Starting /dee2/code/volunteer_pipeline.sh SRR3691915 current disk space = 1523492265984 free memory = 1601570924 SRR3691915 SRAfilesize 228d57c96afa452a53ba95fea1f7e9de SRR3691915.sra SRR3691915.sra file validated SRR3691915 is paired end SRR3691915 is conventional basespace SRR3691915 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691915_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8775 34.0 33.0 34.0 32.0 34.0 2 33.163 34.0 33.0 34.0 32.0 34.0 3 33.22725 34.0 33.0 34.0 32.0 34.0 4 33.272 34.0 33.0 34.0 33.0 34.0 5 33.3045 34.0 33.0 34.0 33.0 34.0 6 36.9965 38.0 37.0 38.0 36.0 38.0 7 37.35725 38.0 38.0 38.0 37.0 38.0 8 37.47675 38.0 38.0 38.0 37.0 38.0 9 37.4865 38.0 38.0 38.0 38.0 38.0 10-11 37.5065 38.0 38.0 38.0 38.0 38.0 12-13 37.47125 38.0 38.0 38.0 38.0 38.0 14-15 37.465125 38.0 38.0 38.0 38.0 38.0 16-17 37.532875000000004 38.0 38.0 38.0 38.0 38.0 18-19 37.465500000000006 38.0 38.0 38.0 38.0 38.0 20-21 37.490750000000006 38.0 38.0 38.0 38.0 38.0 22-23 37.52175 38.0 38.0 38.0 38.0 38.0 24-25 37.526125 38.0 38.0 38.0 38.0 38.0 26-27 37.501875 38.0 38.0 38.0 38.0 38.0 28-29 37.478125 38.0 38.0 38.0 37.5 38.0 30-31 37.500875 38.0 38.0 38.0 38.0 38.0 32-33 37.4755 38.0 38.0 38.0 38.0 38.0 34-35 37.399375 38.0 38.0 38.0 37.0 38.0 36-37 37.384125 38.0 38.0 38.0 37.0 38.0 38-39 37.351749999999996 38.0 38.0 38.0 37.0 38.0 40-41 37.37525 38.0 38.0 38.0 37.0 38.0 42-43 37.361625000000004 38.0 38.0 38.0 37.0 38.0 44-45 37.317750000000004 38.0 38.0 38.0 37.0 38.0 46-47 37.286 38.0 38.0 38.0 37.0 38.0 48-49 37.303125 38.0 38.0 38.0 37.0 38.0 50-51 37.265125 38.0 38.0 38.0 37.0 38.0 52-53 37.2705 38.0 38.0 38.0 37.0 38.0 54-55 37.24275 38.0 38.0 38.0 37.0 38.0 56-57 37.2595 38.0 38.0 38.0 37.0 38.0 58-59 37.271874999999994 38.0 38.0 38.0 36.5 38.0 60-61 37.244375000000005 38.0 38.0 38.0 36.5 38.0 62-63 37.206875 38.0 38.0 38.0 36.5 38.0 64-65 37.158500000000004 38.0 38.0 38.0 36.0 38.0 66-67 37.1715 38.0 38.0 38.0 36.5 38.0 68-69 37.177875 38.0 38.0 38.0 36.5 38.0 70-71 37.149875 38.0 38.0 38.0 36.0 38.0 72-73 37.166375 38.0 38.0 38.0 36.0 38.0 74-75 37.233125 38.0 38.0 38.0 36.5 38.0 76-77 37.13875 38.0 38.0 38.0 36.0 38.0 78-79 37.09675 38.0 38.0 38.0 36.0 38.0 80-81 37.077875 38.0 38.0 38.0 36.0 38.0 82-83 37.053375 38.0 38.0 38.0 36.0 38.0 84-85 37.044250000000005 38.0 38.0 38.0 36.0 38.0 86-87 37.060875 38.0 38.0 38.0 36.0 38.0 88-89 36.96575 38.0 38.0 38.0 35.5 38.0 90-91 36.798625 38.0 38.0 38.0 35.0 38.0 92-93 36.90575 38.0 38.0 38.0 35.5 38.0 94-95 36.779875000000004 38.0 38.0 38.0 35.0 38.0 96-97 36.821875 38.0 38.0 38.0 35.0 38.0 98-99 36.856750000000005 38.0 38.0 38.0 35.0 38.0 100-101 36.822500000000005 38.0 38.0 38.0 35.0 38.0 102-103 36.79275 38.0 38.0 38.0 35.0 38.0 104-105 36.800749999999994 38.0 38.0 38.0 35.0 38.0 106-107 36.73975 38.0 38.0 38.0 34.5 38.0 108-109 36.63975 38.0 38.0 38.0 35.0 38.0 110-111 36.693625 38.0 38.0 38.0 34.5 38.0 112-113 36.666124999999994 38.0 38.0 38.0 34.5 38.0 114-115 36.530125 38.0 38.0 38.0 34.0 38.0 116-117 36.317125000000004 38.0 38.0 38.0 34.0 38.0 118-119 36.417 38.0 38.0 38.0 34.0 38.0 120-121 36.44675 38.0 38.0 38.0 34.0 38.0 122-123 36.444625 38.0 38.0 38.0 34.0 38.0 124-125 36.34425 38.0 38.0 38.0 34.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 4.0 24 7.0 25 6.0 26 7.0 27 14.0 28 13.0 29 22.0 30 33.0 31 44.0 32 39.0 33 67.0 34 109.0 35 169.0 36 326.0 37 3138.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.36428209030949 10.705225773718924 7.128361237950279 39.80213089802131 2 24.525 14.399999999999999 34.5 26.575 3 21.525 19.05 25.275 34.150000000000006 4 27.125 24.55 22.15 26.174999999999997 5 25.224999999999998 31.55 22.8 20.424999999999997 6 21.775 32.324999999999996 25.074999999999996 20.825 7 18.075 22.825 39.2 19.900000000000002 8 18.6 24.224999999999998 29.875 27.3 9 19.525000000000002 22.05 33.025 25.4 10-11 23.2625 31.2125 22.7125 22.8125 12-13 22.075 24.675 26.987499999999997 26.2625 14-15 21.625 26.4125 26.674999999999997 25.2875 16-17 23.175 25.7 25.412499999999998 25.7125 18-19 22.475 25.837500000000002 26.3 25.387500000000003 20-21 23.0875 26.924999999999997 25.374999999999996 24.6125 22-23 23.0 26.437500000000004 26.825 23.7375 24-25 22.7 26.55 25.775 24.975 26-27 21.9625 25.837500000000002 26.474999999999998 25.724999999999998 28-29 23.674999999999997 25.912499999999998 25.0375 25.374999999999996 30-31 22.45 26.8 25.5 25.25 32-33 22.475 26.474999999999998 24.9 26.150000000000002 34-35 23.05 26.0 25.275 25.674999999999997 36-37 22.9375 26.724999999999998 25.087500000000002 25.25 38-39 22.725 26.1 25.7125 25.4625 40-41 23.3125 25.924999999999997 25.0125 25.75 42-43 22.8625 26.5875 25.2 25.35 44-45 22.662499999999998 27.0625 25.85 24.425 46-47 23.375 26.5875 24.962500000000002 25.074999999999996 48-49 22.9625 26.1 25.25 25.687500000000004 50-51 22.525000000000002 26.487500000000004 25.7125 25.275 52-53 23.150000000000002 27.1625 24.1875 25.5 54-55 22.8125 25.85 26.1125 25.224999999999998 56-57 22.725 26.237500000000004 25.874999999999996 25.162499999999998 58-59 23.325000000000003 26.224999999999998 25.474999999999998 24.975 60-61 22.912499999999998 26.8 24.8625 25.424999999999997 62-63 22.85 25.674999999999997 26.4625 25.0125 64-65 23.2875 26.0375 25.3125 25.362499999999997 66-67 22.6125 26.275 25.412499999999998 25.7 68-69 22.7125 26.0375 25.2125 26.0375 70-71 23.0125 27.037499999999998 25.5125 24.4375 72-73 23.025000000000002 25.775 25.337500000000002 25.8625 74-75 23.2875 25.9875 25.587500000000002 25.137500000000003 76-77 23.5125 26.8625 24.5125 25.112499999999997 78-79 23.7 26.35 24.825 25.124999999999996 80-81 23.150000000000002 25.7875 25.575 25.4875 82-83 23.5125 26.224999999999998 25.2125 25.05 84-85 23.974999999999998 26.025 25.0625 24.9375 86-87 23.674999999999997 25.55 25.324999999999996 25.45 88-89 23.849999999999998 26.075 24.9 25.174999999999997 90-91 22.9375 26.487500000000004 25.0 25.575 92-93 23.5375 26.424999999999997 24.675 25.362499999999997 94-95 23.400000000000002 26.2875 25.087500000000002 25.224999999999998 96-97 23.6875 25.887500000000003 24.8125 25.6125 98-99 24.8625 26.674999999999997 23.9375 24.525 100-101 23.375 26.487500000000004 24.9375 25.2 102-103 23.8625 27.1625 23.8625 25.112499999999997 104-105 24.675 26.75 23.599999999999998 24.975 106-107 24.1375 26.9125 24.2875 24.6625 108-109 24.837500000000002 26.6 23.7125 24.85 110-111 24.5625 27.3375 22.7125 25.387500000000003 112-113 25.0625 27.075 22.8 25.0625 114-115 24.1375 27.775 22.8875 25.2 116-117 25.4875 27.0125 22.575 24.925 118-119 24.474999999999998 28.1625 21.8125 25.55 120-121 24.025 28.3125 21.8 25.8625 122-123 24.0 28.075 21.3625 26.5625 124-125 24.5375 28.075 22.45 24.9375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 1.0 25 3.0 26 2.5 27 3.5 28 6.0 29 5.5 30 9.0 31 16.0 32 24.5 33 31.0 34 38.0 35 55.5 36 68.0 37 81.5 38 106.5 39 130.5 40 143.0 41 157.0 42 171.0 43 180.5 44 185.0 45 192.0 46 191.5 47 175.0 48 159.5 49 148.0 50 157.0 51 157.5 52 136.5 53 127.5 54 112.0 55 89.5 56 87.0 57 94.5 58 87.5 59 71.5 60 65.0 61 60.0 62 52.5 63 45.0 64 48.0 65 47.0 66 39.5 67 40.5 68 35.5 69 32.0 70 30.5 71 21.0 72 18.0 73 17.5 74 17.5 75 13.0 76 5.5 77 3.0 78 1.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29435483870968 98.5 2 0.6300403225806451 1.25 3 0.05040322580645161 0.15 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.21250000000000002 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.425 0.0 0.0 0.0 0.0 76-77 0.525 0.0 0.0 0.0 0.0 78-79 0.7250000000000001 0.0 0.0 0.0 0.0 80-81 0.8500000000000001 0.0 0.0 0.0 0.0 82-83 1.1625 0.0 0.0 0.0 0.0 84-85 1.4875 0.0 0.0 0.0 0.0 86-87 1.875 0.0 0.0 0.0 0.0 88-89 2.3375000000000004 0.0 0.0 0.0 0.0 90-91 2.95 0.0 0.0 0.0 0.0 92-93 3.6875 0.0 0.0 0.0 0.0 94-95 4.375 0.0 0.0 0.0 0.0 96-97 5.2875 0.0 0.0 0.0 0.0 98-99 6.3875 0.0 0.0 0.0 0.0 100-101 7.6125 0.0 0.0 0.0 0.0 102-103 8.925 0.0 0.0 0.0 0.0 104-105 10.6625 0.0 0.0 0.0 0.0 106-107 12.4375 0.0 0.0 0.0 0.0 108-109 14.35 0.0 0.0 0.0 0.0 110-111 16.6625 0.0 0.0 0.0 0.0 112-113 18.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTCTGA 40 0.005056411 29.746876 118-119 CACACGT 45 0.008989325 26.441668 114-115 CACGTCT 45 0.008989325 26.441668 116-117 >>END_MODULE SRR3691915 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691915_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83025 33.0 33.0 34.0 32.0 34.0 2 32.98375 34.0 33.0 34.0 32.0 34.0 3 33.05025 34.0 33.0 34.0 32.0 34.0 4 32.9285 34.0 33.0 34.0 32.0 34.0 5 32.98975 34.0 33.0 34.0 32.0 34.0 6 37.1485 38.0 38.0 38.0 37.0 38.0 7 37.16325 38.0 38.0 38.0 37.0 38.0 8 37.1595 38.0 38.0 38.0 37.0 38.0 9 37.20275 38.0 38.0 38.0 37.0 38.0 10-11 37.182249999999996 38.0 38.0 38.0 37.0 38.0 12-13 37.101375000000004 38.0 38.0 38.0 37.0 38.0 14-15 37.121625 38.0 38.0 38.0 37.0 38.0 16-17 37.057625 38.0 38.0 38.0 37.0 38.0 18-19 37.1145 38.0 38.0 38.0 37.0 38.0 20-21 37.141 38.0 38.0 38.0 37.0 38.0 22-23 37.134625 38.0 38.0 38.0 37.0 38.0 24-25 37.069625 38.0 38.0 38.0 37.0 38.0 26-27 37.076625 38.0 38.0 38.0 37.0 38.0 28-29 37.192499999999995 38.0 38.0 38.0 37.0 38.0 30-31 37.139375 38.0 38.0 38.0 37.0 38.0 32-33 37.140375 38.0 38.0 38.0 37.0 38.0 34-35 37.11475 38.0 38.0 38.0 37.0 38.0 36-37 37.052375 38.0 38.0 38.0 37.0 38.0 38-39 37.158 38.0 38.0 38.0 37.0 38.0 40-41 37.184 38.0 38.0 38.0 37.0 38.0 42-43 37.10675 38.0 38.0 38.0 37.0 38.0 44-45 37.136375 38.0 38.0 38.0 37.0 38.0 46-47 37.181124999999994 38.0 38.0 38.0 37.0 38.0 48-49 37.0985 38.0 38.0 38.0 37.0 38.0 50-51 37.120374999999996 38.0 38.0 38.0 37.0 38.0 52-53 37.0345 38.0 38.0 38.0 36.5 38.0 54-55 37.012875 38.0 38.0 38.0 36.5 38.0 56-57 37.027625 38.0 38.0 38.0 36.0 38.0 58-59 37.0065 38.0 38.0 38.0 36.0 38.0 60-61 37.037125 38.0 38.0 38.0 36.0 38.0 62-63 37.049625 38.0 38.0 38.0 37.0 38.0 64-65 36.957625 38.0 38.0 38.0 36.0 38.0 66-67 36.945499999999996 38.0 38.0 38.0 36.0 38.0 68-69 36.870999999999995 38.0 38.0 38.0 36.0 38.0 70-71 36.89 38.0 38.0 38.0 36.0 38.0 72-73 36.973875 38.0 38.0 38.0 36.0 38.0 74-75 36.91775 38.0 38.0 38.0 36.0 38.0 76-77 36.86325 38.0 38.0 38.0 36.0 38.0 78-79 36.895375 38.0 38.0 38.0 36.0 38.0 80-81 36.895125 38.0 38.0 38.0 36.0 38.0 82-83 36.840125 38.0 38.0 38.0 36.0 38.0 84-85 36.663375 38.0 38.0 38.0 34.5 38.0 86-87 36.754125 38.0 38.0 38.0 35.0 38.0 88-89 36.65225 38.0 38.0 38.0 35.0 38.0 90-91 36.67937499999999 38.0 38.0 38.0 35.0 38.0 92-93 36.612875 38.0 38.0 38.0 35.0 38.0 94-95 36.616625 38.0 38.0 38.0 35.0 38.0 96-97 36.610375 38.0 38.0 38.0 35.0 38.0 98-99 36.4815 38.0 38.0 38.0 34.0 38.0 100-101 36.463625 38.0 38.0 38.0 34.0 38.0 102-103 36.358125 38.0 38.0 38.0 34.0 38.0 104-105 36.469375 38.0 38.0 38.0 34.0 38.0 106-107 36.4445 38.0 38.0 38.0 34.0 38.0 108-109 36.22225 38.0 38.0 38.0 33.0 38.0 110-111 36.248374999999996 38.0 38.0 38.0 34.0 38.0 112-113 36.154375 38.0 38.0 38.0 33.0 38.0 114-115 36.081625 38.0 38.0 38.0 33.0 38.0 116-117 35.959375 38.0 38.0 38.0 32.0 38.0 118-119 35.491 38.0 37.5 38.0 31.0 38.0 120-121 35.351625 38.0 36.5 38.0 30.0 38.0 122-123 35.293375 38.0 36.5 38.0 30.0 38.0 124-125 35.122125 38.0 36.0 38.0 28.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 3.0 16 4.0 17 8.0 18 10.0 19 5.0 20 4.0 21 2.0 22 8.0 23 12.0 24 10.0 25 6.0 26 13.0 27 22.0 28 33.0 29 23.0 30 42.0 31 37.0 32 55.0 33 64.0 34 119.0 35 141.0 36 324.0 37 3054.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.30185836263184 19.563033651431443 10.12054244098443 31.014565544952283 2 28.96448224112056 22.0360180090045 30.490245122561284 18.509254627313656 3 22.686343171585793 25.78789394697349 27.988994497248626 23.536768384192097 4 26.038019009504755 31.49074537268634 21.085542771385693 21.38569284642321 5 28.414207103551774 30.86543271635818 20.485242621310658 20.23511755877939 6 22.625 34.35 20.65 22.375 7 22.025 18.9 37.65 21.425 8 23.474999999999998 21.7 26.8 28.025 9 23.575 21.8 27.775 26.85 10-11 25.797173940227587 27.885457046392396 22.858571964486682 23.458797048893334 12-13 26.100550275137568 22.961480740370185 24.974987493746873 25.962981490745374 14-15 24.874937468734366 24.824912456228116 25.775387693846923 24.524762381190595 16-17 26.513256628314156 24.912456228114056 24.77488744372186 23.799399699849925 18-19 25.162581290645324 26.000500250125064 25.03751875937969 23.799399699849925 20-21 26.440805100637583 25.040630078759847 25.603200400050007 22.91536442055257 22-23 26.325 24.7375 25.587500000000002 23.35 24-25 25.5 25.525 25.35 23.625 26-27 25.25 25.85 25.2125 23.6875 28-29 25.4625 25.2 25.587500000000002 23.75 30-31 26.081520380095025 25.343835958989747 25.93148287071768 22.643160790197552 32-33 25.7 25.874999999999996 24.625 23.799999999999997 34-35 26.187500000000004 24.95 24.45 24.4125 36-37 25.6125 25.424999999999997 25.337500000000002 23.625 38-39 26.387500000000003 25.1 25.2375 23.275000000000002 40-41 26.281570392598148 24.918729682420604 25.943985996499126 22.85571392848212 42-43 25.974999999999998 24.5 26.7625 22.7625 44-45 25.218804701175294 25.49387346836709 26.04401100275069 23.243310827706924 46-47 26.2125 24.9875 25.575 23.225 48-49 25.218804701175294 25.431357839459867 25.331332833208304 24.01850462615654 50-51 24.487243621810904 25.700350175087543 25.80040020010005 24.012006003001503 52-53 26.13480055020633 24.609228460672753 25.722145804676757 23.533825184444165 54-55 25.48774387193597 25.337668834417208 25.18759379689845 23.986993496748372 56-57 26.613306653326664 25.737868934467233 25.237618809404704 22.411205602801402 58-59 25.968992248062015 25.593898474618655 25.131282820705174 23.305826456614152 60-61 25.6064016004001 24.58114528632158 26.806701675418854 23.005751437859466 62-63 26.106526631657918 25.168792198049513 26.206551637909474 22.518129532383096 64-65 24.6125 26.2625 26.0625 23.0625 66-67 24.712500000000002 25.05 26.787499999999998 23.45 68-69 25.900000000000002 24.4875 25.924999999999997 23.6875 70-71 25.5375 26.087500000000002 25.650000000000002 22.725 72-73 25.587500000000002 25.112499999999997 26.275 23.025000000000002 74-75 25.4875 25.412499999999998 26.2125 22.8875 76-77 24.975 25.887500000000003 26.174999999999997 22.9625 78-79 25.05 25.5125 26.35 23.0875 80-81 25.324999999999996 25.662499999999998 26.325 22.6875 82-83 25.11877969492373 25.218804701175294 26.069017254313575 23.593398349587396 84-85 25.45022511255628 25.52526263131566 27.00100050025013 22.02351175587794 86-87 25.400200100050025 25.387693846923458 26.32566283141571 22.886443221610804 88-89 26.18809404702351 26.21310655327664 25.437718859429715 22.161080540270135 90-91 25.3751875937969 26.088044022011005 26.25062531265633 22.28614307153577 92-93 25.53776888444222 25.775387693846923 25.80040020010005 22.886443221610804 94-95 26.694173543385848 25.881470367591895 25.743935983995996 21.680420105026258 96-97 26.10381488430269 26.216385240775487 24.96560350218887 22.71419637273296 98-99 26.476476476476474 26.351351351351347 25.312812812812812 21.85935935935936 100-101 27.364864864864863 26.276276276276278 24.687187187187188 21.67167167167167 102-103 26.323032653571875 26.52320780683098 25.234580257725508 21.919179281871635 104-105 27.463731865932967 26.350675337668832 24.324662331165584 21.860930465232617 106-107 27.726363181590795 26.475737868934466 24.787393696848426 21.010505252626313 108-109 27.388694347173587 26.850925462731368 24.69984992496248 21.060530265132567 110-111 27.17948717948718 27.529706066291432 23.85240775484678 21.43839899937461 112-113 28.87165374030523 27.220415311483613 22.57943457593195 21.32849637227921 114-115 28.14610958218664 26.857643232424316 23.90542907180385 21.09081811358519 116-117 28.5767883941971 28.08904452226113 22.811405702851424 20.522761380690348 118-119 28.791514080060615 27.958075514585172 23.04583912110115 20.204571284253063 120-121 29.308604592480442 27.125914711077463 22.836235175372195 20.7292455210699 122-123 30.822609134494073 27.264698460762048 22.65960131213727 19.25309109260661 124-125 30.860459248044407 26.596013121372696 23.353520060560182 19.19000757002271 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.0 24 1.0 25 2.0 26 1.5 27 2.5 28 6.0 29 8.5 30 12.5 31 16.0 32 14.5 33 19.0 34 34.5 35 51.5 36 61.5 37 83.5 38 115.0 39 123.5 40 134.0 41 144.0 42 143.0 43 166.5 44 183.0 45 178.5 46 186.0 47 185.0 48 172.0 49 159.5 50 158.0 51 155.0 52 132.0 53 114.5 54 116.5 55 112.0 56 98.0 57 89.5 58 80.0 59 80.0 60 75.5 61 63.5 62 53.5 63 52.0 64 57.0 65 52.5 66 47.5 67 41.0 68 39.5 69 36.0 70 31.0 71 25.5 72 19.5 73 21.0 74 14.5 75 7.0 76 7.0 77 6.5 78 3.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.05 3 0.05 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0375 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.0125 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.025 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.025 42-43 0.0 44-45 0.025 46-47 0.0 48-49 0.025 50-51 0.05 52-53 0.0375 54-55 0.05 56-57 0.05 58-59 0.025 60-61 0.025 62-63 0.025 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.025 84-85 0.05 86-87 0.05 88-89 0.05 90-91 0.05 92-93 0.05 94-95 0.025 96-97 0.0625 98-99 0.1 100-101 0.1 102-103 0.08750000000000001 104-105 0.05 106-107 0.05 108-109 0.05 110-111 0.0625 112-113 0.075 114-115 0.075 116-117 0.05 118-119 1.0125 120-121 0.9249999999999999 122-123 0.9249999999999999 124-125 0.9249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.21250000000000002 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.425 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.025 0.0 0.0 78-79 0.7 0.0 0.025 0.0 0.0 80-81 0.825 0.0 0.025 0.0 0.0 82-83 1.15 0.0 0.025 0.0 0.0 84-85 1.4625 0.0 0.025 0.0 0.0 86-87 1.85 0.0 0.025 0.0 0.0 88-89 2.3125 0.0 0.025 0.0 0.0 90-91 2.9125 0.0 0.025 0.0 0.0 92-93 3.675 0.0 0.025 0.0 0.0 94-95 4.3875 0.0 0.025 0.0 0.0 96-97 5.2625 0.0 0.025 0.0 0.0 98-99 6.275 0.0 0.025 0.0 0.0 100-101 7.475 0.0 0.025 0.0 0.0 102-103 8.75 0.0 0.025 0.0 0.0 104-105 10.412500000000001 0.0 0.025 0.0 0.0 106-107 12.125 0.0 0.025 0.0 0.0 108-109 13.912500000000001 0.0 0.025 0.0 0.0 110-111 16.1625 0.0 0.025 0.0 0.0 112-113 18.3375 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTTTG 15 0.003748725 60.78846 114-115 TCGTGTA 40 0.004543842 30.394234 116-117 CGTCGTG 40 0.004543842 30.394234 114-115 GTGTAGG 45 0.008080486 27.017092 118-119 AGCGTCG 45 0.008080486 27.017092 112-113 >>END_MODULE Read 1230679 spots for SRR3691915.sra Written 1230679 spots for SRR3691915.sra Read 1230679 spots for SRR3691915.sra Written 1230679 spots for SRR3691915.sra Read 1230679 spots for SRR3691915.sra Written 1230679 spots for SRR3691915.sra Read 1230679 spots for SRR3691915.sra Written 1230679 spots for SRR3691915.sra Read 1230679 spots for SRR3691915.sra Written 1230679 spots for SRR3691915.sra Read 1230679 spots for SRR3691915.sra Written 1230679 spots for SRR3691915.sra Read 1230679 spots for SRR3691915.sra Written 1230679 spots for SRR3691915.sra Read 1230679 spots for SRR3691915.sra Written 1230679 spots for SRR3691915.sra Read 1230679 spots for SRR3691915.sra Written 1230679 spots for SRR3691915.sra Read 1230679 spots for SRR3691915.sra Written 1230679 spots for SRR3691915.sra Read 1230679 spots for SRR3691915.sra Written 1230679 spots for SRR3691915.sra Read 1230679 spots for SRR3691915.sra Written 1230679 spots for SRR3691915.sra Read 1230679 spots for SRR3691915.sra Written 1230679 spots for SRR3691915.sra Read 1230679 spots for SRR3691915.sra Written 1230679 spots for SRR3691915.sra Read 1230679 spots for SRR3691915.sra Written 1230679 spots for SRR3691915.sra Read 1230679 spots for SRR3691915.sra Written 1230679 spots for SRR3691915.sra Read 1230679 spots for SRR3691915.sra Written 1230679 spots for SRR3691915.sra Read 1230679 spots for SRR3691915.sra Written 1230679 spots for SRR3691915.sra Read 1230679 spots for SRR3691915.sra Written 1230679 spots for SRR3691915.sra Read 1230695 spots for SRR3691915.sra Written 1230695 spots for SRR3691915.sra SRR ids: ['SRR3691915.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8j023732 SRR3691915.sra spots: 24613596 blocks: [[1, 1230679], [1230680, 2461358], [2461359, 3692037], [3692038, 4922716], [4922717, 6153395], [6153396, 7384074], [7384075, 8614753], [8614754, 9845432], [9845433, 11076111], [11076112, 12306790], [12306791, 13537469], [13537470, 14768148], [14768149, 15998827], [15998828, 17229506], [17229507, 18460185], [18460186, 19690864], [19690865, 20921543], [20921544, 22152222], [22152223, 23382901], [23382902, 24613596]] SRR3691915 file size 7836780 SRR3691915 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3691915 SRR3691915_1.fastq SRR3691915_2.fastq Input file: SRR3691915_1.fastq Paired file: SRR3691915_2.fastq trimmed: SRR3691915-trimmed-pair1.fastq, SRR3691915-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:08:37 2024 >> started Tue Dec 10 00:09:02 2024 >> done (24.662s) 24613596 read pairs processed; of these: 244 ( 0.00%) short read pairs filtered out after trimming by size control 4906 ( 0.02%) empty read pairs filtered out after trimming by size control 24608446 (99.98%) read pairs available; of these: 8403140 (34.15%) trimmed read pairs available after processing 16205306 (65.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 6 0.00% 21 4 0.00% 22 5 0.00% 23 3 0.00% 24 6 0.00% 25 3 0.00% 26 11 0.00% 27 14 0.00% 28 17 0.00% 29 20 0.00% 30 40 0.00% 31 41 0.00% 32 47 0.00% 33 66 0.00% 34 69 0.00% 35 62 0.00% 36 95 0.00% 37 108 0.00% 38 138 0.00% 39 173 0.00% 40 203 0.00% 41 241 0.00% 42 262 0.00% 43 310 0.00% 44 299 0.00% 45 318 0.00% 46 445 0.00% 47 520 0.00% 48 663 0.00% 49 743 0.00% 50 924 0.00% 51 1029 0.00% 52 1126 0.00% 53 1134 0.00% 54 1278 0.01% 55 1399 0.01% 56 1514 0.01% 57 1776 0.01% 58 1994 0.01% 59 2430 0.01% 60 2721 0.01% 61 3226 0.01% 62 3607 0.01% 63 3935 0.02% 64 4462 0.02% 65 4749 0.02% 66 5295 0.02% 67 5866 0.02% 68 6589 0.03% 69 7473 0.03% 70 8524 0.03% 71 9775 0.04% 72 11323 0.05% 73 13089 0.05% 74 14693 0.06% 75 16342 0.07% 76 17766 0.07% 77 19388 0.08% 78 21060 0.09% 79 24042 0.10% 80 27073 0.11% 81 31089 0.13% 82 35282 0.14% 83 40122 0.16% 84 45027 0.18% 85 50053 0.20% 86 54225 0.22% 87 58766 0.24% 88 64373 0.26% 89 69476 0.28% 90 75591 0.31% 91 83532 0.34% 92 91909 0.37% 93 102763 0.42% 94 112765 0.46% 95 122373 0.50% 96 130011 0.53% 97 138818 0.56% 98 144883 0.59% 99 151953 0.62% 100 163438 0.66% 101 171612 0.70% 102 184048 0.75% 103 196443 0.80% 104 206790 0.84% 105 220601 0.90% 106 228059 0.93% 107 234387 0.95% 108 239994 0.98% 109 248392 1.01% 110 253646 1.03% 111 259473 1.05% 112 270608 1.10% 113 276471 1.12% 114 287326 1.17% 115 299243 1.22% 116 303807 1.23% 117 304313 1.24% 118 305112 1.24% 119 303972 1.24% 120 306395 1.25% 121 338905 1.38% 122 309306 1.26% 123 316701 1.29% 124 320548 1.30% 125 16205306 65.85% 24608446 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=33 prefix-density=0.21 prefix-fanout=2.0 sequence=GTATTTAGCCTTGGACGGAGTCTACCGCCCGATTTGGGCTGCATTCCCAAACAACCCGACTCGTTGACGGCGCCTCGTGGGGCGACAGGGTCCGGGCCGGACGGGGCTCTCACCCTCCCAGGCGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGTCGCTGAGGACGCCTCTCCAGACTACAATTCGGACGGCACGGCCGCCCGATTCTCAAGCTGGGCTGCTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTCTCCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=271.91 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=17.4 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=25 prefix-density=0.19 prefix-fanout=2.4 sequence=ACCTTGCCGACC criterion=fanout-score sequence-density=0.10 sequence-density-rank=14 fanout-score=151.41 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=23.8 sequence=CAAGAAGAAGATC SRR3691915 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:09:46 Started mapping on | Dec 10 00:09:46 Finished on | Dec 10 00:11:23 Mapping speed, Million of reads per hour | 913.30 Number of input reads | 24608446 Average input read length | 238 UNIQUE READS: Uniquely mapped reads number | 22591665 Uniquely mapped reads % | 91.80% Average mapped length | 237.94 Number of splices: Total | 15768464 Number of splices: Annotated (sjdb) | 14783950 Number of splices: GT/AG | 15542477 Number of splices: GC/AG | 190569 Number of splices: AT/AC | 8348 Number of splices: Non-canonical | 27070 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.06 Insertion rate per base | 0.01% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 673014 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 147984 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.73% % of reads unmapped: other | 2.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1344086 1344086 1344086 N_multimapping 673014 673014 673014 N_noFeature 1108855 21828888 1426017 N_ambiguous 508580 2445 63256 UnstrandedReadsAssigned:20974230 PositiveStrandReadsAssigned:760332 NegativeStrandReadsAssigned:21102392 Dataset is classified negative stranded MeadianReadLen=125 20thPercentileLength=113 echo kmer=109 SRR3691915 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3691915-trimmed-pair1.fastq SRR3691915-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,608,446 reads, 21,433,478 reads pseudoaligned [quant] estimated average fragment length: 142.865 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52973 SRR3691915.ke.tsv 35125 SRR3691915.se.tsv 88098 total ==> SRR3691915.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 794.286 0 0 PNS24247 1044 902.135 96.592 7.5142 PNS24249 1928 1786.13 159.369 6.26184 PNS24246 1044 902.135 96.592 7.5142 PNS24248 1044 902.135 96.592 7.5142 PNS24244 1471 1329.13 282.855 14.9351 PNS24243 293 153.035 0 0 KQK14069 1603 1461.13 33854 1626.05 KQK14071 474 333.219 2187.67 460.75 ==> SRR3691915.se.tsv <== BRADI_1g14170v3 40711 BRADI_1g53295v3 26 BRADI_1g59795v3 1673 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 225 BRADI_1g74790v3 188 BRADI_1g09890v3 0 BRADI_1g77505v3 352 BRADI_1g48960v3 0 SRR3691915 completed mapping pipeline successfully