Starting /dee2/code/volunteer_pipeline.sh SRR3691968 current disk space = 1515215319040 free memory = 1607611492 SRR3691968 SRAfilesize 198bc47c6d4ca71cc8ee5020139759a0 SRR3691968.sra SRR3691968.sra file validated SRR3691968 is paired end SRR3691968 is conventional basespace SRR3691968 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691968_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.972 33.0 33.0 34.0 32.0 34.0 2 33.00775 34.0 33.0 34.0 32.0 34.0 3 33.01575 34.0 33.0 34.0 32.0 34.0 4 32.9975 34.0 33.0 34.0 32.0 34.0 5 32.981 34.0 33.0 34.0 32.0 34.0 6 37.11375 38.0 38.0 38.0 37.0 38.0 7 37.146 38.0 38.0 38.0 37.0 38.0 8 37.212 38.0 38.0 38.0 37.0 38.0 9 37.1425 38.0 38.0 38.0 37.0 38.0 10-11 37.11475 38.0 38.0 38.0 37.0 38.0 12-13 37.112750000000005 38.0 38.0 38.0 37.0 38.0 14-15 36.946875 38.0 38.0 38.0 36.0 38.0 16-17 37.05675 38.0 38.0 38.0 36.5 38.0 18-19 37.062 38.0 38.0 38.0 37.0 38.0 20-21 37.150625000000005 38.0 38.0 38.0 37.0 38.0 22-23 37.165125 38.0 38.0 38.0 37.0 38.0 24-25 37.146375000000006 38.0 38.0 38.0 37.0 38.0 26-27 37.110375 38.0 38.0 38.0 37.0 38.0 28-29 37.0635 38.0 38.0 38.0 37.0 38.0 30-31 37.144375 38.0 38.0 38.0 37.0 38.0 32-33 37.193 38.0 38.0 38.0 37.0 38.0 34-35 37.0975 38.0 38.0 38.0 37.0 38.0 36-37 37.194500000000005 38.0 38.0 38.0 37.0 38.0 38-39 37.229375000000005 38.0 38.0 38.0 37.0 38.0 40-41 37.207875 38.0 38.0 38.0 37.0 38.0 42-43 37.16875 38.0 38.0 38.0 37.0 38.0 44-45 37.161874999999995 38.0 38.0 38.0 37.0 38.0 46-47 37.147125 38.0 38.0 38.0 36.5 38.0 48-49 37.090374999999995 38.0 38.0 38.0 36.5 38.0 50-51 36.990625 38.0 38.0 38.0 36.0 38.0 52-53 37.113375 38.0 38.0 38.0 37.0 38.0 54-55 37.110375000000005 38.0 38.0 38.0 36.5 38.0 56-57 37.14625 38.0 38.0 38.0 37.0 38.0 58-59 37.066625 38.0 38.0 38.0 37.0 38.0 60-61 37.159875 38.0 38.0 38.0 37.0 38.0 62-63 37.090125 38.0 38.0 38.0 36.0 38.0 64-65 37.139875 38.0 38.0 38.0 37.0 38.0 66-67 37.071 38.0 38.0 38.0 36.0 38.0 68-69 37.12125 38.0 38.0 38.0 36.5 38.0 70-71 37.008624999999995 38.0 38.0 38.0 36.0 38.0 72-73 37.029375 38.0 38.0 38.0 36.0 38.0 74-75 37.027874999999995 38.0 38.0 38.0 36.0 38.0 76-77 37.073875 38.0 38.0 38.0 36.0 38.0 78-79 37.032375 38.0 38.0 38.0 36.5 38.0 80-81 36.968375 38.0 38.0 38.0 36.0 38.0 82-83 37.003 38.0 38.0 38.0 36.0 38.0 84-85 36.883250000000004 38.0 38.0 38.0 36.0 38.0 86-87 36.892625 38.0 38.0 38.0 36.0 38.0 88-89 36.852000000000004 38.0 38.0 38.0 35.5 38.0 90-91 36.846999999999994 38.0 38.0 38.0 35.0 38.0 92-93 36.865125000000006 38.0 38.0 38.0 35.5 38.0 94-95 36.8395 38.0 38.0 38.0 35.5 38.0 96-97 36.8665 38.0 38.0 38.0 35.5 38.0 98-99 36.870999999999995 38.0 38.0 38.0 35.5 38.0 100-101 36.80875 38.0 38.0 38.0 35.0 38.0 102-103 36.780375 38.0 38.0 38.0 35.0 38.0 104-105 36.683499999999995 38.0 38.0 38.0 35.0 38.0 106-107 36.61725 38.0 38.0 38.0 34.5 38.0 108-109 36.5655 38.0 38.0 38.0 34.0 38.0 110-111 36.447625 38.0 38.0 38.0 34.0 38.0 112-113 36.31675 38.0 38.0 38.0 34.0 38.0 114-115 36.28425 38.0 38.0 38.0 33.0 38.0 116-117 36.310375 38.0 38.0 38.0 33.0 38.0 118-119 36.170625 38.0 38.0 38.0 33.0 38.0 120-121 36.223375000000004 38.0 38.0 38.0 33.0 38.0 122-123 36.115750000000006 38.0 38.0 38.0 32.5 38.0 124-125 35.9985 38.0 38.0 38.0 32.5 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10-11 0.0 2309 12-13 0.0 2309 14-15 0.0 2309 16-17 0.0 2309 18-19 0.0 2309 20-21 0.0 2309 22-23 0.0 2309 24-25 0.0 2309 26-27 0.0 2309 28-29 0.0 2309 30-31 0.0 2309 32-33 0.0 2309 34-35 0.0 2309 36-37 0.0 2309 38-39 0.0 2309 40-41 0.0 2309 42-43 0.0 2309 44-45 0.0 2309 46-47 0.0 2309 48-49 0.0 2309 50-51 0.0 2309 52-53 0.0 2309 54-55 0.0 2309 56-57 0.0 2309 58-59 0.0 2309 60-61 0.0 2309 62-63 0.0 2309 64-65 0.0 2309 66-67 0.0 2309 68-69 0.0 2309 70-71 0.0 2309 72-73 0.0 2309 74-75 0.0 2309 76-77 0.0 2309 78-79 0.0 2309 80-81 0.0 2309 82-83 0.0 2309 84-85 0.0 2309 86-87 0.0 2309 88-89 0.0 2309 90-91 0.0 2309 92-93 0.0 2309 94-95 0.0 2309 96-97 0.0 2309 98-99 0.0 2309 100-101 0.0 2309 102-103 0.0 2309 104-105 0.0 2309 106-107 0.0 2309 108-109 0.0 2309 110-111 0.0 2309 112-113 0.0 2309 114-115 0.0 2309 116-117 0.0 2309 118-119 0.0 2309 120-121 0.0 2309 122-123 0.0 2309 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 3.0 17 2.0 18 3.0 19 6.0 20 6.0 21 3.0 22 4.0 23 11.0 24 8.0 25 12.0 26 11.0 27 19.0 28 20.0 29 20.0 30 34.0 31 46.0 32 58.0 33 75.0 34 88.0 35 143.0 36 302.0 37 3125.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.875 19.650000000000002 9.425 25.05 2 28.307076769192296 22.705676419104776 30.43260815203801 18.554638659664917 3 23.825 24.8 28.625 22.75 4 27.675 30.15 21.475 20.7 5 28.375 34.325 19.35 17.95 6 22.55 37.275000000000006 19.8 20.375 7 22.55563890972743 19.079769942485623 35.408852213053265 22.95573893473368 8 22.88072018004501 20.955238809702426 26.756689172293076 29.40735183795949 9 23.7 21.85 27.200000000000003 27.250000000000004 10-11 25.175087543771884 28.92696348174087 22.123561780890444 23.774387193596798 12-13 25.259472302113295 23.783918969613605 26.072277103913965 24.884331624359135 14-15 25.350175087543768 25.56278139069535 25.41270635317659 23.67433716858429 16-17 25.962981490745374 25.80040020010005 25.775387693846923 22.461230615307652 18-19 25.28448168063024 25.334500437664126 25.35950981618107 24.02150806552457 20-21 25.04376094023506 25.743935983995996 25.18129532383096 24.031007751937985 22-23 26.337500000000002 24.9875 25.4875 23.1875 24-25 25.6 24.887500000000003 25.837500000000002 23.674999999999997 26-27 25.353169146143266 26.26578322290286 26.103262907863485 22.277784723090384 28-29 26.244061015253813 25.893973493373345 25.468867216804203 22.393098274568644 30-31 25.6064016004001 25.79394848712178 26.431607901975497 22.168042010502624 32-33 24.953119139892486 26.715839479934996 25.778222277784725 22.552819102387797 34-35 25.874999999999996 25.687500000000004 26.05 22.3875 36-37 25.424999999999997 25.7375 25.687500000000004 23.150000000000002 38-39 25.387500000000003 25.2 26.7625 22.650000000000002 40-41 25.275 25.575 26.1 23.05 42-43 24.675 26.0 26.087500000000002 23.2375 44-45 24.825 25.362499999999997 26.6625 23.150000000000002 46-47 25.5125 25.412499999999998 25.6 23.474999999999998 48-49 25.497061398024258 25.797173940227587 26.222333375015634 22.483431286732525 50-51 26.32237088908341 24.98436913842691 26.42240840315118 22.2708515693385 52-53 25.756439109777446 25.618904726181547 25.84396099024756 22.780695173793447 54-55 25.38451919469801 25.334500437664126 26.62248343128673 22.65849693635113 56-57 24.896836313617605 25.1219207202701 26.559959984994375 23.42128298111792 58-59 24.756189047261813 25.79394848712178 26.431607901975497 23.018254563640912 60-61 24.949974987493746 25.625312656328163 27.01350675337669 22.411205602801402 62-63 24.171564336626236 26.334875578341876 26.53495060647743 22.958609478554457 64-65 25.378172271533945 26.328291036379547 26.040755094386796 22.252781597699713 66-67 24.715589448681087 26.490811351418923 26.540817602200274 22.252781597699713 68-69 24.2625 26.950000000000003 27.1 21.6875 70-71 25.51568946118265 25.528191023877984 26.96587073384173 21.990248781097637 72-73 25.4875 24.925 26.187500000000004 23.400000000000002 74-75 24.712500000000002 25.2875 27.3375 22.662499999999998 76-77 24.825 25.362499999999997 27.150000000000002 22.662499999999998 78-79 25.650000000000002 25.374999999999996 26.5875 22.3875 80-81 24.4375 26.474999999999998 26.825 22.2625 82-83 25.071901963236215 25.97223958984619 27.060147555333252 21.895710891584343 84-85 25.050025012506254 25.050025012506254 27.726363181590795 22.173586793396698 86-87 24.73736868434217 26.113056528264135 27.33866933466733 21.810905452726363 88-89 26.3631815907954 25.550275137568786 27.063531765882942 21.023011505752876 90-91 24.787393696848426 25.937968984492244 26.87593796898449 22.39869934967484 92-93 24.862431215607803 27.56378189094547 26.150575287643825 21.4232116058029 94-95 25.975487743871934 26.350675337668832 26.150575287643825 21.52326163081541 96-97 25.42521260630315 26.775887943971988 25.7503751875938 22.048524262131068 98-99 25.26263131565783 27.47623811905953 25.925462731365684 21.335667833916958 100-101 26.275637818909452 27.01350675337669 25.587793896948476 21.123061530765384 102-103 26.550775387693847 26.863431715857928 25.087543771885944 21.498249124562278 104-105 26.525762881440716 27.363681840920464 24.58729364682341 21.52326163081541 106-107 26.456614153538382 26.9567391847962 25.318829707426854 21.267816954238562 108-109 27.031757939484873 27.169292323080768 25.131282820705174 20.667666916729182 110-111 27.251125562781393 26.700850425212607 25.26263131565783 20.785392696348172 112-113 28.826913456728363 27.126063031515756 23.51175587793897 20.535267633816908 114-115 28.139069534767387 27.838919459729865 23.82441220610305 20.1975987993997 116-117 29.427213606803406 26.563281640820406 23.961980990495245 20.04752376188094 118-119 28.64290181363352 28.355222013758596 23.677298311444652 19.324577861163228 120-121 30.240120060030012 27.326163081540773 23.08654327163582 19.3471735867934 122-123 29.164582291145575 27.301150575287643 24.23711855927964 19.297148574287142 124-125 30.377688844422213 27.5887943971986 23.536768384192097 18.496748374187096 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 1.5 22 1.5 23 2.0 24 2.0 25 1.0 26 1.0 27 2.5 28 6.5 29 11.0 30 13.5 31 20.0 32 27.5 33 30.0 34 39.5 35 53.5 36 63.5 37 77.0 38 99.5 39 115.0 40 126.5 41 148.5 42 182.0 43 194.5 44 199.0 45 202.0 46 192.0 47 197.5 48 189.0 49 168.0 50 157.5 51 152.0 52 135.0 53 114.5 54 107.5 55 103.5 56 95.0 57 81.0 58 76.0 59 74.0 60 67.0 61 59.5 62 54.5 63 46.5 64 43.0 65 45.5 66 37.5 67 31.5 68 36.5 69 33.5 70 25.5 71 17.0 72 11.0 73 9.5 74 5.0 75 3.5 76 3.0 77 2.0 78 1.0 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.025 9 0.0 10-11 0.05 12-13 0.0375 14-15 0.05 16-17 0.05 18-19 0.0375 20-21 0.025 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.025 30-31 0.025 32-33 0.0125 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0375 50-51 0.0375 52-53 0.025 54-55 0.0375 56-57 0.0375 58-59 0.025 60-61 0.05 62-63 0.0375 64-65 0.0125 66-67 0.0125 68-69 0.0 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0375 84-85 0.05 86-87 0.05 88-89 0.05 90-91 0.05 92-93 0.05 94-95 0.05 96-97 0.05 98-99 0.05 100-101 0.05 102-103 0.05 104-105 0.05 106-107 0.025 108-109 0.025 110-111 0.05 112-113 0.05 114-115 0.05 116-117 0.05 118-119 0.0625 120-121 0.05 122-123 0.05 124-125 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.4125 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.6499999999999999 0.0 0.0 0.0 0.0 82-83 0.925 0.0 0.0 0.0 0.0 84-85 1.15 0.0 0.0 0.0 0.0 86-87 1.5625 0.0 0.0 0.0 0.0 88-89 2.05 0.0 0.0 0.0 0.0 90-91 2.55 0.0 0.0 0.0 0.0 92-93 3.1875 0.0 0.0 0.0 0.0 94-95 4.1 0.0 0.0 0.0 0.0 96-97 5.050000000000001 0.0 0.0 0.0 0.0 98-99 5.9875 0.0 0.0 0.0 0.0 100-101 7.3125 0.0 0.0 0.0 0.0 102-103 8.5 0.0 0.0 0.0 0.0 104-105 9.899999999999999 0.0 0.0 0.0 0.0 106-107 11.725 0.0 0.0 0.0 0.0 108-109 13.7875 0.0 0.0 0.0 0.0 110-111 15.325 0.0 0.0 0.0 0.0 112-113 17.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCGGAA 90 1.848698E-5 23.138887 118-119 AGATCGG 80 0.0062708086 18.59375 116-117 >>END_MODULE SRR3691968 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691968_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.60875 34.0 33.0 34.0 32.0 34.0 2 33.20325 34.0 33.0 34.0 32.0 34.0 3 33.2275 34.0 33.0 34.0 32.0 34.0 4 33.299 34.0 33.0 34.0 32.0 34.0 5 33.30775 34.0 33.0 34.0 33.0 34.0 6 36.87125 38.0 37.0 38.0 35.0 38.0 7 37.23 38.0 38.0 38.0 36.0 38.0 8 37.35625 38.0 38.0 38.0 37.0 38.0 9 37.496 38.0 38.0 38.0 37.0 38.0 10-11 37.40175 38.0 38.0 38.0 37.0 38.0 12-13 37.367000000000004 38.0 38.0 38.0 37.0 38.0 14-15 37.323125 38.0 38.0 38.0 37.0 38.0 16-17 37.400125 38.0 38.0 38.0 37.0 38.0 18-19 37.445 38.0 38.0 38.0 37.0 38.0 20-21 37.42775 38.0 38.0 38.0 37.0 38.0 22-23 37.43825 38.0 38.0 38.0 37.5 38.0 24-25 37.463750000000005 38.0 38.0 38.0 37.5 38.0 26-27 37.442125000000004 38.0 38.0 38.0 37.0 38.0 28-29 37.3885 38.0 38.0 38.0 37.0 38.0 30-31 37.4285 38.0 38.0 38.0 37.0 38.0 32-33 37.388625000000005 38.0 38.0 38.0 37.0 38.0 34-35 37.366625 38.0 38.0 38.0 37.0 38.0 36-37 37.38775 38.0 38.0 38.0 37.0 38.0 38-39 37.31625 38.0 38.0 38.0 37.0 38.0 40-41 37.2775 38.0 38.0 38.0 37.0 38.0 42-43 37.24875 38.0 38.0 38.0 37.0 38.0 44-45 37.22475 38.0 38.0 38.0 37.0 38.0 46-47 37.282875000000004 38.0 38.0 38.0 37.0 38.0 48-49 37.233625 38.0 38.0 38.0 36.5 38.0 50-51 37.3195 38.0 38.0 38.0 36.5 38.0 52-53 37.33775 38.0 38.0 38.0 37.0 38.0 54-55 37.21 38.0 38.0 38.0 36.5 38.0 56-57 37.17475 38.0 38.0 38.0 36.5 38.0 58-59 37.1905 38.0 38.0 38.0 36.5 38.0 60-61 37.17400000000001 38.0 38.0 38.0 36.0 38.0 62-63 37.1665 38.0 38.0 38.0 36.0 38.0 64-65 37.188625 38.0 38.0 38.0 36.0 38.0 66-67 37.14375 38.0 38.0 38.0 36.0 38.0 68-69 37.182249999999996 38.0 38.0 38.0 36.0 38.0 70-71 37.126 38.0 38.0 38.0 36.0 38.0 72-73 37.10725 38.0 38.0 38.0 36.0 38.0 74-75 37.179625 38.0 38.0 38.0 36.0 38.0 76-77 37.107875 38.0 38.0 38.0 36.0 38.0 78-79 37.116125 38.0 38.0 38.0 36.0 38.0 80-81 37.042375 38.0 38.0 38.0 36.0 38.0 82-83 36.989000000000004 38.0 38.0 38.0 36.0 38.0 84-85 36.826 38.0 38.0 38.0 35.0 38.0 86-87 36.883375 38.0 38.0 38.0 35.0 38.0 88-89 36.949124999999995 38.0 38.0 38.0 35.5 38.0 90-91 36.988 38.0 38.0 38.0 36.0 38.0 92-93 36.835125 38.0 38.0 38.0 35.0 38.0 94-95 36.978875 38.0 38.0 38.0 36.0 38.0 96-97 36.798 38.0 38.0 38.0 35.0 38.0 98-99 36.802875 38.0 38.0 38.0 35.0 38.0 100-101 36.847125 38.0 38.0 38.0 35.0 38.0 102-103 36.7595 38.0 38.0 38.0 35.0 38.0 104-105 36.727875 38.0 38.0 38.0 35.0 38.0 106-107 36.693375 38.0 38.0 38.0 34.5 38.0 108-109 36.771625 38.0 38.0 38.0 35.0 38.0 110-111 36.600375 38.0 38.0 38.0 34.5 38.0 112-113 36.596375 38.0 38.0 38.0 34.0 38.0 114-115 36.65325 38.0 38.0 38.0 34.5 38.0 116-117 36.501999999999995 38.0 38.0 38.0 34.0 38.0 118-119 36.339 38.0 38.0 38.0 34.0 38.0 120-121 36.326625 38.0 38.0 38.0 34.0 38.0 122-123 36.347375 38.0 38.0 38.0 34.0 38.0 124-125 36.29075 38.0 38.0 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10-11 0.0 2309 12-13 0.0 2309 14-15 0.0 2309 16-17 0.0 2309 18-19 0.0 2309 20-21 0.0 2309 22-23 0.0 2309 24-25 0.0 2309 26-27 0.0 2309 28-29 0.0 2309 30-31 0.0 2309 32-33 0.0 2309 34-35 0.0 2309 36-37 0.0 2309 38-39 0.0 2309 40-41 0.0 2309 42-43 0.0 2309 44-45 0.0 2309 46-47 0.0 2309 48-49 0.0 2309 50-51 0.0 2309 52-53 0.0 2309 54-55 0.0 2309 56-57 0.0 2309 58-59 0.0 2309 60-61 0.0 2309 62-63 0.0 2309 64-65 0.0 2309 66-67 0.0 2309 68-69 0.0 2309 70-71 0.0 2309 72-73 0.0 2309 74-75 0.0 2309 76-77 0.0 2309 78-79 0.0 2309 80-81 0.0 2309 82-83 0.0 2309 84-85 0.0 2309 86-87 0.0 2309 88-89 0.0 2309 90-91 0.0 2309 92-93 0.0 2309 94-95 0.0 2309 96-97 0.0 2309 98-99 0.0 2309 100-101 0.0 2309 102-103 0.0 2309 104-105 0.0 2309 106-107 0.0 2309 108-109 0.0 2309 110-111 0.0 2309 112-113 0.0 2309 114-115 0.0 2309 116-117 0.0 2309 118-119 0.0 2309 120-121 0.0 2309 122-123 0.0 2309 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 3.0 22 2.0 23 1.0 24 3.0 25 10.0 26 15.0 27 9.0 28 25.0 29 17.0 30 35.0 31 42.0 32 51.0 33 71.0 34 86.0 35 162.0 36 367.0 37 3101.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 48.67143587123148 10.526315789473683 7.256004087889627 33.54624425140521 2 22.775000000000002 13.900000000000002 33.300000000000004 30.025000000000002 3 21.5 19.55 25.05 33.900000000000006 4 27.85 25.974999999999998 21.65 24.525 5 25.6 31.974999999999998 22.325 20.1 6 20.8 32.95 25.1 21.15 7 16.225 23.35 40.825 19.6 8 17.4 23.95 31.25 27.400000000000002 9 19.400000000000002 22.775000000000002 32.925 24.9 10-11 22.175 31.424999999999997 24.0 22.400000000000002 12-13 21.2375 25.25 28.012500000000003 25.5 14-15 22.0625 26.137500000000003 27.250000000000004 24.55 16-17 22.2125 26.7625 25.7375 25.2875 18-19 21.55 27.1 26.1 25.25 20-21 22.8875 27.35 25.4875 24.275 22-23 22.162499999999998 26.674999999999997 26.025 25.137500000000003 24-25 22.2625 27.0 26.6125 24.125 26-27 21.7375 26.8 26.5375 24.925 28-29 21.925 27.825 25.95 24.3 30-31 22.825 26.687499999999996 26.0375 24.45 32-33 21.9375 27.437499999999996 26.150000000000002 24.474999999999998 34-35 22.4875 27.037499999999998 25.412499999999998 25.0625 36-37 22.8 26.3125 25.912499999999998 24.975 38-39 21.8 26.8625 25.575 25.7625 40-41 23.175 26.487500000000004 25.7 24.637500000000003 42-43 22.900000000000002 26.724999999999998 25.575 24.8 44-45 21.725 26.474999999999998 26.424999999999997 25.374999999999996 46-47 22.525000000000002 27.800000000000004 25.2625 24.4125 48-49 22.5875 26.8 25.4 25.2125 50-51 21.75 27.287499999999998 25.650000000000002 25.3125 52-53 22.85 26.85 25.687500000000004 24.6125 54-55 22.287499999999998 26.85 25.4875 25.374999999999996 56-57 21.75 27.0125 26.3625 24.875 58-59 22.112499999999997 27.425 25.275 25.1875 60-61 22.912499999999998 26.737499999999997 25.3125 25.0375 62-63 22.0 26.4125 26.825 24.762500000000003 64-65 22.2 26.474999999999998 25.937500000000004 25.387500000000003 66-67 21.637500000000003 27.6 25.624999999999996 25.137500000000003 68-69 22.5625 26.125 25.724999999999998 25.587500000000002 70-71 22.25 27.0 25.55 25.2 72-73 21.85 27.3625 25.9875 24.8 74-75 23.275000000000002 25.474999999999998 25.9625 25.2875 76-77 22.85 27.2625 25.624999999999996 24.2625 78-79 22.412499999999998 26.674999999999997 25.025 25.887500000000003 80-81 22.675 27.175 26.0625 24.087500000000002 82-83 22.8625 27.237499999999997 25.137500000000003 24.762500000000003 84-85 23.05 27.025 24.4 25.525 86-87 23.200000000000003 25.275 25.887500000000003 25.637500000000003 88-89 24.025 26.8125 24.75 24.4125 90-91 23.1875 26.5125 25.387500000000003 24.9125 92-93 23.825 26.137500000000003 25.575 24.462500000000002 94-95 24.5 27.3125 24.212500000000002 23.974999999999998 96-97 23.1125 27.200000000000003 24.2875 25.4 98-99 23.5375 27.450000000000003 24.0 25.0125 100-101 22.912499999999998 27.462500000000002 25.374999999999996 24.25 102-103 23.325000000000003 27.474999999999998 23.974999999999998 25.224999999999998 104-105 24.0625 26.987499999999997 24.725 24.224999999999998 106-107 23.65 27.1625 24.2875 24.9 108-109 23.225 27.925 23.5875 25.2625 110-111 23.8375 27.450000000000003 24.087500000000002 24.625 112-113 24.25 27.474999999999998 22.9625 25.3125 114-115 23.7 28.3875 22.650000000000002 25.2625 116-117 24.7 27.625 22.9375 24.7375 118-119 23.3375 28.775000000000002 22.8875 25.0 120-121 24.4375 28.325 22.1875 25.05 122-123 23.45 29.7875 22.0875 24.675 124-125 24.1375 28.3625 22.025 25.474999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 1.5 25 1.0 26 2.5 27 5.5 28 6.5 29 13.0 30 15.5 31 15.5 32 24.5 33 34.5 34 42.5 35 54.0 36 79.5 37 106.0 38 113.5 39 120.0 40 143.0 41 164.0 42 177.5 43 190.5 44 199.0 45 200.0 46 206.0 47 194.0 48 187.5 49 175.0 50 151.5 51 145.0 52 123.0 53 106.0 54 96.0 55 86.0 56 80.5 57 78.5 58 75.5 59 66.5 60 66.0 61 68.5 62 55.0 63 43.0 64 40.0 65 35.0 66 33.0 67 35.5 68 29.0 69 23.5 70 23.0 71 15.0 72 11.5 73 12.5 74 7.0 75 5.0 76 5.0 77 3.0 78 1.5 79 1.0 80 1.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21736935117394 98.25 2 0.6311537490532694 1.25 3 0.10098459984852311 0.3 4 0.050492299924261554 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.21250000000000002 0.0 0.0 0.0 0.0 72-73 0.2625 0.0 0.0 0.0 0.0 74-75 0.3375 0.0 0.0 0.0 0.0 76-77 0.425 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.6375 0.0 0.0 0.0 0.0 82-83 0.95 0.0 0.0 0.0 0.0 84-85 1.2 0.0 0.0 0.0 0.0 86-87 1.6124999999999998 0.0 0.0 0.0 0.0 88-89 2.0375 0.0 0.0 0.0 0.0 90-91 2.5250000000000004 0.0 0.0 0.0 0.0 92-93 3.175 0.0 0.0 0.0 0.0 94-95 4.074999999999999 0.0 0.0 0.0 0.0 96-97 5.025 0.0 0.0 0.0 0.0 98-99 6.0375 0.0 0.0 0.0 0.0 100-101 7.45 0.0 0.0 0.0 0.0 102-103 8.649999999999999 0.0 0.0 0.0 0.0 104-105 10.0125 0.0 0.0 0.0 0.0 106-107 11.8625 0.0 0.0 0.0 0.0 108-109 14.0625 0.0 0.0 0.0 0.0 110-111 15.649999999999999 0.0 0.0 0.0 0.0 112-113 17.825000000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGATCG 40 0.0050538145 29.749998 116-117 ATCGGAA 75 4.486219E-6 27.766665 118-119 AGATCGG 80 2.3110506E-4 22.312498 116-117 GATCGGA 75 0.0043167206 19.833332 118-119 >>END_MODULE Read 1170675 spots for SRR3691968.sra Written 1170675 spots for SRR3691968.sra Read 1170675 spots for SRR3691968.sra Written 1170675 spots for SRR3691968.sra Read 1170675 spots for SRR3691968.sra Written 1170675 spots for SRR3691968.sra Read 1170675 spots for SRR3691968.sra Written 1170675 spots for SRR3691968.sra Read 1170675 spots for SRR3691968.sra Written 1170675 spots for SRR3691968.sra Read 1170675 spots for SRR3691968.sra Written 1170675 spots for SRR3691968.sra Read 1170675 spots for SRR3691968.sra Written 1170675 spots for SRR3691968.sra Read 1170675 spots for SRR3691968.sra Written 1170675 spots for SRR3691968.sra Read 1170675 spots for SRR3691968.sra Written 1170675 spots for SRR3691968.sra Read 1170675 spots for SRR3691968.sra Written 1170675 spots for SRR3691968.sra Read 1170675 spots for SRR3691968.sra Written 1170675 spots for SRR3691968.sra Read 1170675 spots for SRR3691968.sra Written 1170675 spots for SRR3691968.sra Read 1170675 spots for SRR3691968.sra Written 1170675 spots for SRR3691968.sra Read 1170675 spots for SRR3691968.sra Written 1170675 spots for SRR3691968.sra Read 1170675 spots for SRR3691968.sra Written 1170675 spots for SRR3691968.sra Read 1170675 spots for SRR3691968.sra Written 1170675 spots for SRR3691968.sra Read 1170690 spots for SRR3691968.sra Written 1170690 spots for SRR3691968.sra Read 1170675 spots for SRR3691968.sra Written 1170675 spots for SRR3691968.sra Read 1170675 spots for SRR3691968.sra Written 1170675 spots for SRR3691968.sra Read 1170675 spots for SRR3691968.sra Written 1170675 spots for SRR3691968.sra SRR ids: ['SRR3691968.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mhlivw92 SRR3691968.sra spots: 23413515 blocks: [[1, 1170675], [1170676, 2341350], [2341351, 3512025], [3512026, 4682700], [4682701, 5853375], [5853376, 7024050], [7024051, 8194725], [8194726, 9365400], [9365401, 10536075], [10536076, 11706750], [11706751, 12877425], [12877426, 14048100], [14048101, 15218775], [15218776, 16389450], [16389451, 17560125], [17560126, 18730800], [18730801, 19901475], [19901476, 21072150], [21072151, 22242825], [22242826, 23413515]] SRR3691968 file size 7454155 SRR3691968 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3691968 SRR3691968_1.fastq SRR3691968_2.fastq Input file: SRR3691968_1.fastq Paired file: SRR3691968_2.fastq trimmed: SRR3691968-trimmed-pair1.fastq, SRR3691968-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:25:36 2024 >> started Thu Dec 12 03:26:15 2024 >> done (38.677s) 23413515 read pairs processed; of these: 151 ( 0.00%) short read pairs filtered out after trimming by size control 3911 ( 0.02%) empty read pairs filtered out after trimming by size control 23409453 (99.98%) read pairs available; of these: 6082680 (25.98%) trimmed read pairs available after processing 17326773 (74.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 0 0.00% 23 5 0.00% 24 1 0.00% 25 2 0.00% 26 5 0.00% 27 6 0.00% 28 11 0.00% 29 7 0.00% 30 11 0.00% 31 20 0.00% 32 22 0.00% 33 27 0.00% 34 31 0.00% 35 29 0.00% 36 38 0.00% 37 57 0.00% 38 58 0.00% 39 70 0.00% 40 110 0.00% 41 107 0.00% 42 137 0.00% 43 124 0.00% 44 131 0.00% 45 171 0.00% 46 180 0.00% 47 216 0.00% 48 248 0.00% 49 322 0.00% 50 365 0.00% 51 405 0.00% 52 446 0.00% 53 512 0.00% 54 597 0.00% 55 645 0.00% 56 648 0.00% 57 743 0.00% 58 923 0.00% 59 1011 0.00% 60 1230 0.01% 61 1433 0.01% 62 1638 0.01% 63 1770 0.01% 64 1894 0.01% 65 2111 0.01% 66 2353 0.01% 67 2634 0.01% 68 2922 0.01% 69 3413 0.01% 70 3877 0.02% 71 4487 0.02% 72 5294 0.02% 73 5934 0.03% 74 6770 0.03% 75 7545 0.03% 76 8299 0.04% 77 8880 0.04% 78 9737 0.04% 79 11274 0.05% 80 12390 0.05% 81 14264 0.06% 82 16438 0.07% 83 18488 0.08% 84 20970 0.09% 85 23219 0.10% 86 25813 0.11% 87 27603 0.12% 88 30222 0.13% 89 32322 0.14% 90 35885 0.15% 91 39303 0.17% 92 43442 0.19% 93 48663 0.21% 94 53493 0.23% 95 58727 0.25% 96 62417 0.27% 97 66362 0.28% 98 68567 0.29% 99 73045 0.31% 100 78293 0.33% 101 82353 0.35% 102 87912 0.38% 103 94966 0.41% 104 99713 0.43% 105 107392 0.46% 106 110912 0.47% 107 113981 0.49% 108 118111 0.50% 109 122130 0.52% 110 125957 0.54% 111 143888 0.61% 112 262885 1.12% 113 272093 1.16% 114 283320 1.21% 115 295670 1.26% 116 302790 1.29% 117 305045 1.30% 118 305342 1.30% 119 303663 1.30% 120 307589 1.31% 121 338010 1.44% 122 308754 1.32% 123 315723 1.35% 124 322613 1.38% 125 17326773 74.02% 23409453 reads passed initial QC criterion=sequence-density sequence-density=16.73 sequence-density-rank=1 fanout-score=33.93 fanout-score-rank=2 prefix-density=16.90 prefix-fanout=33.6 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA criterion=fanout-score sequence-density=0.68 sequence-density-rank=2 fanout-score=35.07 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=35.1 sequence=GGATCGGAAGAG criterion=sequence-density sequence-density=16.94 sequence-density-rank=1 fanout-score=40.79 fanout-score-rank=2 prefix-density=17.02 prefix-fanout=40.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA criterion=fanout-score sequence-density=0.59 sequence-density-rank=2 fanout-score=43.80 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=43.4 sequence=GGATCGGAAGAG Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -y AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA -o SRR3691968 SRR3691968_1.fastq SRR3691968_2.fastq Input file: SRR3691968_1.fastq Paired file: SRR3691968_2.fastq trimmed: SRR3691968-trimmed-pair1.fastq, SRR3691968-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:27:50 2024 >> started Thu Dec 12 03:28:19 2024 >> done (29.003s) 20655400 read pairs processed; of these: 103 ( 0.00%) short read pairs filtered out after trimming by size control 3414 ( 0.02%) empty read pairs filtered out after trimming by size control 20651883 (99.98%) read pairs available; of these: 1861736 ( 9.01%) trimmed read pairs available after processing 18790147 (90.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 3 0.00% 21 4 0.00% 22 2 0.00% 23 6 0.00% 24 1 0.00% 25 6 0.00% 26 6 0.00% 27 11 0.00% 28 19 0.00% 29 11 0.00% 30 23 0.00% 31 38 0.00% 32 38 0.00% 33 39 0.00% 34 67 0.00% 35 53 0.00% 36 76 0.00% 37 126 0.00% 38 100 0.00% 39 119 0.00% 40 184 0.00% 41 181 0.00% 42 211 0.00% 43 239 0.00% 44 246 0.00% 45 304 0.00% 46 328 0.00% 47 387 0.00% 48 465 0.00% 49 574 0.00% 50 646 0.00% 51 733 0.00% 52 795 0.00% 53 918 0.00% 54 1010 0.00% 55 1081 0.01% 56 1122 0.01% 57 1276 0.01% 58 1638 0.01% 59 1814 0.01% 60 2215 0.01% 61 2491 0.01% 62 2857 0.01% 63 3105 0.02% 64 3392 0.02% 65 3710 0.02% 66 4090 0.02% 67 4670 0.02% 68 5122 0.02% 69 5908 0.03% 70 6826 0.03% 71 7822 0.04% 72 9327 0.05% 73 10685 0.05% 74 11773 0.06% 75 13257 0.06% 76 14385 0.07% 77 15705 0.08% 78 17316 0.08% 79 19688 0.10% 80 22065 0.11% 81 25142 0.12% 82 28876 0.14% 83 32712 0.16% 84 37184 0.18% 85 41069 0.20% 86 45123 0.22% 87 48378 0.23% 88 52967 0.26% 89 56870 0.28% 90 63201 0.31% 91 69620 0.34% 92 76569 0.37% 93 85347 0.41% 94 94219 0.46% 95 102897 0.50% 96 109507 0.53% 97 116845 0.57% 98 120953 0.59% 99 128359 0.62% 100 137332 0.66% 101 144681 0.70% 102 154460 0.75% 103 167247 0.81% 104 175267 0.85% 105 187806 0.91% 106 195338 0.95% 107 201103 0.97% 108 207785 1.01% 109 214293 1.04% 110 218820 1.06% 111 224656 1.09% 112 231570 1.12% 113 240065 1.16% 114 250131 1.21% 115 260922 1.26% 116 267230 1.29% 117 269059 1.30% 118 269584 1.31% 119 268042 1.30% 120 271512 1.31% 121 295842 1.43% 122 272119 1.32% 123 278669 1.35% 124 284659 1.38% 125 13426534 65.01% criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=40 prefix-density=0.10 prefix-fanout=2.0 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=123.35 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=18.4 sequence=GAAGAAGAAGAAA criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=37 prefix-density=0.10 prefix-fanout=2.0 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=132.79 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=19.3 sequence=GAAGAAGAAGAAA SRR3691968 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:29:20 Started mapping on | Dec 12 03:29:20 Finished on | Dec 12 03:31:11 Mapping speed, Million of reads per hour | 759.11 Number of input reads | 23405936 Average input read length | 238 UNIQUE READS: Uniquely mapped reads number | 21399694 Uniquely mapped reads % | 91.43% Average mapped length | 238.02 Number of splices: Total | 14031268 Number of splices: Annotated (sjdb) | 13126025 Number of splices: GT/AG | 13831209 Number of splices: GC/AG | 164425 Number of splices: AT/AC | 7084 Number of splices: Non-canonical | 28550 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.08 Insertion rate per base | 0.01% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 652126 % of reads mapped to multiple loci | 2.79% Number of reads mapped to too many loci | 121286 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.47% % of reads unmapped: other | 1.80% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1354255 1354255 1354255 N_multimapping 652126 652126 652126 N_noFeature 1065834 11054614 10934997 N_ambiguous 536709 32461 31255 UnstrandedReadsAssigned:19797151 PositiveStrandReadsAssigned:10312619 NegativeStrandReadsAssigned:10433442 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=113 echo kmer=109 SRR3691968 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3691968-trimmed-pair1.fastq SRR3691968-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,405,936 reads, 20,888,094 reads pseudoaligned [quant] estimated average fragment length: 139.899 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52973 SRR3691968.ke.tsv 35125 SRR3691968.se.tsv 88098 total ==> SRR3691968.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 797.252 0 0 PNS24247 1044 905.101 64.9035 5.11818 PNS24249 1928 1789.1 111.146 4.43408 PNS24246 1044 905.101 64.9035 5.11818 PNS24248 1044 905.101 64.9035 5.11818 PNS24244 1471 1332.1 317.144 16.9927 PNS24243 293 155.627 7 3.21039 KQK14069 1603 1464.1 37648.9 1835.38 KQK14071 474 336.097 1887.02 400.735 ==> SRR3691968.se.tsv <== BRADI_1g14170v3 44947 BRADI_1g53295v3 35 BRADI_1g59795v3 1915 BRADI_1g07683v3 0 BRADI_1g00485v3 27 BRADI_1g20270v3 172 BRADI_1g74790v3 158 BRADI_1g09890v3 0 BRADI_1g77505v3 319 BRADI_1g48960v3 0 SRR3691968 completed mapping pipeline successfully