Starting /dee2/code/volunteer_pipeline.sh SRR3691969 current disk space = 1523450675200 free memory = 1563897008 SRR3691969 SRAfilesize c245f6a9365bf4248d27b77ed94c3f9a SRR3691969.sra SRR3691969.sra file validated SRR3691969 is paired end SRR3691969 is conventional basespace SRR3691969 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691969_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.878 33.0 33.0 34.0 32.0 34.0 2 32.99075 34.0 33.0 34.0 32.0 34.0 3 33.0365 34.0 33.0 34.0 32.0 34.0 4 32.8655 34.0 33.0 34.0 32.0 34.0 5 32.94375 34.0 33.0 34.0 32.0 34.0 6 37.036 38.0 38.0 38.0 36.0 38.0 7 37.16 38.0 38.0 38.0 37.0 38.0 8 37.13575 38.0 38.0 38.0 37.0 38.0 9 37.13225 38.0 38.0 38.0 37.0 38.0 10-11 37.06575 38.0 38.0 38.0 36.5 38.0 12-13 37.031000000000006 38.0 38.0 38.0 36.5 38.0 14-15 37.079 38.0 38.0 38.0 37.0 38.0 16-17 36.99425 38.0 38.0 38.0 36.0 38.0 18-19 37.091375 38.0 38.0 38.0 37.0 38.0 20-21 37.10125 38.0 38.0 38.0 36.5 38.0 22-23 37.100375 38.0 38.0 38.0 37.0 38.0 24-25 37.01875 38.0 38.0 38.0 36.5 38.0 26-27 36.99525 38.0 38.0 38.0 36.5 38.0 28-29 37.090125 38.0 38.0 38.0 37.0 38.0 30-31 37.073125 38.0 38.0 38.0 37.0 38.0 32-33 37.095124999999996 38.0 38.0 38.0 37.0 38.0 34-35 37.074875 38.0 38.0 38.0 37.0 38.0 36-37 37.087875 38.0 38.0 38.0 36.5 38.0 38-39 37.083875 38.0 38.0 38.0 36.5 38.0 40-41 37.145875000000004 38.0 38.0 38.0 37.0 38.0 42-43 37.090125 38.0 38.0 38.0 37.0 38.0 44-45 37.079375 38.0 38.0 38.0 36.5 38.0 46-47 37.0685 38.0 38.0 38.0 37.0 38.0 48-49 37.063 38.0 38.0 38.0 36.5 38.0 50-51 37.049625000000006 38.0 38.0 38.0 36.5 38.0 52-53 37.01325 38.0 38.0 38.0 36.5 38.0 54-55 37.0105 38.0 38.0 38.0 36.0 38.0 56-57 37.0025 38.0 38.0 38.0 36.5 38.0 58-59 36.978125 38.0 38.0 38.0 36.0 38.0 60-61 36.985375000000005 38.0 38.0 38.0 36.0 38.0 62-63 36.994749999999996 38.0 38.0 38.0 36.0 38.0 64-65 36.98325 38.0 38.0 38.0 36.0 38.0 66-67 36.949749999999995 38.0 38.0 38.0 36.0 38.0 68-69 36.849125 38.0 38.0 38.0 36.0 38.0 70-71 36.89425 38.0 38.0 38.0 36.0 38.0 72-73 36.93325 38.0 38.0 38.0 36.0 38.0 74-75 36.789249999999996 38.0 38.0 38.0 36.0 38.0 76-77 36.81825 38.0 38.0 38.0 36.0 38.0 78-79 36.806125 38.0 38.0 38.0 36.0 38.0 80-81 36.808 38.0 38.0 38.0 35.0 38.0 82-83 36.7555 38.0 38.0 38.0 35.0 38.0 84-85 36.635875 38.0 38.0 38.0 35.0 38.0 86-87 36.7605 38.0 38.0 38.0 35.0 38.0 88-89 36.719125 38.0 38.0 38.0 35.0 38.0 90-91 36.578500000000005 38.0 38.0 38.0 34.0 38.0 92-93 36.599125 38.0 38.0 38.0 35.0 38.0 94-95 36.501999999999995 38.0 38.0 38.0 34.0 38.0 96-97 36.510000000000005 38.0 38.0 38.0 34.0 38.0 98-99 36.371875 38.0 38.0 38.0 34.0 38.0 100-101 36.459999999999994 38.0 38.0 38.0 34.0 38.0 102-103 36.3335 38.0 38.0 38.0 34.0 38.0 104-105 36.4105 38.0 38.0 38.0 34.0 38.0 106-107 36.356625 38.0 38.0 38.0 34.0 38.0 108-109 36.268625 38.0 38.0 38.0 34.0 38.0 110-111 36.215875 38.0 38.0 38.0 34.0 38.0 112-113 36.218 38.0 38.0 38.0 34.0 38.0 114-115 36.061375 38.0 38.0 38.0 33.0 38.0 116-117 35.841750000000005 38.0 37.5 38.0 31.0 38.0 118-119 35.510374999999996 38.0 37.0 38.0 31.0 38.0 120-121 35.359625 38.0 37.0 38.0 30.0 38.0 122-123 35.40225 38.0 36.5 38.0 31.0 38.0 124-125 35.143874999999994 38.0 36.0 38.0 28.5 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 2.0 17 9.0 18 12.0 19 6.0 20 3.0 21 5.0 22 4.0 23 9.0 24 12.0 25 13.0 26 12.0 27 17.0 28 24.0 29 23.0 30 33.0 31 51.0 32 64.0 33 78.0 34 84.0 35 177.0 36 354.0 37 3002.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.288224956063274 18.98066783831283 8.260105448154658 28.471001757469246 2 27.641462193289932 22.058087130696045 30.17025538307461 20.13019529293941 3 23.309964947421133 24.486730095142715 30.095142714071105 22.108162243365047 4 27.84176264396595 30.345518277416122 20.555833750625936 21.256885327991988 5 29.394091136705057 32.49874812218327 19.053580370555835 19.053580370555835 6 21.896896896896898 35.86086086086086 20.845845845845844 21.396396396396398 7 23.123123123123122 18.41841841841842 34.609609609609606 23.84884884884885 8 22.722722722722725 21.646646646646648 26.326326326326328 29.304304304304303 9 24.724724724724727 21.77177177177177 27.177177177177175 26.326326326326328 10-11 26.67417699336588 28.81462010264113 21.366879459256477 23.14432344473651 12-13 26.852779168753127 22.521281922884327 25.600901352028043 25.0250375563345 14-15 25.72931012895956 24.902967321898085 25.241016652059596 24.126705897082758 16-17 26.86866157505947 24.139226242644295 24.66508075622887 24.327031426067357 18-19 25.81372058087131 25.037556334501755 24.699549323985977 24.44917376064096 20-21 25.71964956195244 24.367959949937422 25.732165206508135 24.180225281602002 22-23 26.213713713713716 24.924924924924923 25.13763763763764 23.723723723723726 24-25 26.576576576576578 24.3993993993994 24.512012012012015 24.512012012012015 26-27 25.100100100100097 25.425425425425423 25.913413413413412 23.56106106106106 28-29 25.775775775775777 24.54954954954955 25.625625625625624 24.04904904904905 30-31 25.732165206508135 24.918648310387987 25.819774718397998 23.52941176470588 32-33 25.41609310474284 24.114628957577274 25.55374796646227 24.91552997121762 34-35 25.93843843843844 24.64964964964965 24.474474474474476 24.93743743743744 36-37 25.63781890945473 25.662831415707853 25.475237618809405 23.224112056028016 38-39 25.25644233174881 26.53239929947461 25.056292219164373 23.15486614961221 40-41 26.583229036295368 24.317897371714643 25.294117647058822 23.804755944931163 42-43 25.175175175175173 24.486986986986985 26.076076076076077 24.261761761761765 44-45 24.881101376720903 25.269086357947433 25.819774718397998 24.030037546933666 46-47 26.52984607683644 24.577649856088097 24.978100362908272 23.91440370416719 48-49 25.57266241081487 25.03442233070472 24.9342846413819 24.45863061709851 50-51 25.325488232348526 25.751126690035054 26.01402103154732 22.909364046069104 52-53 25.184628864688946 24.859181374389784 25.38490424333458 24.571285517586684 54-55 24.787180771156734 24.54932398597897 26.489734601902853 24.173760640961444 56-57 24.9749624436655 24.912368552829246 25.98898347521282 24.123685528292437 58-59 26.057571964956196 24.58072590738423 25.431789737171464 23.92991239048811 60-61 25.109525597696837 25.84804105645262 25.62273125547628 23.419702090374265 62-63 25.03442233070472 24.846664163224432 26.33621229190136 23.78270121416948 64-65 25.400400400400404 25.325325325325327 25.663163163163162 23.61111111111111 66-67 26.614114114114113 24.84984984984985 25.462962962962965 23.073073073073072 68-69 24.968742185546386 25.581395348837212 25.531382845711427 23.918479619904975 70-71 26.08478179317244 24.759284731774414 25.472052019507313 23.68388145554583 72-73 25.081310983237426 25.331498623967974 25.331498623967974 24.25569176882662 74-75 25.037537537537535 25.763263263263266 26.013513513513516 23.185685685685687 76-77 26.576576576576578 25.613113113113112 25.212712712712715 22.597597597597595 78-79 25.563063063063062 25.325325325325327 25.487987987987985 23.623623623623622 80-81 25.372200675591145 25.672463405479796 26.448142124358814 22.50719379457025 82-83 25.99824759043685 24.88421579672049 25.52259356615346 23.5949430466892 84-85 25.187781672508763 24.912368552829246 26.02653980971457 23.87330996494742 86-87 25.88883324987481 25.98898347521282 25.17526289434151 22.946920380570855 88-89 26.042318767997997 24.677601101790408 25.892074621259546 23.388005508952048 90-91 25.776164246369554 25.30045067601402 25.901352028042062 23.02203304957436 92-93 25.81372058087131 25.7386079118678 25.88883324987481 22.55883825738608 94-95 26.173488546751784 25.460007510326697 25.322318187507825 23.044185755413693 96-97 26.292725679228745 26.33028671591336 25.291098034305747 22.085889570552148 98-99 25.585472761427674 26.0738885410144 26.199123356293047 22.14151534126487 100-101 26.787726988102694 26.123982467125863 24.821540388227927 22.26675015654352 102-103 26.48716343143394 26.0738885410144 24.85911083281152 22.579837194740136 104-105 26.72176308539945 27.560731279739542 23.779113448534936 21.93839218632607 106-107 26.589884827240862 27.053079619429145 24.361542313470206 21.99549323985979 108-109 26.906222611744084 27.094027795167147 24.026543132590458 21.97320646049831 110-111 26.355327407036434 27.369475397520972 25.02817077751346 21.247026417929135 112-113 26.984723265715 26.947157525669923 23.6038066616579 22.464312546957174 114-115 27.526612398246712 26.224170319348776 23.969943644333124 22.279273638071384 116-117 28.32102166019782 26.693376737197948 24.001502441467384 20.984099161136847 118-119 28.364232564005547 28.212889393366126 23.105057384285534 20.317820658342793 120-121 29.115200403327453 26.59440383161079 23.93496344844971 20.35543231661205 122-123 29.417695991933453 26.833879505923875 23.279556339803378 20.468868162339298 124-125 30.55205444920595 27.37585076884295 22.056970002520796 20.015124779430298 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.5 5 1.0 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 1.5 22 0.5 23 0.0 24 1.5 25 3.0 26 1.5 27 3.0 28 7.5 29 7.0 30 7.0 31 12.0 32 16.0 33 20.5 34 27.5 35 38.5 36 55.5 37 72.5 38 93.5 39 109.5 40 127.5 41 147.0 42 159.5 43 172.5 44 171.5 45 182.5 46 201.5 47 192.5 48 183.5 49 167.5 50 148.5 51 141.5 52 124.5 53 108.5 54 110.5 55 104.5 56 88.5 57 83.5 58 88.5 59 82.5 60 70.0 61 69.0 62 63.0 63 58.5 64 56.0 65 58.5 66 58.5 67 52.0 68 48.0 69 42.5 70 36.5 71 32.0 72 22.0 73 16.0 74 15.5 75 10.5 76 8.0 77 6.0 78 3.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.15 3 0.15 4 0.15 5 0.15 6 0.1 7 0.1 8 0.1 9 0.1 10-11 0.13749999999999998 12-13 0.15 14-15 0.1625 16-17 0.1625 18-19 0.15 20-21 0.125 22-23 0.1 24-25 0.1 26-27 0.1 28-29 0.1 30-31 0.125 32-33 0.11249999999999999 34-35 0.1 36-37 0.05 38-39 0.075 40-41 0.125 42-43 0.1 44-45 0.125 46-47 0.11249999999999999 48-49 0.13749999999999998 50-51 0.15 52-53 0.13749999999999998 54-55 0.15 56-57 0.15 58-59 0.125 60-61 0.13749999999999998 62-63 0.13749999999999998 64-65 0.1 66-67 0.1 68-69 0.025 70-71 0.0375 72-73 0.075 74-75 0.1 76-77 0.1 78-79 0.1 80-81 0.08750000000000001 82-83 0.13749999999999998 84-85 0.15 86-87 0.15 88-89 0.1625 90-91 0.15 92-93 0.15 94-95 0.13749999999999998 96-97 0.1625 98-99 0.1875 100-101 0.1875 102-103 0.1875 104-105 0.17500000000000002 106-107 0.15 108-109 0.1625 110-111 0.1625 112-113 0.17500000000000002 114-115 0.1875 116-117 0.1625 118-119 0.8875 120-121 0.8250000000000001 122-123 0.8250000000000001 124-125 0.8250000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.21250000000000002 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.30000000000000004 0.0 0.0 0.0 0.0 72-73 0.375 0.0 0.0 0.0 0.0 74-75 0.4375 0.0 0.0 0.0 0.0 76-77 0.55 0.0 0.0 0.0 0.0 78-79 0.675 0.0 0.0 0.0 0.0 80-81 0.8375 0.0 0.0 0.0 0.0 82-83 1.1375 0.0 0.0 0.0 0.0 84-85 1.4125 0.0 0.0 0.0 0.0 86-87 1.6625 0.0 0.0 0.0 0.0 88-89 1.9 0.0 0.0 0.0 0.0 90-91 2.3875 0.0 0.0 0.0 0.0 92-93 2.9125 0.0 0.0 0.0 0.0 94-95 3.55 0.0 0.0 0.0 0.0 96-97 4.1125 0.0 0.0 0.0 0.0 98-99 5.225 0.0 0.0 0.0 0.0 100-101 6.1875 0.0 0.0 0.0 0.0 102-103 7.324999999999999 0.0 0.0 0.0 0.0 104-105 8.7625 0.0 0.0 0.0 0.0 106-107 9.7625 0.0 0.0 0.0 0.0 108-109 11.475000000000001 0.0 0.0 0.0 0.0 110-111 13.2 0.0 0.0 0.0 0.0 112-113 15.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCGGAA 60 2.545769E-5 30.827923 118-119 AGATCGG 60 2.545769E-5 30.827923 116-117 >>END_MODULE SRR3691969 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691969_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.61675 34.0 33.0 34.0 32.0 34.0 2 33.15225 34.0 33.0 34.0 32.0 34.0 3 33.18825 34.0 33.0 34.0 32.0 34.0 4 33.192 34.0 33.0 34.0 32.0 34.0 5 33.26725 34.0 33.0 34.0 33.0 34.0 6 36.946 38.0 37.0 38.0 36.0 38.0 7 37.31625 38.0 38.0 38.0 37.0 38.0 8 37.43975 38.0 38.0 38.0 37.0 38.0 9 37.5505 38.0 38.0 38.0 38.0 38.0 10-11 37.480000000000004 38.0 38.0 38.0 38.0 38.0 12-13 37.50325 38.0 38.0 38.0 37.5 38.0 14-15 37.494249999999994 38.0 38.0 38.0 38.0 38.0 16-17 37.539375 38.0 38.0 38.0 38.0 38.0 18-19 37.436 38.0 38.0 38.0 37.0 38.0 20-21 37.400125 38.0 38.0 38.0 37.0 38.0 22-23 37.45975 38.0 38.0 38.0 37.5 38.0 24-25 37.397 38.0 38.0 38.0 37.5 38.0 26-27 37.48125 38.0 38.0 38.0 37.5 38.0 28-29 37.4025 38.0 38.0 38.0 37.0 38.0 30-31 37.45925 38.0 38.0 38.0 37.0 38.0 32-33 37.403375 38.0 38.0 38.0 37.5 38.0 34-35 37.3515 38.0 38.0 38.0 37.0 38.0 36-37 37.379125 38.0 38.0 38.0 37.0 38.0 38-39 37.312125 38.0 38.0 38.0 37.0 38.0 40-41 37.385625000000005 38.0 38.0 38.0 37.0 38.0 42-43 37.272875 38.0 38.0 38.0 37.0 38.0 44-45 37.291624999999996 38.0 38.0 38.0 37.0 38.0 46-47 37.2775 38.0 38.0 38.0 36.5 38.0 48-49 37.206125 38.0 38.0 38.0 36.5 38.0 50-51 37.223875 38.0 38.0 38.0 37.0 38.0 52-53 37.240125000000006 38.0 38.0 38.0 36.5 38.0 54-55 37.207625 38.0 38.0 38.0 37.0 38.0 56-57 37.199625 38.0 38.0 38.0 36.5 38.0 58-59 37.247625 38.0 38.0 38.0 37.0 38.0 60-61 37.20825 38.0 38.0 38.0 37.0 38.0 62-63 37.182 38.0 38.0 38.0 36.5 38.0 64-65 37.140625 38.0 38.0 38.0 36.0 38.0 66-67 37.151125 38.0 38.0 38.0 36.0 38.0 68-69 37.145375 38.0 38.0 38.0 36.0 38.0 70-71 37.025875 38.0 38.0 38.0 36.0 38.0 72-73 37.108875 38.0 38.0 38.0 36.0 38.0 74-75 37.17175 38.0 38.0 38.0 36.0 38.0 76-77 37.00975 38.0 38.0 38.0 36.0 38.0 78-79 37.03325 38.0 38.0 38.0 36.0 38.0 80-81 37.044875000000005 38.0 38.0 38.0 36.0 38.0 82-83 36.973124999999996 38.0 38.0 38.0 35.5 38.0 84-85 36.965999999999994 38.0 38.0 38.0 36.0 38.0 86-87 36.912 38.0 38.0 38.0 35.5 38.0 88-89 36.938375 38.0 38.0 38.0 35.5 38.0 90-91 36.691874999999996 38.0 38.0 38.0 34.5 38.0 92-93 36.83325 38.0 38.0 38.0 35.0 38.0 94-95 36.792500000000004 38.0 38.0 38.0 35.0 38.0 96-97 36.786249999999995 38.0 38.0 38.0 35.0 38.0 98-99 36.799125000000004 38.0 38.0 38.0 35.0 38.0 100-101 36.788124999999994 38.0 38.0 38.0 35.0 38.0 102-103 36.72225 38.0 38.0 38.0 34.5 38.0 104-105 36.616875 38.0 38.0 38.0 34.5 38.0 106-107 36.632625000000004 38.0 38.0 38.0 34.0 38.0 108-109 36.599375 38.0 38.0 38.0 34.0 38.0 110-111 36.669624999999996 38.0 38.0 38.0 34.0 38.0 112-113 36.61825 38.0 38.0 38.0 34.0 38.0 114-115 36.447375 38.0 38.0 38.0 34.0 38.0 116-117 36.410624999999996 38.0 38.0 38.0 34.0 38.0 118-119 36.350750000000005 38.0 38.0 38.0 34.0 38.0 120-121 36.434375 38.0 38.0 38.0 34.0 38.0 122-123 36.37125 38.0 38.0 38.0 34.0 38.0 124-125 36.329750000000004 38.0 38.0 38.0 34.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 1.0 23 1.0 24 7.0 25 6.0 26 10.0 27 20.0 28 14.0 29 34.0 30 28.0 31 48.0 32 57.0 33 60.0 34 91.0 35 161.0 36 337.0 37 3122.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 48.47864996164664 10.48325236512401 6.443364868320122 34.59473280490923 2 23.474999999999998 14.025000000000002 33.15 29.349999999999998 3 22.725 19.125 24.525 33.625 4 26.450000000000003 27.1 21.025 25.424999999999997 5 25.2 31.324999999999996 22.125 21.349999999999998 6 21.275 33.975 22.15 22.6 7 17.8 23.400000000000002 40.925 17.875 8 18.9 24.025 30.375000000000004 26.700000000000003 9 19.85 22.2 32.6 25.35 10-11 23.2875 30.912499999999998 22.9375 22.8625 12-13 23.1625 24.637500000000003 26.35 25.85 14-15 23.2625 25.474999999999998 26.875 24.3875 16-17 24.15 25.624999999999996 25.8 24.425 18-19 22.9625 26.1625 25.5375 25.337500000000002 20-21 23.325000000000003 25.6 25.724999999999998 25.35 22-23 23.025000000000002 26.7125 25.324999999999996 24.9375 24-25 23.0125 26.3125 25.25 25.424999999999997 26-27 22.5875 26.525 25.624999999999996 25.2625 28-29 22.575 26.0125 25.7125 25.7 30-31 22.525000000000002 25.874999999999996 25.7 25.900000000000002 32-33 22.8875 26.224999999999998 25.887500000000003 25.0 34-35 22.75 26.25 25.412499999999998 25.587500000000002 36-37 23.7125 25.900000000000002 25.25 25.137500000000003 38-39 22.912499999999998 25.362499999999997 26.0 25.724999999999998 40-41 23.375 25.275 25.924999999999997 25.424999999999997 42-43 23.575 25.2 25.35 25.874999999999996 44-45 23.0 26.1125 25.8 25.087500000000002 46-47 23.724999999999998 26.25 24.762500000000003 25.2625 48-49 23.25 26.387500000000003 25.924999999999997 24.4375 50-51 22.775000000000002 27.250000000000004 24.337500000000002 25.637500000000003 52-53 23.3125 26.6125 25.587500000000002 24.4875 54-55 22.925 25.8 25.337500000000002 25.937500000000004 56-57 23.5 25.650000000000002 25.087500000000002 25.7625 58-59 23.9 25.3125 25.775 25.0125 60-61 23.6125 25.4875 26.224999999999998 24.675 62-63 23.9125 25.7125 25.275 25.1 64-65 23.45 25.35 25.887500000000003 25.3125 66-67 23.1125 25.75 24.725 26.4125 68-69 23.375 25.15 25.95 25.525 70-71 24.099999999999998 25.387500000000003 25.650000000000002 24.8625 72-73 23.275000000000002 26.337500000000002 24.7 25.687500000000004 74-75 23.7875 25.374999999999996 24.75 26.087500000000002 76-77 23.625 26.275 25.2125 24.887500000000003 78-79 23.3 25.374999999999996 25.5 25.825 80-81 22.6875 25.8625 25.5625 25.887500000000003 82-83 23.5125 26.35 24.762500000000003 25.374999999999996 84-85 22.8875 25.662499999999998 25.825 25.624999999999996 86-87 24.05 25.074999999999996 24.75 26.125 88-89 24.5625 25.6 24.425 25.412499999999998 90-91 23.7 26.325 24.9125 25.0625 92-93 24.625 25.4625 24.4875 25.424999999999997 94-95 22.9625 25.674999999999997 24.525 26.8375 96-97 24.4 25.0125 24.7 25.887500000000003 98-99 24.8625 26.35 23.95 24.837500000000002 100-101 24.825 25.7125 25.25 24.212500000000002 102-103 24.625 25.8625 23.6375 25.874999999999996 104-105 24.6125 26.424999999999997 23.7875 25.174999999999997 106-107 23.7 26.9125 24.4125 24.975 108-109 24.875 25.8125 24.3125 25.0 110-111 24.85 26.2875 23.5375 25.324999999999996 112-113 24.75 27.5875 22.3 25.362499999999997 114-115 24.3625 26.825 22.8875 25.924999999999997 116-117 24.15 27.6 23.225 25.025 118-119 24.5375 27.487499999999997 23.05 24.925 120-121 25.15 27.187499999999996 22.2625 25.4 122-123 24.825 27.224999999999998 22.787499999999998 25.162499999999998 124-125 24.3875 27.2625 22.35 26.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.5 25 2.5 26 1.5 27 3.0 28 6.0 29 6.5 30 10.5 31 17.0 32 19.5 33 29.5 34 39.5 35 46.0 36 55.5 37 73.5 38 100.0 39 113.5 40 120.0 41 149.0 42 175.0 43 174.5 44 197.5 45 217.5 46 191.5 47 177.0 48 186.0 49 184.0 50 151.0 51 121.5 52 113.5 53 126.5 54 123.5 55 97.0 56 80.0 57 72.0 58 74.5 59 66.0 60 68.0 61 74.0 62 61.0 63 50.5 64 51.5 65 52.5 66 53.5 67 48.0 68 41.5 69 40.5 70 31.5 71 25.5 72 25.5 73 15.5 74 8.5 75 7.0 76 5.5 77 4.0 78 3.0 79 4.5 80 2.5 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11683068382538 98.2 2 0.8327024981074944 1.6500000000000001 3 0.05046681806712087 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.1875 0.0 0.0 0.0 0.0 68-69 0.21250000000000002 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.35 0.0 0.0 0.0 0.0 74-75 0.4125 0.0 0.0 0.0 0.0 76-77 0.525 0.0 0.0 0.0 0.0 78-79 0.65 0.0 0.0 0.0 0.0 80-81 0.7875 0.0 0.0 0.0 0.0 82-83 1.0625 0.0 0.0 0.0 0.0 84-85 1.2999999999999998 0.0 0.0 0.0 0.0 86-87 1.5125 0.0 0.0 0.0 0.0 88-89 1.775 0.0 0.0 0.0 0.0 90-91 2.2750000000000004 0.0 0.0 0.0 0.0 92-93 2.8875 0.0 0.0 0.0 0.0 94-95 3.55 0.0 0.0 0.0 0.0 96-97 4.1 0.0 0.0 0.0 0.0 98-99 5.2 0.0 0.0 0.0 0.0 100-101 6.1625 0.0 0.0 0.0 0.0 102-103 7.3 0.0 0.0 0.0 0.0 104-105 8.725000000000001 0.0 0.0 0.0 0.0 106-107 9.825 0.0 0.0 0.0 0.0 108-109 11.55 0.0 0.0 0.0 0.0 110-111 13.45 0.0 0.0 0.0 0.0 112-113 15.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCGGAA 65 1.4713733E-6 32.031734 118-119 AGATCGG 65 1.4713733E-6 32.031734 116-117 GATCGGA 65 0.0018828106 22.879808 118-119 >>END_MODULE Read 1149063 spots for SRR3691969.sra Written 1149063 spots for SRR3691969.sra Read 1149063 spots for SRR3691969.sra Written 1149063 spots for SRR3691969.sra Read 1149063 spots for SRR3691969.sra Written 1149063 spots for SRR3691969.sra Read 1149063 spots for SRR3691969.sra Written 1149063 spots for SRR3691969.sra Read 1149063 spots for SRR3691969.sra Written 1149063 spots for SRR3691969.sra Read 1149063 spots for SRR3691969.sra Written 1149063 spots for SRR3691969.sra Read 1149063 spots for SRR3691969.sra Written 1149063 spots for SRR3691969.sra Read 1149074 spots for SRR3691969.sra Written 1149074 spots for SRR3691969.sra Read 1149063 spots for SRR3691969.sra Written 1149063 spots for SRR3691969.sra Read 1149063 spots for SRR3691969.sra Written 1149063 spots for SRR3691969.sra Read 1149063 spots for SRR3691969.sra Written 1149063 spots for SRR3691969.sra Read 1149063 spots for SRR3691969.sra Written 1149063 spots for SRR3691969.sra Read 1149063 spots for SRR3691969.sra Written 1149063 spots for SRR3691969.sra Read 1149063 spots for SRR3691969.sra Written 1149063 spots for SRR3691969.sra Read 1149063 spots for SRR3691969.sra Written 1149063 spots for SRR3691969.sra Read 1149063 spots for SRR3691969.sra Written 1149063 spots for SRR3691969.sra Read 1149063 spots for SRR3691969.sra Written 1149063 spots for SRR3691969.sra Read 1149063 spots for SRR3691969.sra Written 1149063 spots for SRR3691969.sra Read 1149063 spots for SRR3691969.sra Written 1149063 spots for SRR3691969.sra Read 1149063 spots for SRR3691969.sra Written 1149063 spots for SRR3691969.sra SRR ids: ['SRR3691969.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cz_pk7nt SRR3691969.sra spots: 22981271 blocks: [[1, 1149063], [1149064, 2298126], [2298127, 3447189], [3447190, 4596252], [4596253, 5745315], [5745316, 6894378], [6894379, 8043441], [8043442, 9192504], [9192505, 10341567], [10341568, 11490630], [11490631, 12639693], [12639694, 13788756], [13788757, 14937819], [14937820, 16086882], [16086883, 17235945], [17235946, 18385008], [18385009, 19534071], [19534072, 20683134], [20683135, 21832197], [21832198, 22981271]] SRR3691969 file size 7316338 SRR3691969 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3691969 SRR3691969_1.fastq SRR3691969_2.fastq Input file: SRR3691969_1.fastq Paired file: SRR3691969_2.fastq trimmed: SRR3691969-trimmed-pair1.fastq, SRR3691969-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:12:29 2024 >> started Tue Dec 10 00:12:54 2024 >> done (24.882s) 22981271 read pairs processed; of these: 4 ( 0.00%) short read pairs filtered out after trimming by size control 913 ( 0.00%) empty read pairs filtered out after trimming by size control 22980354 (100.00%) read pairs available; of these: 3332899 (14.50%) trimmed read pairs available after processing 19647455 (85.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 80 29 0.00% 81 126 0.00% 82 45 0.00% 83 5 0.00% 84 0 0.00% 85 0 0.00% 86 0 0.00% 87 0 0.00% 88 0 0.00% 89 0 0.00% 90 0 0.00% 91 0 0.00% 92 0 0.00% 93 0 0.00% 94 0 0.00% 95 3 0.00% 96 64 0.00% 97 59 0.00% 98 28 0.00% 99 450 0.00% 100 671 0.00% 101 586 0.00% 102 426 0.00% 103 1266 0.01% 104 278 0.00% 105 1814 0.01% 106 17 0.00% 107 2 0.00% 108 41 0.00% 109 658 0.00% 110 2368 0.01% 111 22302 0.10% 112 220094 0.96% 113 226994 0.99% 114 236308 1.03% 115 246431 1.07% 116 251488 1.09% 117 255589 1.11% 118 256974 1.12% 119 255060 1.11% 120 258301 1.12% 121 295037 1.28% 122 260279 1.13% 123 266680 1.16% 124 272426 1.19% 125 19647455 85.50% 22980354 reads passed initial QC criterion=sequence-density sequence-density=14.39 sequence-density-rank=1 fanout-score=33.58 fanout-score-rank=1 prefix-density=14.53 prefix-fanout=33.3 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA criterion=fanout-score sequence-density=14.39 sequence-density-rank=1 fanout-score=33.58 fanout-score-rank=1 prefix-density=14.53 prefix-fanout=33.3 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA criterion=sequence-density sequence-density=14.56 sequence-density-rank=1 fanout-score=41.45 fanout-score-rank=1 prefix-density=14.61 prefix-fanout=41.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=14.56 sequence-density-rank=1 fanout-score=41.45 fanout-score-rank=1 prefix-density=14.61 prefix-fanout=41.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -y AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3691969 SRR3691969_1.fastq SRR3691969_2.fastq Input file: SRR3691969_1.fastq Paired file: SRR3691969_2.fastq trimmed: SRR3691969-trimmed-pair1.fastq, SRR3691969-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:15:03 2024 >> started Tue Dec 10 00:15:28 2024 >> done (24.291s) 19916307 read pairs processed; of these: 215 ( 0.00%) short read pairs filtered out after trimming by size control 3871 ( 0.02%) empty read pairs filtered out after trimming by size control 19912221 (99.98%) read pairs available; of these: 3074126 (15.44%) trimmed read pairs available after processing 16838095 (84.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 5 0.00% 21 4 0.00% 22 3 0.00% 23 7 0.00% 24 5 0.00% 25 7 0.00% 26 16 0.00% 27 17 0.00% 28 11 0.00% 29 23 0.00% 30 26 0.00% 31 24 0.00% 32 33 0.00% 33 43 0.00% 34 59 0.00% 35 65 0.00% 36 65 0.00% 37 91 0.00% 38 108 0.00% 39 111 0.00% 40 138 0.00% 41 157 0.00% 42 194 0.00% 43 190 0.00% 44 202 0.00% 45 233 0.00% 46 247 0.00% 47 347 0.00% 48 404 0.00% 49 484 0.00% 50 613 0.00% 51 699 0.00% 52 692 0.00% 53 739 0.00% 54 844 0.00% 55 882 0.00% 56 968 0.00% 57 1156 0.01% 58 1374 0.01% 59 1497 0.01% 60 1769 0.01% 61 2086 0.01% 62 2405 0.01% 63 2720 0.01% 64 2859 0.01% 65 3319 0.02% 66 3445 0.02% 67 3983 0.02% 68 4342 0.02% 69 5067 0.03% 70 5789 0.03% 71 6592 0.03% 72 7912 0.04% 73 9042 0.05% 74 9854 0.05% 75 11195 0.06% 76 12226 0.06% 77 13175 0.07% 78 14456 0.07% 79 16346 0.08% 80 18469 0.09% 81 21014 0.11% 82 24028 0.12% 83 27407 0.14% 84 30757 0.15% 85 34175 0.17% 86 37325 0.19% 87 40204 0.20% 88 44001 0.22% 89 47638 0.24% 90 51621 0.26% 91 56813 0.29% 92 63047 0.32% 93 69748 0.35% 94 76840 0.39% 95 83364 0.42% 96 89629 0.45% 97 95785 0.48% 98 100301 0.50% 99 105870 0.53% 100 113325 0.57% 101 118232 0.59% 102 127317 0.64% 103 137114 0.69% 104 144059 0.72% 105 154312 0.77% 106 160872 0.81% 107 165150 0.83% 108 170669 0.86% 109 176662 0.89% 110 179917 0.90% 111 183679 0.92% 112 190887 0.96% 113 196797 0.99% 114 204664 1.03% 115 213555 1.07% 116 217540 1.09% 117 221235 1.11% 118 222511 1.12% 119 221054 1.11% 120 223842 1.12% 121 249899 1.26% 122 225569 1.13% 123 231291 1.16% 124 235613 1.18% 125 13957048 70.09% criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=34 prefix-density=0.16 prefix-fanout=2.2 sequence=TGCATGTACGTAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=163.72 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=21.6 sequence=CAAGAAGAAGGT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=34 prefix-density=0.17 prefix-fanout=2.0 sequence=GTATTTAGCCTTGGACGGAGTCTACCGCCCGATTTGGGCTGCATTCCCAAACAACCCGACTCGTTGACGGCGCCTCGTGGGGCGACAGGGTCCGGGCCGGACGGGGCTCTCACCCTCCCAGGCGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGTCGCTGAGGACGCCTCTCCAGACTACAATTCGGACGGCACGGCCGCCCGATTCTCAAGCTGGGCTGCTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTCTCCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=292.95 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=17.2 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC SRR3691969 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:16:22 Started mapping on | Dec 10 00:16:22 Finished on | Dec 10 00:18:03 Mapping speed, Million of reads per hour | 818.96 Number of input reads | 22976268 Average input read length | 241 UNIQUE READS: Uniquely mapped reads number | 21174918 Uniquely mapped reads % | 92.16% Average mapped length | 239.94 Number of splices: Total | 15090259 Number of splices: Annotated (sjdb) | 14163940 Number of splices: GT/AG | 14871284 Number of splices: GC/AG | 184112 Number of splices: AT/AC | 7769 Number of splices: Non-canonical | 27094 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.06 Insertion rate per base | 0.01% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 508072 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 85118 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.83% % of reads unmapped: other | 1.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1293405 1293405 1293405 N_multimapping 508072 508072 508072 N_noFeature 978636 1253840 20465569 N_ambiguous 495382 61424 2319 UnstrandedReadsAssigned:19700900 PositiveStrandReadsAssigned:19859654 NegativeStrandReadsAssigned:707030 Dataset is classified positive stranded MeadianReadLen=125 20thPercentileLength=116 echo kmer=111 SRR3691969 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3691969-trimmed-pair1.fastq SRR3691969-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,976,268 reads, 20,354,491 reads pseudoaligned [quant] estimated average fragment length: 148.385 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,202 rounds 52973 SRR3691969.ke.tsv 35125 SRR3691969.se.tsv 88098 total ==> SRR3691969.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 788.748 0 0 PNS24247 1044 896.615 77.7384 6.38914 PNS24249 1928 1780.62 152.286 6.30234 PNS24246 1044 896.615 77.7384 6.38914 PNS24248 1044 896.615 77.7384 6.38914 PNS24244 1471 1323.62 205.499 11.4409 PNS24243 293 148.038 0 0 KQK14069 1603 1455.62 42661.5 2159.75 KQK14071 474 327.831 2152.71 483.892 ==> SRR3691969.se.tsv <== BRADI_1g14170v3 49008 BRADI_1g53295v3 37 BRADI_1g59795v3 1605 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 240 BRADI_1g74790v3 176 BRADI_1g09890v3 0 BRADI_1g77505v3 328 BRADI_1g48960v3 0 SRR3691969 completed mapping pipeline successfully