24.267834793491865 22.327909887359198 106-107 27.284105131414265 26.307884856070086 24.180225281602002 22.22778473091364 108-109 27.496871088861074 25.18147684605757 24.680851063829788 22.640801001251564 110-111 27.77221526908636 25.944931163954944 24.81852315394243 21.46433041301627 112-113 27.88485607008761 26.670838548185234 23.67959949937422 21.764705882352942 114-115 27.934918648310386 26.708385481852314 23.44180225281602 21.914893617021278 116-117 28.585732165206508 26.99624530663329 23.30413016270338 21.11389236545682 118-119 29.25170068027211 26.127488032249936 23.46938775510204 21.15142353237591 120-121 29.68513853904282 26.41057934508816 23.375314861460957 20.52896725440806 122-123 29.353985644125423 27.011711371363806 23.284221130839946 20.350081853670822 124-125 29.924433249370274 27.405541561712848 22.921914357682617 19.748110831234257 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 1.0 13 1.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.5 19 0.5 20 0.0 21 1.5 22 1.5 23 0.5 24 1.0 25 2.5 26 3.5 27 3.5 28 6.5 29 7.5 30 11.5 31 16.0 32 15.5 33 22.0 34 30.5 35 38.0 36 49.0 37 67.0 38 80.5 39 107.0 40 126.0 41 133.0 42 151.0 43 164.0 44 191.0 45 196.5 46 179.0 47 173.0 48 164.5 49 147.0 50 143.0 51 140.0 52 134.0 53 121.0 54 107.0 55 103.0 56 92.0 57 82.5 58 80.5 59 81.5 60 72.5 61 72.0 62 73.0 63 60.0 64 59.0 65 60.5 66 60.0 67 60.5 68 52.0 69 47.5 70 42.0 71 32.5 72 28.5 73 25.5 74 16.5 75 15.5 76 18.0 77 10.0 78 4.0 79 3.5 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.125 3 0.125 4 0.125 5 0.125 6 0.075 7 0.075 8 0.075 9 0.075 10-11 0.11249999999999999 12-13 0.125 14-15 0.125 16-17 0.125 18-19 0.125 20-21 0.1 22-23 0.0625 24-25 0.075 26-27 0.0625 28-29 0.075 30-31 0.1 32-33 0.08750000000000001 34-35 0.075 36-37 0.0375 38-39 0.05 40-41 0.08750000000000001 42-43 0.075 44-45 0.08750000000000001 46-47 0.08750000000000001 48-49 0.11249999999999999 50-51 0.125 52-53 0.11249999999999999 54-55 0.125 56-57 0.125 58-59 0.1 60-61 0.11249999999999999 62-63 0.1 64-65 0.075 66-67 0.075 68-69 0.0375 70-71 0.0375 72-73 0.05 74-75 0.05 76-77 0.05 78-79 0.075 80-81 0.075 82-83 0.11249999999999999 84-85 0.125 86-87 0.125 88-89 0.125 90-91 0.125 92-93 0.125 94-95 0.11249999999999999 96-97 0.125 98-99 0.125 100-101 0.125 102-103 0.125 104-105 0.125 106-107 0.125 108-109 0.125 110-111 0.125 112-113 0.125 114-115 0.125 116-117 0.125 118-119 0.775 120-121 0.75 122-123 0.7374999999999999 124-125 0.75 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.5249999999999999 0.0 0.0 0.0 0.0 80-81 0.7125 0.0 0.0 0.0 0.0 82-83 0.95 0.0 0.0 0.0 0.0 84-85 1.1124999999999998 0.0 0.0 0.0 0.0 86-87 1.3875000000000002 0.0 0.0 0.0 0.0 88-89 1.725 0.0 0.0 0.0 0.0 90-91 2.1624999999999996 0.0 0.0 0.0 0.0 92-93 2.775 0.0 0.0 0.0 0.0 94-95 3.4375 0.0 0.0 0.0 0.0 96-97 4.35 0.0 0.0 0.0 0.0 98-99 5.225 0.0 0.0 0.0 0.0 100-101 5.9875 0.0 0.0 0.0 0.0 102-103 6.85 0.0 0.0 0.0 0.0 104-105 8.175 0.0 0.0 0.0 0.0 106-107 9.7375 0.0 0.0 0.0 0.0 108-109 11.3125 0.0 0.0 0.0 0.0 110-111 12.7625 0.0 0.0 0.0 0.0 112-113 14.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1185397 spots for SRR3691909.sra Written 1185397 spots for SRR3691909.sra Read 1185397 spots for SRR3691909.sra Written 1185397 spots for SRR3691909.sra Read 1185397 spots for SRR3691909.sra Written 1185397 spots for SRR3691909.sra Read 1185397 spots for SRR3691909.sra Written 1185397 spots for SRR3691909.sra Read 1185397 spots for SRR3691909.sra Written 1185397 spots for SRR3691909.sra Read 1185397 spots for SRR3691909.sra Written 1185397 spots for SRR3691909.sra Read 1185397 spots for SRR3691909.sra Written 1185397 spots for SRR3691909.sra Read 1185397 spots for SRR3691909.sra Written 1185397 spots for SRR3691909.sra Read 1185397 spots for SRR3691909.sra Written 1185397 spots for SRR3691909.sra Read 1185397 spots for SRR3691909.sra Written 1185397 spots for SRR3691909.sra Read 1185397 spots for SRR3691909.sra Written 1185397 spots for SRR3691909.sra Read 1185397 spots for SRR3691909.sra Written 1185397 spots for SRR3691909.sra Read 1185397 spots for SRR3691909.sra Written 1185397 spots for SRR3691909.sra Read 1185397 spots for SRR3691909.sra Written 1185397 spots for SRR3691909.sra Read 1185397 spots for SRR3691909.sra Written 1185397 spots for SRR3691909.sra Read 1185397 spots for SRR3691909.sra Written 1185397 spots for SRR3691909.sra Read 1185401 spots for SRR3691909.sra Written 1185401 spots for SRR3691909.sra Read 1185397 spots for SRR3691909.sra Written 1185397 spots for SRR3691909.sra Read 1185397 spots for SRR3691909.sra Written 1185397 spots for SRR3691909.sra Read 1185397 spots for SRR3691909.sra Written 1185397 spots for SRR3691909.sra SRR ids: ['SRR3691909.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8021b15b SRR3691909.sra spots: 23707944 blocks: [[1, 1185397], [1185398, 2370794], [2370795, 3556191], [3556192, 4741588], [4741589, 5926985], [5926986, 7112382], [7112383, 8297779], [8297780, 9483176], [9483177, 10668573], [10668574, 11853970], [11853971, 13039367], [13039368, 14224764], [14224765, 15410161], [15410162, 16595558], [16595559, 17780955], [17780956, 18966352], [18966353, 20151749], [20151750, 21337146], [21337147, 22522543], [22522544, 23707944]] SRR3691909 file size 7548023 SRR3691909 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3691909 SRR3691909_1.fastq SRR3691909_2.fastq Input file: SRR3691909_1.fastq Paired file: SRR3691909_2.fastq trimmed: SRR3691909-trimmed-pair1.fastq, SRR3691909-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:05:06 2024 >> started Tue Dec 10 00:05:34 2024 >> done (27.633s) 23707944 read pairs processed; of these: 177 ( 0.00%) short read pairs filtered out after trimming by size control 5692 ( 0.02%) empty read pairs filtered out after trimming by size control 23702075 (99.98%) read pairs available; of these: 7220133 (30.46%) trimmed read pairs available after processing 16481942 (69.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 7 0.00% 20 7 0.00% 21 4 0.00% 22 3 0.00% 23 6 0.00% 24 0 0.00% 25 4 0.00% 26 5 0.00% 27 7 0.00% 28 13 0.00% 29 16 0.00% 30 23 0.00% 31 24 0.00% 32 44 0.00% 33 28 0.00% 34 51 0.00% 35 51 0.00% 36 70 0.00% 37 88 0.00% 38 106 0.00% 39 133 0.00% 40 166 0.00% 41 187 0.00% 42 210 0.00% 43 236 0.00% 44 237 0.00% 45 267 0.00% 46 327 0.00% 47 336 0.00% 48 467 0.00% 49 570 0.00% 50 625 0.00% 51 746 0.00% 52 805 0.00% 53 869 0.00% 54 985 0.00% 55 964 0.00% 56 1164 0.00% 57 1242 0.01% 58 1477 0.01% 59 1740 0.01% 60 2047 0.01% 61 2361 0.01% 62 2709 0.01% 63 2996 0.01% 64 3324 0.01% 65 3662 0.02% 66 4062 0.02% 67 4242 0.02% 68 4812 0.02% 69 5454 0.02% 70 6455 0.03% 71 7775 0.03% 72 9125 0.04% 73 10293 0.04% 74 11495 0.05% 75 12389 0.05% 76 13667 0.06% 77 14309 0.06% 78 16075 0.07% 79 18338 0.08% 80 20903 0.09% 81 24280 0.10% 82 28009 0.12% 83 31990 0.13% 84 36081 0.15% 85 39511 0.17% 86 42454 0.18% 87 45050 0.19% 88 49189 0.21% 89 53014 0.22% 90 58914 0.25% 91 66510 0.28% 92 75324 0.32% 93 84557 0.36% 94 93940 0.40% 95 100186 0.42% 96 105892 0.45% 97 111169 0.47% 98 115514 0.49% 99 122227 0.52% 100 131759 0.56% 101 141340 0.60% 102 153432 0.65% 103 168377 0.71% 104 179241 0.76% 105 190449 0.80% 106 194886 0.82% 107 199708 0.84% 108 201442 0.85% 109 207802 0.88% 110 213261 0.90% 111 221927 0.94% 112 234343 0.99% 113 247423 1.04% 114 260101 1.10% 115 269447 1.14% 116 272125 1.15% 117 271675 1.15% 118 269812 1.14% 119 266984 1.13% 120 270100 1.14% 121 305392 1.29% 122 280060 1.18% 123 292215 1.23% 124 302217 1.28% 125 16481942 69.54% 23702075 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=33 prefix-density=0.19 prefix-fanout=2.2 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=10 fanout-score=240.95 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=24.6 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=37 prefix-density=0.16 prefix-fanout=2.1 sequence=TGCATGTACGTAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=186.19 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=22.3 sequence=CAAGAAGAAGGT SRR3691909 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:06:33 Started mapping on | Dec 10 00:06:33 Finished on | Dec 10 00:08:12 Mapping speed, Million of reads per hour | 861.89 Number of input reads | 23702075 Average input read length | 240 UNIQUE READS: Uniquely mapped reads number | 22204034 Uniquely mapped reads % | 93.68% Average mapped length | 239.46 Number of splices: Total | 16343535 Number of splices: Annotated (sjdb) | 15336269 Number of splices: GT/AG | 16119161 Number of splices: GC/AG | 190059 Number of splices: AT/AC | 8270 Number of splices: Non-canonical | 26045 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.01 Insertion rate per base | 0.01% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 446749 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 83343 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.77% % of reads unmapped: other | 1.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1051589 1051589 1051589 N_multimapping 446749 446749 446749 N_noFeature 978694 21493439 1261009 N_ambiguous 488998 2382 60546 UnstrandedReadsAssigned:20736342 PositiveStrandReadsAssigned:708213 NegativeStrandReadsAssigned:20882479 Dataset is classified negative stranded MeadianReadLen=125 20thPercentileLength=116 echo kmer=111 SRR3691909 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3691909-trimmed-pair1.fastq SRR3691909-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,702,075 reads, 21,217,889 reads pseudoaligned [quant] estimated average fragment length: 146.761 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52973 SRR3691909.ke.tsv 35125 SRR3691909.se.tsv 88098 total ==> SRR3691909.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 790.424 0 0 PNS24247 1044 898.239 67.5444 5.34586 PNS24249 1928 1782.24 187.378 7.47435 PNS24246 1044 898.239 67.5444 5.34586 PNS24248 1044 898.239 67.5444 5.34586 PNS24244 1471 1325.24 223.989 12.0158 PNS24243 293 149.648 0 0 KQK14069 1603 1457.24 38843.3 1894.99 KQK14071 474 329.674 2530.93 545.779 ==> SRR3691909.se.tsv <== BRADI_1g14170v3 45519 BRADI_1g53295v3 41 BRADI_1g59795v3 1515 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 175 BRADI_1g74790v3 228 BRADI_1g09890v3 0 BRADI_1g77505v3 338 BRADI_1g48960v3 0 SRR3691909 completed mapping pipeline successfully