Starting /dee2/code/volunteer_pipeline.sh SRR3691947 current disk space = 1523465646080 free memory = 1567150984 SRR3691947 SRAfilesize 695773905feb5e30881372c8889ab05d SRR3691947.sra SRR3691947.sra file validated SRR3691947 is paired end SRR3691947 is conventional basespace SRR3691947 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691947_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94075 33.0 33.0 34.0 32.0 34.0 2 33.034 34.0 33.0 34.0 32.0 34.0 3 32.99 34.0 33.0 34.0 32.0 34.0 4 32.946 34.0 33.0 34.0 32.0 34.0 5 33.01075 34.0 33.0 34.0 32.0 34.0 6 37.116 38.0 38.0 38.0 36.0 38.0 7 37.07025 38.0 38.0 38.0 37.0 38.0 8 37.0035 38.0 38.0 38.0 36.0 38.0 9 37.1065 38.0 38.0 38.0 37.0 38.0 10-11 37.106 38.0 38.0 38.0 36.5 38.0 12-13 37.071124999999995 38.0 38.0 38.0 36.5 38.0 14-15 37.00475 38.0 38.0 38.0 36.0 38.0 16-17 37.046375 38.0 38.0 38.0 36.5 38.0 18-19 37.019125 38.0 38.0 38.0 36.0 38.0 20-21 37.08025000000001 38.0 38.0 38.0 36.5 38.0 22-23 37.100125 38.0 38.0 38.0 36.5 38.0 24-25 37.083125 38.0 38.0 38.0 36.5 38.0 26-27 37.09 38.0 38.0 38.0 37.0 38.0 28-29 37.11775 38.0 38.0 38.0 37.0 38.0 30-31 37.111374999999995 38.0 38.0 38.0 37.0 38.0 32-33 37.184875000000005 38.0 38.0 38.0 37.0 38.0 34-35 37.1385 38.0 38.0 38.0 37.0 38.0 36-37 37.155125 38.0 38.0 38.0 37.0 38.0 38-39 37.151375 38.0 38.0 38.0 37.0 38.0 40-41 37.213375 38.0 38.0 38.0 37.0 38.0 42-43 37.21475 38.0 38.0 38.0 37.0 38.0 44-45 37.136625 38.0 38.0 38.0 37.0 38.0 46-47 37.140875 38.0 38.0 38.0 37.0 38.0 48-49 37.09525 38.0 38.0 38.0 36.5 38.0 50-51 37.035624999999996 38.0 38.0 38.0 36.5 38.0 52-53 37.084125 38.0 38.0 38.0 36.0 38.0 54-55 37.111374999999995 38.0 38.0 38.0 37.0 38.0 56-57 37.133375 38.0 38.0 38.0 36.5 38.0 58-59 37.018874999999994 38.0 38.0 38.0 36.0 38.0 60-61 37.051625 38.0 38.0 38.0 36.5 38.0 62-63 37.048625 38.0 38.0 38.0 36.5 38.0 64-65 37.061625 38.0 38.0 38.0 37.0 38.0 66-67 37.014125 38.0 38.0 38.0 36.0 38.0 68-69 36.9865 38.0 38.0 38.0 36.0 38.0 70-71 36.974374999999995 38.0 38.0 38.0 36.0 38.0 72-73 36.980625 38.0 38.0 38.0 36.5 38.0 74-75 36.985125 38.0 38.0 38.0 36.0 38.0 76-77 36.976625 38.0 38.0 38.0 36.0 38.0 78-79 36.930625 38.0 38.0 38.0 36.0 38.0 80-81 36.892125 38.0 38.0 38.0 36.0 38.0 82-83 36.8805 38.0 38.0 38.0 36.0 38.0 84-85 36.9285 38.0 38.0 38.0 36.0 38.0 86-87 36.844875 38.0 38.0 38.0 35.0 38.0 88-89 36.78075 38.0 38.0 38.0 35.5 38.0 90-91 36.814875 38.0 38.0 38.0 35.0 38.0 92-93 36.792 38.0 38.0 38.0 35.0 38.0 94-95 36.763125 38.0 38.0 38.0 35.0 38.0 96-97 36.821875 38.0 38.0 38.0 35.0 38.0 98-99 36.7855 38.0 38.0 38.0 35.0 38.0 100-101 36.686875 38.0 38.0 38.0 35.0 38.0 102-103 36.613125 38.0 38.0 38.0 34.5 38.0 104-105 36.486625000000004 38.0 38.0 38.0 34.0 38.0 106-107 36.430499999999995 38.0 38.0 38.0 34.0 38.0 108-109 36.568 38.0 38.0 38.0 34.0 38.0 110-111 36.5055 38.0 38.0 38.0 34.0 38.0 112-113 36.27875 38.0 38.0 38.0 33.5 38.0 114-115 36.229875 38.0 38.0 38.0 32.5 38.0 116-117 36.17225 38.0 38.0 38.0 32.5 38.0 118-119 36.0105 38.0 38.0 38.0 32.0 38.0 120-121 36.112375 38.0 38.0 38.0 32.5 38.0 122-123 35.974000000000004 38.0 38.0 38.0 31.5 38.0 124-125 35.850875 38.0 38.0 38.0 31.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10-11 0.0 2309 12-13 0.0 2309 14-15 0.0 2309 16-17 0.0 2309 18-19 0.0 2309 20-21 0.0 2309 22-23 0.0 2309 24-25 0.0 2309 26-27 0.0 2309 28-29 0.0 2309 30-31 0.0 2309 32-33 0.0 2309 34-35 0.0 2309 36-37 0.0 2309 38-39 0.0 2309 40-41 0.0 2309 42-43 0.0 2309 44-45 0.0 2309 46-47 0.0 2309 48-49 0.0 2309 50-51 0.0 2309 52-53 0.0 2309 54-55 0.0 2309 56-57 0.0 2309 58-59 0.0 2309 60-61 0.0 2309 62-63 0.0 2309 64-65 0.0 2309 66-67 0.0 2309 68-69 0.0 2309 70-71 0.0 2309 72-73 0.0 2309 74-75 0.0 2309 76-77 0.0 2309 78-79 0.0 2309 80-81 0.0 2309 82-83 0.0 2309 84-85 0.0 2309 86-87 0.0 2309 88-89 0.0 2309 90-91 0.0 2309 92-93 0.0 2309 94-95 0.0 2309 96-97 0.0 2309 98-99 0.0 2309 100-101 0.0 2309 102-103 0.0 2309 104-105 0.0 2309 106-107 0.0 2309 108-109 0.0 2309 110-111 0.0 2309 112-113 0.0 2309 114-115 0.0 2309 116-117 0.0 2309 118-119 0.0 2309 120-121 0.0 2309 122-123 0.0 2309 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 3.0 17 3.0 18 5.0 19 4.0 20 3.0 21 9.0 22 7.0 23 11.0 24 8.0 25 9.0 26 21.0 27 15.0 28 24.0 29 29.0 30 39.0 31 38.0 32 50.0 33 65.0 34 86.0 35 157.0 36 292.0 37 3120.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.484871217804454 19.179794948737182 11.727931982995749 29.607401850462615 2 29.839919959979987 23.186593296648326 27.5887943971986 19.384692346173086 3 23.15578894723681 26.456614153538382 26.18154538634659 24.20605151287822 4 28.057014253563388 31.857964491122782 18.704676169042262 21.380345086271568 5 28.507126781695426 31.682920730182545 18.829707426856714 20.980245061265315 6 24.006001500375092 35.08377094273568 19.954988747186796 20.955238809702426 7 23.386693346673336 18.8344172086043 33.941970985492745 23.836918459229615 8 24.862431215607803 22.861430715357677 24.58729364682341 27.688844422211105 9 23.21160580290145 22.36118059029515 28.264132066033014 26.163081540770385 10-11 26.375687843921963 28.12656328164082 21.72336168084042 23.774387193596798 12-13 26.23811905952976 22.811405702851424 25.775387693846923 25.175087543771884 14-15 26.063031515757878 25.22511255627814 25.550275137568786 23.1615807903952 16-17 25.662831415707853 24.424712356178087 25.812906453226613 24.099549774887443 18-19 26.425712856428213 23.84942471235618 25.912956478239117 23.81190595297649 20-21 25.7503751875938 25.437718859429715 24.58729364682341 24.224612306153077 22-23 26.597474052769787 24.771789421032885 24.284106539952482 24.346629986244842 24-25 25.081270317579396 25.731432858214554 25.63140785196299 23.55588897224306 26-27 26.32566283141571 25.57528764382191 25.07503751875938 23.024012006003 28-29 25.850425212606304 25.237618809404704 25.550275137568786 23.36168084042021 30-31 25.212606303151574 25.337668834417208 26.25062531265633 23.19909954977489 32-33 24.987493746873437 26.163081540770385 25.012506253126567 23.836918459229615 34-35 26.63165791447862 24.74368592148037 24.406101525381345 24.218554638659665 36-37 25.993998499624904 25.35633908477119 24.69367341835459 23.95598899724931 38-39 25.54069258657332 24.54056757094637 25.803225403175396 24.115514439304913 40-41 25.531382845711427 24.793698424606152 25.468867216804203 24.20605151287822 42-43 25.30632658164541 24.793698424606152 26.069017254313575 23.830957739434858 44-45 26.056514128532132 26.069017254313575 25.068767191797946 22.80570142535634 46-47 25.271976991371766 24.959359759909965 26.059772414655498 23.708890834062775 48-49 24.662331165582792 26.063031515757878 25.887943971985994 23.386693346673336 50-51 24.96248124062031 25.325162581290645 26.075537768884445 23.6368184092046 52-53 24.912456228114056 25.63781890945473 25.67533766883442 23.774387193596798 54-55 25.350175087543768 24.824912456228116 26.25062531265633 23.574287143571787 56-57 24.6248124062031 26.40070035017509 25.65032516258129 23.32416208104052 58-59 26.125562781390695 24.68734367183592 25.65032516258129 23.536768384192097 60-61 25.60030015007504 24.862431215607803 26.000500250125064 23.536768384192097 62-63 25.56278139069535 25.137568784392194 26.40070035017509 22.898949474737368 64-65 25.050025012506254 24.824912456228116 26.388194097048522 23.736868434217108 66-67 25.959734900587723 23.77141428035513 26.672502188320617 23.59634863073653 68-69 26.11902975743936 25.23130782695674 25.418854713678417 23.23080770192548 70-71 26.32237088908341 24.73427535325747 25.32199574840565 23.62135800925347 72-73 25.09377344336084 25.63140785196299 25.731432858214554 23.543385846461614 74-75 25.468867216804203 25.468867216804203 25.893973493373345 23.168292073018254 76-77 25.581395348837212 25.343835958989747 25.468867216804203 23.605901475368842 78-79 25.068767191797946 25.6064016004001 26.994248562140534 22.330582645661416 80-81 25.259472302113295 25.24696761285482 25.70964111541828 23.783918969613605 82-83 26.425712856428213 25.325162581290645 25.60030015007504 22.648824412206103 84-85 24.512256128064035 26.28814407203602 26.550775387693847 22.648824412206103 86-87 25.3751875937969 25.7503751875938 25.812906453226613 23.06153076538269 88-89 26.038019009504755 25.900450225112557 25.48774387193597 22.573786893446723 90-91 25.68784392196098 25.812906453226613 26.300650325162582 22.198599299649825 92-93 25.72536268134067 27.33866933466733 24.987493746873437 21.94847423711856 94-95 26.20060030015007 25.30015007503752 25.41270635317659 23.08654327163582 96-97 26.525762881440716 26.350675337668832 25.53776888444222 21.585792896448226 98-99 26.91345672836418 26.088044022011005 25.18759379689845 21.810905452726363 100-101 26.813406703351678 26.18809404702351 24.899949974987493 22.098549274637318 102-103 27.288644322161083 26.18809404702351 25.18759379689845 21.335667833916958 104-105 27.63881940970485 25.82541270635318 24.68734367183592 21.848424212106053 106-107 28.864432216108053 26.525762881440716 23.62431215607804 20.985492746373186 108-109 27.776388194097045 27.03851925962982 24.399699849924964 20.785392696348172 110-111 27.763881940970485 27.788894447223612 23.43671835917959 21.010505252626313 112-113 29.30215107553777 27.826413206603302 23.1615807903952 19.70985492746373 114-115 28.53926963481741 27.201100550275136 23.874437218609305 20.38519259629815 116-117 30.10255127563782 27.051025512756375 22.886443221610804 19.959979989995 118-119 30.010007505629222 27.570678008506377 22.404303227420566 20.01501125844383 120-121 30.452726363181593 27.52626313156578 22.798899449724864 19.222111055527762 122-123 30.84042021010505 27.576288144072038 22.836418209104554 18.74687343671836 124-125 31.665832916458232 28.251625812906454 21.72336168084042 18.3591795897949 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 1.0 20 1.0 21 0.0 22 1.0 23 1.5 24 1.0 25 1.5 26 3.5 27 5.5 28 5.0 29 6.0 30 7.0 31 12.0 32 19.0 33 24.5 34 29.0 35 40.0 36 64.5 37 81.5 38 89.5 39 102.0 40 122.5 41 151.0 42 173.5 43 180.0 44 188.0 45 192.5 46 173.0 47 162.0 48 183.5 49 178.0 50 149.5 51 139.0 52 124.5 53 118.5 54 122.5 55 111.5 56 95.0 57 80.5 58 87.0 59 86.5 60 70.5 61 69.5 62 69.0 63 64.5 64 59.5 65 50.0 66 40.5 67 39.5 68 37.0 69 39.0 70 42.5 71 30.0 72 19.5 73 14.5 74 11.5 75 11.5 76 5.5 77 1.5 78 2.5 79 3.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.05 3 0.025 4 0.025 5 0.025 6 0.025 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.0375 24-25 0.025 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.025 36-37 0.025 38-39 0.0125 40-41 0.025 42-43 0.025 44-45 0.025 46-47 0.0375 48-49 0.05 50-51 0.05 52-53 0.05 54-55 0.05 56-57 0.05 58-59 0.05 60-61 0.05 62-63 0.05 64-65 0.05 66-67 0.0375 68-69 0.025 70-71 0.0375 72-73 0.025 74-75 0.025 76-77 0.025 78-79 0.025 80-81 0.0375 82-83 0.05 84-85 0.05 86-87 0.05 88-89 0.05 90-91 0.05 92-93 0.05 94-95 0.05 96-97 0.05 98-99 0.05 100-101 0.05 102-103 0.05 104-105 0.05 106-107 0.05 108-109 0.05 110-111 0.05 112-113 0.05 114-115 0.05 116-117 0.05 118-119 0.075 120-121 0.05 122-123 0.05 124-125 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57286432160805 99.075 2 0.37688442211055273 0.75 3 0.02512562814070352 0.075 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.1375 0.0 0.0 0.0 0.0 60-61 0.16249999999999998 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.2625 0.0 0.0 0.0 0.0 66-67 0.30000000000000004 0.0 0.0 0.0 0.0 68-69 0.4 0.0 0.0 0.0 0.0 70-71 0.4375 0.0 0.0 0.0 0.0 72-73 0.48750000000000004 0.0 0.0 0.0 0.0 74-75 0.675 0.0 0.0 0.0 0.0 76-77 0.8875 0.0 0.0 0.0 0.0 78-79 1.1 0.0 0.0 0.0 0.0 80-81 1.3125 0.0 0.0 0.0 0.0 82-83 1.625 0.0 0.0 0.0 0.0 84-85 2.025 0.0 0.0 0.0 0.0 86-87 2.5625 0.0 0.0 0.0 0.0 88-89 3.1 0.0 0.0 0.0 0.0 90-91 3.75 0.0 0.0 0.0 0.0 92-93 4.5375 0.0 0.0 0.0 0.0 94-95 5.475 0.0 0.0 0.0 0.0 96-97 6.475 0.0 0.0 0.0 0.0 98-99 8.1 0.0 0.0 0.0 0.0 100-101 9.6375 0.0 0.0 0.0 0.0 102-103 11.2875 0.0 0.0 0.0 0.0 104-105 13.1125 0.0 0.0 0.0 0.0 106-107 15.350000000000001 0.0 0.0 0.0 0.0 108-109 17.525 0.0 0.0 0.0 0.0 110-111 19.7 0.0 0.0 0.0 0.0 112-113 22.262500000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3691947 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691947_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.55975 34.0 33.0 34.0 32.0 34.0 2 33.21125 34.0 33.0 34.0 32.0 34.0 3 33.266 34.0 33.0 34.0 32.0 34.0 4 33.3095 34.0 33.0 34.0 33.0 34.0 5 33.34175 34.0 33.0 34.0 33.0 34.0 6 36.8765 38.0 37.0 38.0 35.0 38.0 7 37.25075 38.0 38.0 38.0 36.0 38.0 8 37.4435 38.0 38.0 38.0 37.0 38.0 9 37.50225 38.0 38.0 38.0 38.0 38.0 10-11 37.435625 38.0 38.0 38.0 37.0 38.0 12-13 37.387249999999995 38.0 38.0 38.0 37.0 38.0 14-15 37.39075 38.0 38.0 38.0 37.5 38.0 16-17 37.470124999999996 38.0 38.0 38.0 37.5 38.0 18-19 37.524125 38.0 38.0 38.0 38.0 38.0 20-21 37.505625 38.0 38.0 38.0 37.5 38.0 22-23 37.5145 38.0 38.0 38.0 38.0 38.0 24-25 37.482749999999996 38.0 38.0 38.0 37.5 38.0 26-27 37.45825 38.0 38.0 38.0 37.5 38.0 28-29 37.435 38.0 38.0 38.0 37.5 38.0 30-31 37.452875000000006 38.0 38.0 38.0 37.5 38.0 32-33 37.410875000000004 38.0 38.0 38.0 37.0 38.0 34-35 37.46575 38.0 38.0 38.0 37.5 38.0 36-37 37.444874999999996 38.0 38.0 38.0 37.5 38.0 38-39 37.436 38.0 38.0 38.0 37.5 38.0 40-41 37.343999999999994 38.0 38.0 38.0 37.0 38.0 42-43 37.35825 38.0 38.0 38.0 37.0 38.0 44-45 37.36525 38.0 38.0 38.0 37.0 38.0 46-47 37.2725 38.0 38.0 38.0 37.0 38.0 48-49 37.373125 38.0 38.0 38.0 37.0 38.0 50-51 37.273624999999996 38.0 38.0 38.0 37.0 38.0 52-53 37.28337500000001 38.0 38.0 38.0 37.0 38.0 54-55 37.270624999999995 38.0 38.0 38.0 37.0 38.0 56-57 37.313625 38.0 38.0 38.0 37.0 38.0 58-59 37.37075 38.0 38.0 38.0 37.0 38.0 60-61 37.312875 38.0 38.0 38.0 37.0 38.0 62-63 37.318749999999994 38.0 38.0 38.0 37.0 38.0 64-65 37.207375 38.0 38.0 38.0 37.0 38.0 66-67 37.270875000000004 38.0 38.0 38.0 37.0 38.0 68-69 37.193749999999994 38.0 38.0 38.0 37.0 38.0 70-71 37.1965 38.0 38.0 38.0 36.5 38.0 72-73 37.192875 38.0 38.0 38.0 36.5 38.0 74-75 37.189875 38.0 38.0 38.0 37.0 38.0 76-77 37.126875 38.0 38.0 38.0 36.5 38.0 78-79 37.146375000000006 38.0 38.0 38.0 36.5 38.0 80-81 37.13975 38.0 38.0 38.0 36.0 38.0 82-83 37.0955 38.0 38.0 38.0 36.0 38.0 84-85 37.017250000000004 38.0 38.0 38.0 36.0 38.0 86-87 37.034125 38.0 38.0 38.0 36.0 38.0 88-89 37.027625 38.0 38.0 38.0 36.0 38.0 90-91 37.039375 38.0 38.0 38.0 36.0 38.0 92-93 37.009874999999994 38.0 38.0 38.0 36.0 38.0 94-95 37.03775 38.0 38.0 38.0 36.0 38.0 96-97 36.914375 38.0 38.0 38.0 35.0 38.0 98-99 36.881375 38.0 38.0 38.0 35.0 38.0 100-101 36.87825 38.0 38.0 38.0 35.0 38.0 102-103 36.940375 38.0 38.0 38.0 35.0 38.0 104-105 36.8795 38.0 38.0 38.0 35.0 38.0 106-107 36.8625 38.0 38.0 38.0 35.0 38.0 108-109 36.876374999999996 38.0 38.0 38.0 35.0 38.0 110-111 36.785875000000004 38.0 38.0 38.0 35.0 38.0 112-113 36.761125 38.0 38.0 38.0 35.0 38.0 114-115 36.74525 38.0 38.0 38.0 35.0 38.0 116-117 36.6715 38.0 38.0 38.0 34.5 38.0 118-119 36.534625000000005 38.0 38.0 38.0 34.0 38.0 120-121 36.411500000000004 38.0 38.0 38.0 34.0 38.0 122-123 36.558625000000006 38.0 38.0 38.0 34.0 38.0 124-125 36.522 38.0 38.0 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10-11 0.0 2309 12-13 0.0 2309 14-15 0.0 2309 16-17 0.0 2309 18-19 0.0 2309 20-21 0.0 2309 22-23 0.0 2309 24-25 0.0 2309 26-27 0.0 2309 28-29 0.0 2309 30-31 0.0 2309 32-33 0.0 2309 34-35 0.0 2309 36-37 0.0 2309 38-39 0.0 2309 40-41 0.0 2309 42-43 0.0 2309 44-45 0.0 2309 46-47 0.0 2309 48-49 0.0 2309 50-51 0.0 2309 52-53 0.0 2309 54-55 0.0 2309 56-57 0.0 2309 58-59 0.0 2309 60-61 0.0 2309 62-63 0.0 2309 64-65 0.0 2309 66-67 0.0 2309 68-69 0.0 2309 70-71 0.0 2309 72-73 0.0 2309 74-75 0.0 2309 76-77 0.0 2309 78-79 0.0 2309 80-81 0.0 2309 82-83 0.0 2309 84-85 0.0 2309 86-87 0.0 2309 88-89 0.0 2309 90-91 0.0 2309 92-93 0.0 2309 94-95 0.0 2309 96-97 0.0 2309 98-99 0.0 2309 100-101 0.0 2309 102-103 0.0 2309 104-105 0.0 2309 106-107 0.0 2309 108-109 0.0 2309 110-111 0.0 2309 112-113 0.0 2309 114-115 0.0 2309 116-117 0.0 2309 118-119 0.0 2309 120-121 0.0 2309 122-123 0.0 2309 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 2.0 23 5.0 24 8.0 25 6.0 26 6.0 27 12.0 28 19.0 29 26.0 30 26.0 31 26.0 32 46.0 33 80.0 34 84.0 35 129.0 36 311.0 37 3213.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.2971033068444 11.279159189951296 8.94642399384773 38.47731350935658 2 26.0 15.25 31.7 27.05 3 23.0 18.775 23.474999999999998 34.75 4 24.7 26.325 22.625 26.35 5 25.275 29.875 23.3 21.55 6 22.030507626906726 32.23305826456614 23.85596399099775 21.880470117529384 7 17.375 23.1 39.425 20.1 8 20.349999999999998 24.5 28.299999999999997 26.85 9 19.925 23.1 32.475 24.5 10-11 24.337500000000002 29.612500000000004 23.225 22.825 12-13 22.287499999999998 24.6875 27.3875 25.637500000000003 14-15 22.900000000000002 25.2875 26.637499999999996 25.174999999999997 16-17 22.4625 26.424999999999997 25.75 25.362499999999997 18-19 23.0375 26.8 24.675 25.4875 20-21 22.8625 26.525 26.137500000000003 24.474999999999998 22-23 22.575 26.674999999999997 25.9625 24.7875 24-25 22.85 25.35 25.9875 25.8125 26-27 22.5125 25.7375 26.25 25.5 28-29 22.35 26.3625 25.937500000000004 25.35 30-31 23.268317079269817 25.331332833208304 25.93148287071768 25.468867216804203 32-33 22.325 26.25 26.6 24.825 34-35 23.075000000000003 25.7 26.05 25.174999999999997 36-37 21.55 26.4625 25.0125 26.974999999999998 38-39 22.877859732466558 26.503312914114264 25.753219152394045 24.86560820102513 40-41 23.615451931491435 26.503312914114264 24.915614451806476 24.965620702587824 42-43 22.502812851606453 26.303287910988875 25.778222277784725 25.415676959619955 44-45 23.2125 26.224999999999998 25.275 25.2875 46-47 22.425 27.025 25.374999999999996 25.174999999999997 48-49 23.80297537192149 27.040880110013752 24.70308788598575 24.453056632079008 50-51 22.787499999999998 25.912499999999998 25.7875 25.5125 52-53 23.3625 26.9125 24.175 25.55 54-55 22.900000000000002 26.625 24.6 25.874999999999996 56-57 23.0375 26.2625 25.137500000000003 25.5625 58-59 23.150000000000002 26.0375 25.424999999999997 25.387500000000003 60-61 23.102887860982623 25.84073009126141 24.85310663832979 26.20327540942618 62-63 23.8625 25.662499999999998 24.675 25.8 64-65 23.325000000000003 25.8125 25.687500000000004 25.174999999999997 66-67 23.80595148787197 25.98149537384346 24.88122030507627 25.331332833208304 68-69 23.305826456614152 26.981745436359088 24.431107776944234 25.28132033008252 70-71 24.04050506313289 26.26578322290286 25.040630078759847 24.6530816352044 72-73 23.125 26.6625 25.525 24.6875 74-75 24.1125 25.7625 24.9 25.224999999999998 76-77 23.6875 26.700000000000003 24.5 25.112499999999997 78-79 23.3625 26.687499999999996 25.025 24.925 80-81 23.5125 25.887500000000003 24.45 26.150000000000002 82-83 23.6625 26.487500000000004 24.3875 25.4625 84-85 23.6125 25.8 25.074999999999996 25.5125 86-87 24.05 25.825 24.825 25.3 88-89 24.6875 24.825 24.9375 25.55 90-91 23.4625 26.3 24.224999999999998 26.0125 92-93 23.7625 26.0 25.4625 24.775 94-95 23.7625 26.9625 24.4875 24.7875 96-97 23.724999999999998 25.912499999999998 24.925 25.4375 98-99 24.0 26.237500000000004 24.9875 24.775 100-101 23.95 27.2625 23.4125 25.374999999999996 102-103 23.540442555319416 27.303412926615827 23.502937867233403 25.653206650831358 104-105 24.212500000000002 26.9125 24.712500000000002 24.1625 106-107 25.0375 28.1 23.325000000000003 23.5375 108-109 24.6875 27.375 22.875 25.0625 110-111 25.15 26.637499999999996 23.275000000000002 24.9375 112-113 24.825 27.400000000000002 22.625 25.15 114-115 24.775 28.000000000000004 22.162499999999998 25.0625 116-117 25.025 27.224999999999998 22.8375 24.9125 118-119 25.775 27.2625 21.462500000000002 25.5 120-121 24.3 28.000000000000004 21.475 26.224999999999998 122-123 23.6125 28.675 22.475 25.2375 124-125 24.587500000000002 27.737499999999997 21.45 26.224999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.5 24 2.5 25 1.0 26 2.0 27 4.5 28 7.0 29 7.5 30 10.0 31 14.0 32 22.5 33 29.5 34 27.5 35 38.0 36 65.0 37 83.5 38 97.5 39 128.0 40 145.0 41 156.0 42 180.0 43 200.0 44 195.5 45 177.5 46 172.0 47 172.0 48 172.5 49 168.5 50 160.0 51 137.5 52 120.5 53 123.0 54 117.0 55 108.0 56 93.5 57 75.5 58 75.0 59 71.5 60 62.5 61 67.5 62 63.5 63 44.5 64 44.0 65 53.5 66 52.0 67 45.5 68 42.0 69 36.5 70 30.0 71 24.0 72 20.0 73 16.5 74 10.0 75 7.0 76 5.5 77 3.5 78 3.0 79 2.5 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.025 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0125 40-41 0.0125 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0125 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0125 62-63 0.0 64-65 0.0 66-67 0.025 68-69 0.025 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0125 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36980085707083 98.55000000000001 2 0.4789513486261659 0.95 3 0.10083186286866651 0.3 4 0.050415931434333254 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.1375 0.0 0.0 0.0 0.0 60-61 0.16249999999999998 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.2625 0.0 0.0 0.0 0.0 66-67 0.30000000000000004 0.0 0.0 0.0 0.0 68-69 0.4 0.0 0.0 0.0 0.0 70-71 0.4375 0.0 0.0 0.0 0.0 72-73 0.48750000000000004 0.0 0.0 0.0 0.0 74-75 0.675 0.0 0.0 0.0 0.0 76-77 0.8999999999999999 0.0 0.0 0.0 0.0 78-79 1.1 0.0 0.0 0.0 0.0 80-81 1.3125 0.0 0.0 0.0 0.0 82-83 1.65 0.0 0.0 0.0 0.0 84-85 2.0375 0.0 0.0 0.0 0.0 86-87 2.575 0.0 0.0 0.0 0.0 88-89 3.0875000000000004 0.0 0.0 0.0 0.0 90-91 3.7 0.0 0.0 0.0 0.0 92-93 4.487500000000001 0.0 0.0 0.0 0.0 94-95 5.45 0.0 0.0 0.0 0.0 96-97 6.525 0.0 0.0 0.0 0.0 98-99 8.1875 0.0 0.0 0.0 0.0 100-101 9.7875 0.0 0.0 0.0 0.0 102-103 11.4625 0.0 0.0 0.0 0.0 104-105 13.274999999999999 0.0 0.0 0.0 0.0 106-107 15.5 0.0 0.0 0.0 0.0 108-109 17.674999999999997 0.0 0.0 0.0 0.0 110-111 19.737499999999997 0.0 0.0 0.0 0.0 112-113 22.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCTTC 15 2.5068579E-4 119.0 1 >>END_MODULE Read 1242992 spots for SRR3691947.sra Written 1242992 spots for SRR3691947.sra Read 1242992 spots for SRR3691947.sra Written 1242992 spots for SRR3691947.sra Read 1242992 spots for SRR3691947.sra Written 1242992 spots for SRR3691947.sra Read 1242992 spots for SRR3691947.sra Written 1242992 spots for SRR3691947.sra Read 1242992 spots for SRR3691947.sra Written 1242992 spots for SRR3691947.sra Read 1242992 spots for SRR3691947.sra Written 1242992 spots for SRR3691947.sra Read 1242992 spots for SRR3691947.sra Written 1242992 spots for SRR3691947.sra Read 1242992 spots for SRR3691947.sra Written 1242992 spots for SRR3691947.sra Read 1242992 spots for SRR3691947.sra Written 1242992 spots for SRR3691947.sra Read 1242992 spots for SRR3691947.sra Written 1242992 spots for SRR3691947.sra Read 1242992 spots for SRR3691947.sra Written 1242992 spots for SRR3691947.sra Read 1243006 spots for SRR3691947.sra Written 1243006 spots for SRR3691947.sra Read 1242992 spots for SRR3691947.sra Written 1242992 spots for SRR3691947.sra Read 1242992 spots for SRR3691947.sra Written 1242992 spots for SRR3691947.sra Read 1242992 spots for SRR3691947.sra Written 1242992 spots for SRR3691947.sra Read 1242992 spots for SRR3691947.sra Written 1242992 spots for SRR3691947.sra Read 1242992 spots for SRR3691947.sra Written 1242992 spots for SRR3691947.sra Read 1242992 spots for SRR3691947.sra Written 1242992 spots for SRR3691947.sra Read 1242992 spots for SRR3691947.sra Written 1242992 spots for SRR3691947.sra Read 1242992 spots for SRR3691947.sra Written 1242992 spots for SRR3691947.sra SRR ids: ['SRR3691947.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d90ae_oj SRR3691947.sra spots: 24859854 blocks: [[1, 1242992], [1242993, 2485984], [2485985, 3728976], [3728977, 4971968], [4971969, 6214960], [6214961, 7457952], [7457953, 8700944], [8700945, 9943936], [9943937, 11186928], [11186929, 12429920], [12429921, 13672912], [13672913, 14915904], [14915905, 16158896], [16158897, 17401888], [17401889, 18644880], [18644881, 19887872], [19887873, 21130864], [21130865, 22373856], [22373857, 23616848], [23616849, 24859854]] SRR3691947 file size 7915295 SRR3691947 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3691947 SRR3691947_1.fastq SRR3691947_2.fastq Input file: SRR3691947_1.fastq Paired file: SRR3691947_2.fastq trimmed: SRR3691947-trimmed-pair1.fastq, SRR3691947-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:10:50 2024 >> started Tue Dec 10 00:11:15 2024 >> done (25.159s) 24859854 read pairs processed; of these: 130 ( 0.00%) short read pairs filtered out after trimming by size control 6793 ( 0.03%) empty read pairs filtered out after trimming by size control 24852931 (99.97%) read pairs available; of these: 7175681 (28.87%) trimmed read pairs available after processing 17677250 (71.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 1 0.00% 21 2 0.00% 22 5 0.00% 23 9 0.00% 24 2 0.00% 25 3 0.00% 26 10 0.00% 27 12 0.00% 28 13 0.00% 29 22 0.00% 30 20 0.00% 31 26 0.00% 32 29 0.00% 33 38 0.00% 34 45 0.00% 35 53 0.00% 36 59 0.00% 37 75 0.00% 38 100 0.00% 39 111 0.00% 40 167 0.00% 41 171 0.00% 42 197 0.00% 43 217 0.00% 44 211 0.00% 45 273 0.00% 46 271 0.00% 47 331 0.00% 48 408 0.00% 49 530 0.00% 50 616 0.00% 51 683 0.00% 52 764 0.00% 53 730 0.00% 54 848 0.00% 55 932 0.00% 56 984 0.00% 57 1160 0.00% 58 1364 0.01% 59 1508 0.01% 60 1763 0.01% 61 2131 0.01% 62 2425 0.01% 63 2757 0.01% 64 3007 0.01% 65 3154 0.01% 66 3450 0.01% 67 3821 0.02% 68 4243 0.02% 69 4999 0.02% 70 5736 0.02% 71 6623 0.03% 72 7938 0.03% 73 8958 0.04% 74 9731 0.04% 75 10811 0.04% 76 11559 0.05% 77 12475 0.05% 78 13460 0.05% 79 15458 0.06% 80 17376 0.07% 81 19981 0.08% 82 23195 0.09% 83 26493 0.11% 84 28947 0.12% 85 32110 0.13% 86 34610 0.14% 87 37336 0.15% 88 39665 0.16% 89 42927 0.17% 90 46567 0.19% 91 52524 0.21% 92 58265 0.23% 93 64949 0.26% 94 71509 0.29% 95 76815 0.31% 96 80888 0.33% 97 83949 0.34% 98 87200 0.35% 99 91477 0.37% 100 97596 0.39% 101 102937 0.41% 102 111164 0.45% 103 120099 0.48% 104 126923 0.51% 105 133409 0.54% 106 136400 0.55% 107 137577 0.55% 108 138664 0.56% 109 142147 0.57% 110 147020 0.59% 111 167296 0.67% 112 311614 1.25% 113 324364 1.31% 114 337008 1.36% 115 347362 1.40% 116 349490 1.41% 117 345927 1.39% 118 341187 1.37% 119 335971 1.35% 120 336786 1.36% 121 366883 1.48% 122 341146 1.37% 123 351420 1.41% 124 361005 1.45% 125 17677250 71.13% 24852931 reads passed initial QC criterion=sequence-density sequence-density=20.21 sequence-density-rank=1 fanout-score=36.79 fanout-score-rank=1 prefix-density=20.39 prefix-fanout=36.5 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAA criterion=fanout-score sequence-density=20.21 sequence-density-rank=1 fanout-score=36.79 fanout-score-rank=1 prefix-density=20.39 prefix-fanout=36.5 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAA criterion=sequence-density sequence-density=20.42 sequence-density-rank=1 fanout-score=46.91 fanout-score-rank=1 prefix-density=20.50 prefix-fanout=46.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=20.42 sequence-density-rank=1 fanout-score=46.91 fanout-score-rank=1 prefix-density=20.50 prefix-fanout=46.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAA -y AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3691947 SRR3691947_1.fastq SRR3691947_2.fastq Input file: SRR3691947_1.fastq Paired file: SRR3691947_2.fastq trimmed: SRR3691947-trimmed-pair1.fastq, SRR3691947-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:12:56 2024 >> started Tue Dec 10 00:13:22 2024 >> done (25.998s) 22485985 read pairs processed; of these: 111 ( 0.00%) short read pairs filtered out after trimming by size control 7052 ( 0.03%) empty read pairs filtered out after trimming by size control 22478822 (99.97%) read pairs available; of these: 2420846 (10.77%) trimmed read pairs available after processing 20057976 (89.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 3 0.00% 21 1 0.00% 22 6 0.00% 23 8 0.00% 24 5 0.00% 25 6 0.00% 26 18 0.00% 27 18 0.00% 28 22 0.00% 29 39 0.00% 30 42 0.00% 31 48 0.00% 32 64 0.00% 33 58 0.00% 34 85 0.00% 35 102 0.00% 36 115 0.00% 37 187 0.00% 38 174 0.00% 39 206 0.00% 40 282 0.00% 41 320 0.00% 42 352 0.00% 43 346 0.00% 44 367 0.00% 45 446 0.00% 46 531 0.00% 47 615 0.00% 48 764 0.00% 49 893 0.00% 50 1124 0.01% 51 1243 0.01% 52 1385 0.01% 53 1344 0.01% 54 1464 0.01% 55 1643 0.01% 56 1755 0.01% 57 2081 0.01% 58 2364 0.01% 59 2785 0.01% 60 3294 0.01% 61 3921 0.02% 62 4478 0.02% 63 4984 0.02% 64 5427 0.02% 65 5733 0.03% 66 6315 0.03% 67 6933 0.03% 68 7704 0.03% 69 8987 0.04% 70 10367 0.05% 71 12031 0.05% 72 14255 0.06% 73 16094 0.07% 74 17685 0.08% 75 19576 0.09% 76 21000 0.09% 77 22424 0.10% 78 24524 0.11% 79 28025 0.12% 80 31507 0.14% 81 36367 0.16% 82 41693 0.19% 83 47561 0.21% 84 52742 0.23% 85 58062 0.26% 86 62633 0.28% 87 67034 0.30% 88 71944 0.32% 89 77360 0.34% 90 84247 0.37% 91 94794 0.42% 92 105445 0.47% 93 117397 0.52% 94 129222 0.57% 95 139032 0.62% 96 145872 0.65% 97 151776 0.68% 98 157688 0.70% 99 164155 0.73% 100 175821 0.78% 101 186198 0.83% 102 200856 0.89% 103 216946 0.97% 104 228772 1.02% 105 239083 1.06% 106 246142 1.09% 107 248652 1.11% 108 250533 1.11% 109 257889 1.15% 110 262711 1.17% 111 268957 1.20% 112 281857 1.25% 113 293309 1.30% 114 304941 1.36% 115 314459 1.40% 116 316063 1.41% 117 313041 1.39% 118 308481 1.37% 119 303804 1.35% 120 304917 1.36% 121 329465 1.47% 122 308418 1.37% 123 317931 1.41% 124 326152 1.45% 125 13569815 60.37% criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=35 prefix-density=0.10 prefix-fanout=2.0 sequence=GTATTTAGCCTTGGACGGAGTCTACCGCCCGATTTGGGCTGCATTCCCAAACAACCCGACTCGTTGACGGCGCCTCGTGGGGCGACAGGGTCCGGGCCGGACGGGGCTCTCACCCTCCCAGGCGCCCCTTTCCAGGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=16 fanout-score=142.28 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=18.9 sequence=CCGCCGCCGCCA criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=37 prefix-density=0.10 prefix-fanout=2.0 sequence=GTATTTAGCCTTGGACGGAGTCTACCGCCCGATTTGGGCTGCATTCCCAAACAACCCGACTCGTTGACGGCGCCTCGTGGGGCGACAGGGTCCGGGCCGGACGGGGCTCTCACCCTCCCAGGCGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGTCGCTGAGGACGCCTCTCCAGACTACAATTCGGACGGCACGGCCGCCCGATTCTCAAGCTGGGCTGCTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTCTCCTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=15 fanout-score=154.07 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=19.3 sequence=CCGCCGCCGCCA SRR3691947 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:14:13 Started mapping on | Dec 10 00:14:14 Finished on | Dec 10 00:15:49 Mapping speed, Million of reads per hour | 941.52 Number of input reads | 24845768 Average input read length | 236 UNIQUE READS: Uniquely mapped reads number | 22790989 Uniquely mapped reads % | 91.73% Average mapped length | 235.86 Number of splices: Total | 15662503 Number of splices: Annotated (sjdb) | 14662938 Number of splices: GT/AG | 15433169 Number of splices: GC/AG | 193173 Number of splices: AT/AC | 7833 Number of splices: Non-canonical | 28328 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.04 Insertion rate per base | 0.01% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 650654 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 133748 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.20% % of reads unmapped: other | 1.91% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1404281 1404281 1404281 N_multimapping 650654 650654 650654 N_noFeature 1074538 11764391 11634714 N_ambiguous 529381 33250 32353 UnstrandedReadsAssigned:21187070 PositiveStrandReadsAssigned:10993348 NegativeStrandReadsAssigned:11123922 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=110 echo kmer=105 SRR3691947 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3691947-trimmed-pair1.fastq SRR3691947-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,845,768 reads, 22,231,723 reads pseudoaligned [quant] estimated average fragment length: 137.048 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52973 SRR3691947.ke.tsv 35125 SRR3691947.se.tsv 88098 total ==> SRR3691947.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 800.075 0 0 PNS24247 1044 907.952 81.7611 6.02316 PNS24249 1928 1791.95 248.292 9.26782 PNS24246 1044 907.952 81.7611 6.02316 PNS24248 1044 907.952 81.7611 6.02316 PNS24244 1471 1334.95 176.424 8.8396 PNS24243 293 158.729 7 2.94973 KQK14069 1603 1466.95 46381 2114.78 KQK14071 474 339.154 3042.62 600.056 ==> SRR3691947.se.tsv <== BRADI_1g14170v3 54878 BRADI_1g53295v3 38 BRADI_1g59795v3 1954 BRADI_1g07683v3 1 BRADI_1g00485v3 21 BRADI_1g20270v3 225 BRADI_1g74790v3 227 BRADI_1g09890v3 0 BRADI_1g77505v3 389 BRADI_1g48960v3 0 SRR3691947 completed mapping pipeline successfully