Starting /dee2/code/volunteer_pipeline.sh SRR3691910 current disk space = 1523500187648 free memory = 1402003544 SRR3691910 SRAfilesize 92cb6a2daf70e24d936be72cb5e6d188 SRR3691910.sra SRR3691910.sra file validated SRR3691910 is paired end SRR3691910 is conventional basespace SRR3691910 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691910_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8835 33.0 33.0 34.0 32.0 34.0 2 32.949 34.0 33.0 34.0 32.0 34.0 3 32.97075 34.0 33.0 34.0 32.0 34.0 4 32.8845 34.0 33.0 34.0 32.0 34.0 5 32.942 34.0 33.0 34.0 32.0 34.0 6 36.96175 38.0 38.0 38.0 36.0 38.0 7 37.02175 38.0 38.0 38.0 36.0 38.0 8 37.03325 38.0 38.0 38.0 36.0 38.0 9 37.045 38.0 38.0 38.0 36.0 38.0 10-11 37.011624999999995 38.0 38.0 38.0 36.0 38.0 12-13 36.988375000000005 38.0 38.0 38.0 36.0 38.0 14-15 36.991 38.0 38.0 38.0 36.0 38.0 16-17 36.984375 38.0 38.0 38.0 36.0 38.0 18-19 36.982749999999996 38.0 38.0 38.0 36.0 38.0 20-21 37.039874999999995 38.0 38.0 38.0 36.5 38.0 22-23 37.049375 38.0 38.0 38.0 36.0 38.0 24-25 37.068875000000006 38.0 38.0 38.0 36.5 38.0 26-27 37.08625 38.0 38.0 38.0 36.0 38.0 28-29 37.06625 38.0 38.0 38.0 36.5 38.0 30-31 37.1475 38.0 38.0 38.0 37.0 38.0 32-33 37.1195 38.0 38.0 38.0 36.5 38.0 34-35 37.133375 38.0 38.0 38.0 37.0 38.0 36-37 37.138875 38.0 38.0 38.0 37.0 38.0 38-39 37.220124999999996 38.0 38.0 38.0 37.0 38.0 40-41 37.204499999999996 38.0 38.0 38.0 37.0 38.0 42-43 37.104749999999996 38.0 38.0 38.0 36.5 38.0 44-45 37.143874999999994 38.0 38.0 38.0 36.5 38.0 46-47 37.12575 38.0 38.0 38.0 36.5 38.0 48-49 37.065749999999994 38.0 38.0 38.0 36.0 38.0 50-51 37.079750000000004 38.0 38.0 38.0 36.0 38.0 52-53 37.09575 38.0 38.0 38.0 36.5 38.0 54-55 37.083124999999995 38.0 38.0 38.0 36.0 38.0 56-57 37.022999999999996 38.0 38.0 38.0 36.0 38.0 58-59 36.93125 38.0 38.0 38.0 35.5 38.0 60-61 37.041875000000005 38.0 38.0 38.0 36.0 38.0 62-63 37.02825 38.0 38.0 38.0 36.0 38.0 64-65 37.043375 38.0 38.0 38.0 36.0 38.0 66-67 37.054625 38.0 38.0 38.0 36.0 38.0 68-69 37.057249999999996 38.0 38.0 38.0 36.0 38.0 70-71 36.9955 38.0 38.0 38.0 36.0 38.0 72-73 37.04925 38.0 38.0 38.0 36.0 38.0 74-75 37.036 38.0 38.0 38.0 36.0 38.0 76-77 37.054874999999996 38.0 38.0 38.0 36.0 38.0 78-79 37.027875 38.0 38.0 38.0 36.0 38.0 80-81 36.995125 38.0 38.0 38.0 36.0 38.0 82-83 36.929625 38.0 38.0 38.0 35.5 38.0 84-85 36.870374999999996 38.0 38.0 38.0 35.5 38.0 86-87 36.841875 38.0 38.0 38.0 35.0 38.0 88-89 36.81075 38.0 38.0 38.0 35.0 38.0 90-91 36.802499999999995 38.0 38.0 38.0 35.0 38.0 92-93 36.803375 38.0 38.0 38.0 35.0 38.0 94-95 36.71125 38.0 38.0 38.0 35.0 38.0 96-97 36.7795 38.0 38.0 38.0 35.0 38.0 98-99 36.7295 38.0 38.0 38.0 35.0 38.0 100-101 36.6905 38.0 38.0 38.0 35.0 38.0 102-103 36.660875000000004 38.0 38.0 38.0 34.5 38.0 104-105 36.572 38.0 38.0 38.0 34.0 38.0 106-107 36.56175 38.0 38.0 38.0 34.5 38.0 108-109 36.566875 38.0 38.0 38.0 34.0 38.0 110-111 36.420500000000004 38.0 38.0 38.0 34.0 38.0 112-113 36.228875 38.0 38.0 38.0 34.0 38.0 114-115 36.1095 38.0 38.0 38.0 32.5 38.0 116-117 36.2175 38.0 38.0 38.0 33.0 38.0 118-119 36.062124999999995 38.0 38.0 38.0 32.0 38.0 120-121 36.025875 38.0 38.0 38.0 31.5 38.0 122-123 35.9495 38.0 38.0 38.0 31.0 38.0 124-125 35.945750000000004 38.0 38.0 38.0 32.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10-11 0.0 2309 12-13 0.0 2309 14-15 0.0 2309 16-17 0.0 2309 18-19 0.0 2309 20-21 0.0 2309 22-23 0.0 2309 24-25 0.0 2309 26-27 0.0 2309 28-29 0.0 2309 30-31 0.0 2309 32-33 0.0 2309 34-35 0.0 2309 36-37 0.0 2309 38-39 0.0 2309 40-41 0.0 2309 42-43 0.0 2309 44-45 0.0 2309 46-47 0.0 2309 48-49 0.0 2309 50-51 0.0 2309 52-53 0.0 2309 54-55 0.0 2309 56-57 0.0 2309 58-59 0.0 2309 60-61 0.0 2309 62-63 0.0 2309 64-65 0.0 2309 66-67 0.0 2309 68-69 0.0 2309 70-71 0.0 2309 72-73 0.0 2309 74-75 0.0 2309 76-77 0.0 2309 78-79 0.0 2309 80-81 0.0 2309 82-83 0.0 2309 84-85 0.0 2309 86-87 0.0 2309 88-89 0.0 2309 90-91 0.0 2309 92-93 0.0 2309 94-95 0.0 2309 96-97 0.0 2309 98-99 0.0 2309 100-101 0.0 2309 102-103 0.0 2309 104-105 0.0 2309 106-107 0.0 2309 108-109 0.0 2309 110-111 0.0 2309 112-113 0.0 2309 114-115 0.0 2309 116-117 0.0 2309 118-119 0.0 2309 120-121 0.0 2309 122-123 0.0 2309 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 4.0 20 1.0 21 5.0 22 5.0 23 6.0 24 15.0 25 14.0 26 23.0 27 26.0 28 19.0 29 25.0 30 36.0 31 34.0 32 53.0 33 78.0 34 98.0 35 183.0 36 343.0 37 3029.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.324999999999996 18.55 10.2 32.925 2 28.61430715357679 22.98649324662331 30.315157578789393 18.084042021010504 3 23.275000000000002 26.5 26.5 23.724999999999998 4 27.55 29.7 20.775 21.975 5 29.182295573893473 31.357839459864966 19.679919979995 19.779944986246562 6 22.705676419104776 35.033758439609905 20.655163790947736 21.605401350337583 7 22.886443221610804 18.33416708354177 35.392696348174084 23.386693346673336 8 22.386193096548272 22.661330665332667 25.162581290645324 29.789894947473737 9 24.85621405351338 21.580395098774694 28.40710177544386 25.156289072268066 10-11 27.188594297148573 27.263631815907953 20.985492746373186 24.562281140570285 12-13 26.40070035017509 22.39869934967484 24.862431215607803 26.338169084542272 14-15 25.6128064032016 24.92496248124062 25.362681340670335 24.099549774887443 16-17 26.95097548774387 23.84942471235618 24.412206103051524 24.787393696848426 18-19 25.52526263131566 25.100050025012504 24.77488744372186 24.599799899949975 20-21 25.80040020010005 24.524762381190595 25.250125062531264 24.424712356178087 22-23 25.765720715089387 25.14064258032254 24.753094136767096 24.34054256782098 24-25 24.815601950243778 24.82810351293912 25.678209776222026 24.678084760595073 26-27 25.296986369888707 24.759284731774414 25.372014505439537 24.571714392897338 28-29 26.43821910955478 24.449724862431214 24.92496248124062 24.187093546773387 30-31 26.563281640820406 24.912456228114056 25.025012506253123 23.499249624812407 32-33 26.20982868575716 25.32199574840565 24.096536201075402 24.371639364761783 34-35 25.918979744936234 25.10627656914228 25.10627656914228 23.868467116779193 36-37 25.7625 25.0375 25.087500000000002 24.1125 38-39 26.0625 25.874999999999996 24.65 23.4125 40-41 26.3125 25.2625 24.675 23.75 42-43 24.868717179294826 25.831457864466117 25.431357839459867 23.868467116779193 44-45 24.95 25.337500000000002 25.8625 23.849999999999998 46-47 26.04401100275069 25.11877969492373 25.431357839459867 23.40585146286572 48-49 25.212606303151574 23.999499749874936 26.275637818909452 24.512256128064035 50-51 26.588294147073537 24.72486243121561 25.71285642821411 22.973986993496748 52-53 26.650825412706354 23.84942471235618 25.42521260630315 24.074537268634316 54-55 25.475237618809405 25.6128064032016 25.350175087543768 23.56178089044522 56-57 26.425712856428213 25.175087543771884 25.312656328164078 23.08654327163582 58-59 25.737868934467233 24.937468734367183 25.387693846923458 23.936968484242122 60-61 25.212606303151574 24.349674837418707 25.912956478239117 24.524762381190595 62-63 25.60030015007504 24.824912456228116 25.812906453226613 23.761880940470235 64-65 25.250125062531264 25.60030015007504 25.137568784392194 24.012006003001503 66-67 26.147305239464803 25.89721145429536 25.184444166562457 22.77103913967738 68-69 25.85 25.412499999999998 25.924999999999997 22.8125 70-71 26.419104776194047 25.468867216804203 24.88122030507627 23.23080770192548 72-73 24.50612653163291 25.918979744936234 25.656414103525883 23.918479619904975 74-75 25.656414103525883 25.831457864466117 26.156539134783696 22.355588897224308 76-77 26.253281660207527 25.978247280910118 24.840605075634453 22.927865983247905 78-79 25.715714464308036 25.415676959619955 26.303287910988875 22.565320665083135 80-81 26.019004751187797 24.956239059764943 25.406351587896975 23.618404601150285 82-83 26.075537768884445 25.42521260630315 25.587793896948476 22.911455727863935 84-85 25.775387693846923 26.350675337668832 25.700350175087543 22.173586793396698 86-87 26.516572858036273 25.74108818011257 24.24015009380863 23.502188868042527 88-89 25.344008006004504 25.519139354515886 25.806855141356017 23.329997498123593 90-91 27.01688555347092 25.19074421513446 25.428392745465917 22.363977485928704 92-93 26.025512756378188 25.587793896948476 25.76288144072036 22.623811905952977 94-95 26.619964973730298 25.344008006004504 25.01876407305479 23.01726294721041 96-97 25.93843843843844 25.825825825825827 25.012512512512515 23.223223223223226 98-99 26.413913913913913 25.312812812812812 25.362862862862862 22.91041041041041 100-101 26.169627220415308 26.28221165874406 25.106329747310486 22.441831373530146 102-103 27.073689478293506 26.060302764919303 24.634054797948206 22.231952958838985 104-105 26.088044022011005 26.500750375187593 24.249624812406203 23.1615807903952 106-107 27.876438219109556 25.80040020010005 24.64982491245623 21.673336668334166 108-109 26.663331665832917 26.338169084542272 24.84992496248124 22.14857428714357 110-111 27.37618809404702 26.350675337668832 24.562281140570285 21.710855427713856 112-113 27.801400700350175 26.463231615807903 23.78689344672336 21.94847423711856 114-115 28.809106830122595 26.169627220415308 23.54265699274456 21.478608956717537 116-117 28.43382536902677 27.032774580935705 23.29246935201401 21.240930698023515 118-119 29.129129129129126 27.127127127127125 23.485985985985984 20.25775775775776 120-121 29.354354354354356 26.901901901901905 23.21071071071071 20.533033033033032 122-123 29.22557237582885 27.261353684473917 22.93256599524584 20.580507944451394 124-125 29.634726044533398 27.433074806104578 22.70452839629722 20.2276707530648 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 1.0 22 1.5 23 1.0 24 0.0 25 2.5 26 3.5 27 3.0 28 5.0 29 4.5 30 6.0 31 11.5 32 18.0 33 24.0 34 33.5 35 42.5 36 51.5 37 61.5 38 72.5 39 92.5 40 133.5 41 154.5 42 155.5 43 171.0 44 201.0 45 200.5 46 182.0 47 181.0 48 180.0 49 175.0 50 147.5 51 142.5 52 135.0 53 109.5 54 105.0 55 101.0 56 97.5 57 90.0 58 75.5 59 67.5 60 69.5 61 74.5 62 65.0 63 58.5 64 58.0 65 58.0 66 58.5 67 56.5 68 55.5 69 44.5 70 32.5 71 23.5 72 22.0 73 25.0 74 18.5 75 15.5 76 11.0 77 4.0 78 2.5 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.025 6 0.025 7 0.05 8 0.05 9 0.025 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.0125 24-25 0.0125 26-27 0.0375 28-29 0.05 30-31 0.05 32-33 0.0375 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.025 44-45 0.0 46-47 0.025 48-49 0.05 50-51 0.05 52-53 0.05 54-55 0.05 56-57 0.05 58-59 0.05 60-61 0.05 62-63 0.05 64-65 0.05 66-67 0.0375 68-69 0.0 70-71 0.025 72-73 0.025 74-75 0.025 76-77 0.0125 78-79 0.0125 80-81 0.025 82-83 0.05 84-85 0.05 86-87 0.0625 88-89 0.075 90-91 0.0625 92-93 0.05 94-95 0.075 96-97 0.1 98-99 0.1 100-101 0.075 102-103 0.08750000000000001 104-105 0.05 106-107 0.05 108-109 0.05 110-111 0.05 112-113 0.05 114-115 0.075 116-117 0.075 118-119 0.1 120-121 0.1 122-123 0.08750000000000001 124-125 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74924774322969 99.45 2 0.20060180541624875 0.4 3 0.05015045135406219 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.3625 0.0 0.0 0.0 0.0 74-75 0.48750000000000004 0.0 0.0 0.0 0.0 76-77 0.6 0.0 0.0 0.0 0.0 78-79 0.6625 0.0 0.0 0.0 0.0 80-81 0.75 0.0 0.0 0.0 0.0 82-83 0.8999999999999999 0.0 0.0 0.0 0.0 84-85 1.2375 0.0 0.0 0.0 0.0 86-87 1.6625 0.0 0.0 0.0 0.0 88-89 1.9625 0.0 0.0 0.0 0.0 90-91 2.2875 0.0 0.0 0.0 0.0 92-93 2.8125 0.0 0.0 0.0 0.0 94-95 3.3125 0.0 0.0 0.0 0.0 96-97 4.1625 0.0 0.0 0.0 0.0 98-99 5.0625 0.0 0.0 0.0 0.0 100-101 5.95 0.0 0.0 0.0 0.0 102-103 6.825 0.0 0.0 0.0 0.0 104-105 8.1375 0.0 0.0 0.0 0.0 106-107 9.4875 0.0 0.0 0.0 0.0 108-109 11.0 0.0 0.0 0.0 0.0 110-111 12.775 0.0 0.0 0.0 0.0 112-113 14.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3691910 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691910_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3595 34.0 33.0 34.0 32.0 34.0 2 33.069 34.0 33.0 34.0 32.0 34.0 3 33.13325 34.0 33.0 34.0 32.0 34.0 4 33.27725 34.0 33.0 34.0 32.0 34.0 5 33.20525 34.0 33.0 34.0 32.0 34.0 6 36.6615 38.0 37.0 38.0 34.0 38.0 7 37.07675 38.0 38.0 38.0 36.0 38.0 8 37.3245 38.0 38.0 38.0 37.0 38.0 9 37.39275 38.0 38.0 38.0 37.0 38.0 10-11 37.346125 38.0 38.0 38.0 37.0 38.0 12-13 37.329375 38.0 38.0 38.0 37.0 38.0 14-15 37.32725 38.0 38.0 38.0 37.0 38.0 16-17 37.375875 38.0 38.0 38.0 37.0 38.0 18-19 37.4495 38.0 38.0 38.0 37.0 38.0 20-21 37.400625 38.0 38.0 38.0 37.0 38.0 22-23 37.369875 38.0 38.0 38.0 37.0 38.0 24-25 37.387874999999994 38.0 38.0 38.0 37.0 38.0 26-27 37.371375 38.0 38.0 38.0 37.0 38.0 28-29 37.311 38.0 38.0 38.0 37.0 38.0 30-31 37.361125 38.0 38.0 38.0 37.0 38.0 32-33 37.322874999999996 38.0 38.0 38.0 37.0 38.0 34-35 37.415 38.0 38.0 38.0 37.0 38.0 36-37 37.33875 38.0 38.0 38.0 37.0 38.0 38-39 37.296 38.0 38.0 38.0 37.0 38.0 40-41 37.259375 38.0 38.0 38.0 37.0 38.0 42-43 37.210625 38.0 38.0 38.0 36.5 38.0 44-45 37.25625 38.0 38.0 38.0 36.5 38.0 46-47 37.2605 38.0 38.0 38.0 36.5 38.0 48-49 37.25275 38.0 38.0 38.0 37.0 38.0 50-51 37.255875 38.0 38.0 38.0 37.0 38.0 52-53 37.242875 38.0 38.0 38.0 36.0 38.0 54-55 37.1635 38.0 38.0 38.0 36.0 38.0 56-57 37.153875 38.0 38.0 38.0 36.0 38.0 58-59 37.181124999999994 38.0 38.0 38.0 36.5 38.0 60-61 37.119875 38.0 38.0 38.0 36.0 38.0 62-63 37.168375 38.0 38.0 38.0 36.0 38.0 64-65 37.191874999999996 38.0 38.0 38.0 36.0 38.0 66-67 37.094375 38.0 38.0 38.0 36.0 38.0 68-69 37.085499999999996 38.0 38.0 38.0 36.0 38.0 70-71 37.085125 38.0 38.0 38.0 36.0 38.0 72-73 37.057249999999996 38.0 38.0 38.0 36.0 38.0 74-75 37.1225 38.0 38.0 38.0 36.0 38.0 76-77 37.016999999999996 38.0 38.0 38.0 36.0 38.0 78-79 37.061375 38.0 38.0 38.0 36.0 38.0 80-81 36.986374999999995 38.0 38.0 38.0 36.0 38.0 82-83 36.868375 38.0 38.0 38.0 35.0 38.0 84-85 36.86825 38.0 38.0 38.0 35.0 38.0 86-87 36.909625 38.0 38.0 38.0 35.0 38.0 88-89 36.939 38.0 38.0 38.0 35.0 38.0 90-91 36.937375 38.0 38.0 38.0 35.0 38.0 92-93 36.76525 38.0 38.0 38.0 35.0 38.0 94-95 36.91625 38.0 38.0 38.0 35.0 38.0 96-97 36.748875 38.0 38.0 38.0 35.0 38.0 98-99 36.7825 38.0 38.0 38.0 35.0 38.0 100-101 36.837125 38.0 38.0 38.0 35.0 38.0 102-103 36.789375 38.0 38.0 38.0 35.0 38.0 104-105 36.716499999999996 38.0 38.0 38.0 34.5 38.0 106-107 36.676500000000004 38.0 38.0 38.0 34.5 38.0 108-109 36.65375 38.0 38.0 38.0 34.5 38.0 110-111 36.591375 38.0 38.0 38.0 34.0 38.0 112-113 36.568875000000006 38.0 38.0 38.0 34.0 38.0 114-115 36.671125 38.0 38.0 38.0 34.0 38.0 116-117 36.4385 38.0 38.0 38.0 34.0 38.0 118-119 36.329875 38.0 38.0 38.0 34.0 38.0 120-121 36.219625 38.0 37.5 38.0 33.5 38.0 122-123 36.24925 38.0 37.5 38.0 33.5 38.0 124-125 36.1695 38.0 38.0 38.0 32.5 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10-11 0.0 2309 12-13 0.0 2309 14-15 0.0 2309 16-17 0.0 2309 18-19 0.0 2309 20-21 0.0 2309 22-23 0.0 2309 24-25 0.0 2309 26-27 0.0 2309 28-29 0.0 2309 30-31 0.0 2309 32-33 0.0 2309 34-35 0.0 2309 36-37 0.0 2309 38-39 0.0 2309 40-41 0.0 2309 42-43 0.0 2309 44-45 0.0 2309 46-47 0.0 2309 48-49 0.0 2309 50-51 0.0 2309 52-53 0.0 2309 54-55 0.0 2309 56-57 0.0 2309 58-59 0.0 2309 60-61 0.0 2309 62-63 0.0 2309 64-65 0.0 2309 66-67 0.0 2309 68-69 0.0 2309 70-71 0.0 2309 72-73 0.0 2309 74-75 0.0 2309 76-77 0.0 2309 78-79 0.0 2309 80-81 0.0 2309 82-83 0.0 2309 84-85 0.0 2309 86-87 0.0 2309 88-89 0.0 2309 90-91 0.0 2309 92-93 0.0 2309 94-95 0.0 2309 96-97 0.0 2309 98-99 0.0 2309 100-101 0.0 2309 102-103 0.0 2309 104-105 0.0 2309 106-107 0.0 2309 108-109 0.0 2309 110-111 0.0 2309 112-113 0.0 2309 114-115 0.0 2309 116-117 0.0 2309 118-119 0.0 2309 120-121 0.0 2309 122-123 0.0 2309 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 2.0 24 6.0 25 8.0 26 11.0 27 10.0 28 19.0 29 28.0 30 44.0 31 45.0 32 56.0 33 73.0 34 103.0 35 163.0 36 368.0 37 3061.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.1438127090301 10.419346539747878 7.512220221250322 38.9246205299717 2 23.5 12.15 36.025 28.325 3 21.825 18.275 23.175 36.725 4 26.950000000000003 25.3 21.025 26.724999999999998 5 28.000000000000004 29.475 21.75 20.775 6 21.95 32.65 23.125 22.275 7 18.3 23.575 39.7 18.425 8 19.625 22.95 30.225 27.200000000000003 9 18.8 22.35 34.125 24.725 10-11 23.5375 30.7625 22.0 23.7 12-13 22.8625 25.0125 26.7625 25.362499999999997 14-15 22.3875 25.775 26.937499999999996 24.9 16-17 23.925 25.637500000000003 25.2375 25.2 18-19 22.725 25.3 26.2625 25.7125 20-21 23.3875 26.1125 26.087500000000002 24.4125 22-23 23.4875 26.075 24.8125 25.624999999999996 24-25 22.625 25.95 24.65 26.775 26-27 22.412499999999998 26.05 25.912499999999998 25.624999999999996 28-29 22.7125 26.8125 24.462500000000002 26.0125 30-31 22.927865983247905 26.503312914114264 25.51568946118265 25.053131641455185 32-33 23.3875 25.8125 25.5375 25.2625 34-35 22.8875 25.6125 25.7375 25.7625 36-37 22.3875 27.1125 24.337500000000002 26.1625 38-39 22.440305038129765 25.66570821352669 26.290786348293537 25.603200400050007 40-41 23.040380047505938 26.753344168021005 25.2281535191899 24.978122265283158 42-43 23.29041130141268 25.84073009126141 25.54069258657332 25.328166020752597 44-45 23.775 25.162499999999998 25.4375 25.624999999999996 46-47 23.8375 25.112499999999997 25.25 25.8 48-49 23.65 25.9875 24.087500000000002 26.275 50-51 22.6875 26.174999999999997 25.25 25.887500000000003 52-53 23.6875 25.75 24.5625 26.0 54-55 22.5875 25.687500000000004 26.3125 25.412499999999998 56-57 23.0125 26.150000000000002 24.9125 25.924999999999997 58-59 23.225 26.200000000000003 25.4375 25.137500000000003 60-61 22.6 26.474999999999998 24.762500000000003 26.1625 62-63 23.35 24.75 26.35 25.55 64-65 22.625 26.1 25.650000000000002 25.624999999999996 66-67 23.118279569892472 25.656414103525883 24.88122030507627 26.344086021505376 68-69 23.0432608152038 26.144036009002253 25.131282820705174 25.681420355088775 70-71 23.22790348793599 25.86573321665208 25.003125390673837 25.90323790473809 72-73 23.0125 25.825 25.0375 26.125 74-75 23.225 25.674999999999997 25.387500000000003 25.7125 76-77 23.5125 25.5125 26.275 24.7 78-79 23.9375 25.6125 25.275 25.174999999999997 80-81 22.875 25.7625 25.25 26.1125 82-83 24.3875 25.412499999999998 24.425 25.775 84-85 24.175 25.650000000000002 24.375 25.8 86-87 23.3625 25.25 25.4875 25.900000000000002 88-89 23.724999999999998 25.137500000000003 25.5125 25.624999999999996 90-91 23.962500000000002 25.95 24.6 25.4875 92-93 23.5875 26.125 24.887500000000003 25.4 94-95 24.025 26.200000000000003 24.65 25.124999999999996 96-97 23.2375 25.8625 24.825 26.075 98-99 24.125 25.0625 25.0125 25.8 100-101 23.9375 25.7625 24.2625 26.0375 102-103 24.837500000000002 26.150000000000002 23.1625 25.85 104-105 24.1875 26.224999999999998 24.525 25.0625 106-107 24.325 26.325 24.349999999999998 25.0 108-109 25.05 26.700000000000003 22.925 25.324999999999996 110-111 24.0375 27.287499999999998 23.7 24.975 112-113 24.625 27.037499999999998 23.05 25.2875 114-115 25.25 26.5 22.8 25.45 116-117 25.137500000000003 26.7625 22.6375 25.4625 118-119 24.25 27.900000000000002 22.8125 25.0375 120-121 24.6625 26.924999999999997 21.6625 26.75 122-123 24.8625 27.3125 21.775 26.05 124-125 24.8625 28.1 21.475 25.5625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.5 26 1.5 27 3.0 28 4.0 29 6.5 30 12.0 31 17.0 32 16.5 33 22.5 34 37.0 35 45.5 36 55.5 37 78.5 38 95.0 39 105.0 40 124.0 41 156.5 42 189.5 43 188.0 44 189.0 45 192.0 46 186.0 47 184.5 48 179.5 49 170.5 50 161.0 51 148.0 52 127.0 53 110.5 54 102.5 55 98.0 56 85.0 57 73.0 58 69.5 59 74.5 60 73.5 61 66.5 62 58.0 63 54.5 64 60.0 65 49.0 66 41.0 67 45.0 68 41.5 69 37.0 70 34.0 71 29.5 72 21.0 73 18.0 74 17.5 75 14.5 76 9.5 77 6.0 78 5.0 79 2.0 80 1.5 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0125 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0125 40-41 0.0125 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.025 68-69 0.025 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.3625 0.0 0.0 0.0 0.0 74-75 0.48750000000000004 0.0 0.0 0.0 0.0 76-77 0.6 0.0 0.0 0.0 0.0 78-79 0.6625 0.0 0.0 0.0 0.0 80-81 0.75 0.0 0.0 0.0 0.0125 82-83 0.925 0.0 0.0 0.0 0.025 84-85 1.2625 0.0 0.0 0.0 0.025 86-87 1.6625 0.0 0.0 0.0 0.025 88-89 1.9625 0.0 0.0 0.0 0.025 90-91 2.2625 0.0 0.0 0.0 0.025 92-93 2.8125 0.0 0.0 0.0 0.025 94-95 3.3875 0.0 0.0 0.0 0.025 96-97 4.3 0.0 0.0 0.0 0.025 98-99 5.1625 0.0 0.0 0.0 0.025 100-101 6.0 0.0 0.0 0.0 0.025 102-103 6.8375 0.0 0.0 0.0 0.025 104-105 8.125 0.0 0.0 0.0 0.025 106-107 9.5125 0.0 0.0 0.0 0.025 108-109 11.025 0.0 0.0 0.0 0.025 110-111 12.712499999999999 0.0 0.0 0.0 0.025 112-113 14.4375 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1474728 spots for SRR3691910.sra Written 1474728 spots for SRR3691910.sra Read 1474728 spots for SRR3691910.sra Written 1474728 spots for SRR3691910.sra Read 1474728 spots for SRR3691910.sra Written 1474728 spots for SRR3691910.sra Read 1474728 spots for SRR3691910.sra Written 1474728 spots for SRR3691910.sra Read 1474728 spots for SRR3691910.sra Written 1474728 spots for SRR3691910.sra Read 1474728 spots for SRR3691910.sra Written 1474728 spots for SRR3691910.sra Read 1474728 spots for SRR3691910.sra Written 1474728 spots for SRR3691910.sra Read 1474728 spots for SRR3691910.sra Written 1474728 spots for SRR3691910.sra Read 1474728 spots for SRR3691910.sra Written 1474728 spots for SRR3691910.sra Read 1474728 spots for SRR3691910.sra Written 1474728 spots for SRR3691910.sra Read 1474728 spots for SRR3691910.sra Written 1474728 spots for SRR3691910.sra Read 1474728 spots for SRR3691910.sra Written 1474728 spots for SRR3691910.sra Read 1474728 spots for SRR3691910.sra Written 1474728 spots for SRR3691910.sra Read 1474728 spots for SRR3691910.sra Written 1474728 spots for SRR3691910.sra Read 1474728 spots for SRR3691910.sra Written 1474728 spots for SRR3691910.sra Read 1474728 spots for SRR3691910.sra Written 1474728 spots for SRR3691910.sra Read 1474728 spots for SRR3691910.sra Written 1474728 spots for SRR3691910.sra Read 1474728 spots for SRR3691910.sra Written 1474728 spots for SRR3691910.sra Read 1474728 spots for SRR3691910.sra Written 1474728 spots for SRR3691910.sra Read 1474728 spots for SRR3691910.sra Written 1474728 spots for SRR3691910.sra SRR ids: ['SRR3691910.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_62z1hker SRR3691910.sra spots: 29494560 blocks: [[1, 1474728], [1474729, 2949456], [2949457, 4424184], [4424185, 5898912], [5898913, 7373640], [7373641, 8848368], [8848369, 10323096], [10323097, 11797824], [11797825, 13272552], [13272553, 14747280], [14747281, 16222008], [16222009, 17696736], [17696737, 19171464], [19171465, 20646192], [20646193, 22120920], [22120921, 23595648], [23595649, 25070376], [25070377, 26545104], [26545105, 28019832], [28019833, 29494560]] SRR3691910 file size 9392986 SRR3691910 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3691910 SRR3691910_1.fastq SRR3691910_2.fastq Input file: SRR3691910_1.fastq Paired file: SRR3691910_2.fastq trimmed: SRR3691910-trimmed-pair1.fastq, SRR3691910-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:06:31 2024 >> started Tue Dec 10 00:07:18 2024 >> done (46.362s) 29494560 read pairs processed; of these: 162 ( 0.00%) short read pairs filtered out after trimming by size control 3349 ( 0.01%) empty read pairs filtered out after trimming by size control 29491049 (99.99%) read pairs available; of these: 6266904 (21.25%) trimmed read pairs available after processing 23224145 (78.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 2 0.00% 24 5 0.00% 25 5 0.00% 26 5 0.00% 27 6 0.00% 28 8 0.00% 29 26 0.00% 30 27 0.00% 31 21 0.00% 32 29 0.00% 33 44 0.00% 34 34 0.00% 35 47 0.00% 36 53 0.00% 37 66 0.00% 38 91 0.00% 39 86 0.00% 40 121 0.00% 41 146 0.00% 42 161 0.00% 43 157 0.00% 44 179 0.00% 45 185 0.00% 46 214 0.00% 47 285 0.00% 48 325 0.00% 49 379 0.00% 50 465 0.00% 51 506 0.00% 52 563 0.00% 53 654 0.00% 54 690 0.00% 55 755 0.00% 56 770 0.00% 57 872 0.00% 58 989 0.00% 59 1256 0.00% 60 1424 0.00% 61 1518 0.01% 62 1746 0.01% 63 1992 0.01% 64 2314 0.01% 65 2421 0.01% 66 2643 0.01% 67 2967 0.01% 68 3135 0.01% 69 3662 0.01% 70 4180 0.01% 71 4772 0.02% 72 5533 0.02% 73 6265 0.02% 74 6879 0.02% 75 7887 0.03% 76 8522 0.03% 77 9428 0.03% 78 10483 0.04% 79 11677 0.04% 80 13152 0.04% 81 14872 0.05% 82 16744 0.06% 83 18640 0.06% 84 21241 0.07% 85 23870 0.08% 86 25844 0.09% 87 28280 0.10% 88 30596 0.10% 89 33444 0.11% 90 36408 0.12% 91 40192 0.14% 92 43960 0.15% 93 48593 0.16% 94 53242 0.18% 95 58252 0.20% 96 62251 0.21% 97 66823 0.23% 98 70626 0.24% 99 74371 0.25% 100 80276 0.27% 101 83907 0.28% 102 89133 0.30% 103 96834 0.33% 104 100457 0.34% 105 108888 0.37% 106 111999 0.38% 107 115852 0.39% 108 119875 0.41% 109 125223 0.42% 110 130169 0.44% 111 148255 0.50% 112 271004 0.92% 113 279383 0.95% 114 289238 0.98% 115 300344 1.02% 116 308562 1.05% 117 312202 1.06% 118 314114 1.07% 119 316115 1.07% 120 320016 1.09% 121 362730 1.23% 122 323321 1.10% 123 331340 1.12% 124 336580 1.14% 125 23224145 78.75% 29491049 reads passed initial QC criterion=sequence-density sequence-density=13.71 sequence-density-rank=1 fanout-score=34.37 fanout-score-rank=1 prefix-density=13.85 prefix-fanout=34.0 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA criterion=fanout-score sequence-density=13.71 sequence-density-rank=1 fanout-score=34.37 fanout-score-rank=1 prefix-density=13.85 prefix-fanout=34.0 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA criterion=sequence-density sequence-density=13.85 sequence-density-rank=1 fanout-score=44.99 fanout-score-rank=1 prefix-density=13.91 prefix-fanout=44.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=13.85 sequence-density-rank=1 fanout-score=44.99 fanout-score-rank=1 prefix-density=13.91 prefix-fanout=44.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTGAAAAA Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -y AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTGAAAAA -o SRR3691910 SRR3691910_1.fastq SRR3691910_2.fastq Input file: SRR3691910_1.fastq Paired file: SRR3691910_2.fastq trimmed: SRR3691910-trimmed-pair1.fastq, SRR3691910-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:09:37 2024 >> started Tue Dec 10 00:10:10 2024 >> done (33.387s) 25278042 read pairs processed; of these: 146 ( 0.00%) short read pairs filtered out after trimming by size control 2627 ( 0.01%) empty read pairs filtered out after trimming by size control 25275269 (99.99%) read pairs available; of these: 1840378 ( 7.28%) trimmed read pairs available after processing 23434891 (92.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 7 0.00% 21 2 0.00% 22 4 0.00% 23 10 0.00% 24 9 0.00% 25 6 0.00% 26 13 0.00% 27 20 0.00% 28 12 0.00% 29 37 0.00% 30 39 0.00% 31 31 0.00% 32 53 0.00% 33 67 0.00% 34 67 0.00% 35 74 0.00% 36 90 0.00% 37 158 0.00% 38 154 0.00% 39 163 0.00% 40 218 0.00% 41 245 0.00% 42 279 0.00% 43 279 0.00% 44 302 0.00% 45 329 0.00% 46 380 0.00% 47 465 0.00% 48 533 0.00% 49 647 0.00% 50 787 0.00% 51 911 0.00% 52 995 0.00% 53 1130 0.00% 54 1122 0.00% 55 1307 0.01% 56 1316 0.01% 57 1465 0.01% 58 1733 0.01% 59 2056 0.01% 60 2326 0.01% 61 2614 0.01% 62 2975 0.01% 63 3359 0.01% 64 3843 0.02% 65 4175 0.02% 66 4582 0.02% 67 5057 0.02% 68 5338 0.02% 69 6375 0.03% 70 7172 0.03% 71 8149 0.03% 72 9398 0.04% 73 10941 0.04% 74 11837 0.05% 75 13292 0.05% 76 14364 0.06% 77 16030 0.06% 78 17785 0.07% 79 20017 0.08% 80 22482 0.09% 81 25374 0.10% 82 28580 0.11% 83 32189 0.13% 84 36232 0.14% 85 40504 0.16% 86 44145 0.17% 87 48202 0.19% 88 52590 0.21% 89 56809 0.22% 90 62174 0.25% 91 68370 0.27% 92 75402 0.30% 93 82719 0.33% 94 90787 0.36% 95 99130 0.39% 96 106220 0.42% 97 114614 0.45% 98 120848 0.48% 99 126636 0.50% 100 136578 0.54% 101 143418 0.57% 102 152424 0.60% 103 165036 0.65% 104 171704 0.68% 105 184800 0.73% 106 191577 0.76% 107 198164 0.78% 108 205011 0.81% 109 213381 0.84% 110 219459 0.87% 111 223707 0.89% 112 232059 0.92% 113 239245 0.95% 114 247724 0.98% 115 257438 1.02% 116 264401 1.05% 117 267825 1.06% 118 269385 1.07% 119 270866 1.07% 120 274589 1.09% 121 308909 1.22% 122 277063 1.10% 123 283966 1.12% 124 288096 1.14% 125 18067285 71.48% criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=5.37 fanout-score-rank=21 prefix-density=0.12 prefix-fanout=4.1 sequence=AAGGAGCTGGAGGAGGTGAAGAAGGAGTACCCTGACGCCTATGTCCGCATCATCGGCTTCGACAACACCAGGCAAGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGGCAAGGCCTAAGCAAGTTGATTTCTTATAATACAAGAACGGGTCACACCGATTTTATGTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATCTCTCCCAACAACCCGGATTAACTGTATTCATGAGTACTACTATTATAAGAGTACTACAACTATCGTTGGGAGAGGGGCATGTAATATA criterion=fanout-score sequence-density=0.06 sequence-density-rank=15 fanout-score=233.43 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=26.2 sequence=AGCAGCAGCAGC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=5.33 fanout-score-rank=23 prefix-density=0.13 prefix-fanout=4.0 sequence=AAGGAGCTGGAGGAGGTGAAGAAGGAGTACCCTGACGCCTATGTCCGCATCATCGGCTTCGACAACACCAGGCAAGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGGCAAGGCCTAAGCAAGTTGATTTCTTATAATACAAGAACGGGTCACACCGATTTTATGTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATCTCTCCCAACAACCCGGATTAACTGTATTCATGAGTACTACTATTATAAGAGTACTACAACTATCGTTGGGAGAGGGGCATGTAATATA criterion=fanout-score sequence-density=0.06 sequence-density-rank=15 fanout-score=226.95 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=27.2 sequence=CTGCTGCTGCTG SRR3691910 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:11:10 Started mapping on | Dec 10 00:11:11 Finished on | Dec 10 00:12:59 Mapping speed, Million of reads per hour | 982.94 Number of input reads | 29488276 Average input read length | 241 UNIQUE READS: Uniquely mapped reads number | 27687957 Uniquely mapped reads % | 93.89% Average mapped length | 240.26 Number of splices: Total | 20213287 Number of splices: Annotated (sjdb) | 18977893 Number of splices: GT/AG | 19935024 Number of splices: GC/AG | 235720 Number of splices: AT/AC | 10600 Number of splices: Non-canonical | 31943 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.06 Insertion rate per base | 0.01% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 566155 % of reads mapped to multiple loci | 1.92% Number of reads mapped to too many loci | 90593 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.70% % of reads unmapped: other | 1.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1234347 1234347 1234347 N_multimapping 566155 566155 566155 N_noFeature 1243997 14277209 14118106 N_ambiguous 616211 41921 40707 UnstrandedReadsAssigned:25827749 PositiveStrandReadsAssigned:13368827 NegativeStrandReadsAssigned:13529144 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=117 echo kmer=113 SRR3691910 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3691910-trimmed-pair1.fastq SRR3691910-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,488,276 reads, 26,935,568 reads pseudoaligned [quant] estimated average fragment length: 151.015 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52973 SRR3691910.ke.tsv 35125 SRR3691910.se.tsv 88098 total ==> SRR3691910.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 786.156 0 0 PNS24247 1044 893.985 124.397 7.69552 PNS24249 1928 1777.98 272.458 8.47482 PNS24246 1044 893.985 124.397 7.69552 PNS24248 1044 893.985 124.397 7.69552 PNS24244 1471 1320.98 230.351 9.64389 PNS24243 293 145.919 14 5.30611 KQK14069 1603 1452.98 46023.3 1751.77 KQK14071 474 325.311 2796.38 475.397 ==> SRR3691910.se.tsv <== BRADI_1g14170v3 53731 BRADI_1g53295v3 38 BRADI_1g59795v3 1826 BRADI_1g07683v3 0 BRADI_1g00485v3 25 BRADI_1g20270v3 292 BRADI_1g74790v3 302 BRADI_1g09890v3 0 BRADI_1g77505v3 433 BRADI_1g48960v3 0 SRR3691910 completed mapping pipeline successfully