Starting /dee2/code/volunteer_pipeline.sh SRR3691980 current disk space = 1523467882496 free memory = 1567166772 SRR3691980 SRAfilesize 28dc7200829ac8deb96e287fba490c85 SRR3691980.sra SRR3691980.sra file validated SRR3691980 is paired end SRR3691980 is conventional basespace SRR3691980 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691980_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.706 34.0 33.0 34.0 32.0 34.0 2 33.10125 34.0 33.0 34.0 32.0 34.0 3 33.1405 34.0 33.0 34.0 32.0 34.0 4 33.179 34.0 33.0 34.0 32.0 34.0 5 33.24475 34.0 33.0 34.0 32.0 34.0 6 36.85325 38.0 37.0 38.0 35.0 38.0 7 37.32925 38.0 38.0 38.0 37.0 38.0 8 37.49625 38.0 38.0 38.0 37.0 38.0 9 37.51625 38.0 38.0 38.0 38.0 38.0 10-11 37.5015 38.0 38.0 38.0 38.0 38.0 12-13 37.420125 38.0 38.0 38.0 37.5 38.0 14-15 37.403000000000006 38.0 38.0 38.0 37.0 38.0 16-17 37.488125 38.0 38.0 38.0 38.0 38.0 18-19 37.419875000000005 38.0 38.0 38.0 37.5 38.0 20-21 37.435125 38.0 38.0 38.0 37.0 38.0 22-23 37.470625 38.0 38.0 38.0 38.0 38.0 24-25 37.381125 38.0 38.0 38.0 37.0 38.0 26-27 37.39 38.0 38.0 38.0 37.0 38.0 28-29 37.354124999999996 38.0 38.0 38.0 37.0 38.0 30-31 37.299875 38.0 38.0 38.0 37.0 38.0 32-33 37.325 38.0 38.0 38.0 37.0 38.0 34-35 37.340374999999995 38.0 38.0 38.0 37.0 38.0 36-37 37.33375 38.0 38.0 38.0 37.0 38.0 38-39 37.295 38.0 38.0 38.0 37.0 38.0 40-41 37.230999999999995 38.0 38.0 38.0 37.0 38.0 42-43 37.201 38.0 38.0 38.0 37.0 38.0 44-45 37.192875 38.0 38.0 38.0 37.0 38.0 46-47 37.14025 38.0 38.0 38.0 37.0 38.0 48-49 37.1365 38.0 38.0 38.0 36.0 38.0 50-51 37.195375 38.0 38.0 38.0 37.0 38.0 52-53 37.163624999999996 38.0 38.0 38.0 36.5 38.0 54-55 37.151125 38.0 38.0 38.0 36.0 38.0 56-57 37.1005 38.0 38.0 38.0 36.0 38.0 58-59 37.096875 38.0 38.0 38.0 36.0 38.0 60-61 37.17575 38.0 38.0 38.0 36.0 38.0 62-63 37.083375000000004 38.0 38.0 38.0 36.0 38.0 64-65 37.047875 38.0 38.0 38.0 36.0 38.0 66-67 37.1385 38.0 38.0 38.0 36.0 38.0 68-69 37.132125 38.0 38.0 38.0 36.0 38.0 70-71 37.05225 38.0 38.0 38.0 36.0 38.0 72-73 37.070875 38.0 38.0 38.0 36.0 38.0 74-75 37.0865 38.0 38.0 38.0 36.0 38.0 76-77 37.06425 38.0 38.0 38.0 36.0 38.0 78-79 37.044124999999994 38.0 38.0 38.0 36.0 38.0 80-81 36.992875 38.0 38.0 38.0 36.0 38.0 82-83 36.94375 38.0 38.0 38.0 35.5 38.0 84-85 36.942 38.0 38.0 38.0 35.0 38.0 86-87 36.843125 38.0 38.0 38.0 35.0 38.0 88-89 36.837875 38.0 38.0 38.0 35.0 38.0 90-91 36.620374999999996 38.0 38.0 38.0 34.5 38.0 92-93 36.809625 38.0 38.0 38.0 35.0 38.0 94-95 36.629875 38.0 38.0 38.0 34.0 38.0 96-97 36.70025 38.0 38.0 38.0 35.0 38.0 98-99 36.689625 38.0 38.0 38.0 35.0 38.0 100-101 36.71325 38.0 38.0 38.0 35.0 38.0 102-103 36.649875 38.0 38.0 38.0 34.5 38.0 104-105 36.5975 38.0 38.0 38.0 34.0 38.0 106-107 36.5775 38.0 38.0 38.0 34.0 38.0 108-109 36.57825 38.0 38.0 38.0 34.0 38.0 110-111 36.668625000000006 38.0 38.0 38.0 34.5 38.0 112-113 36.611125 38.0 38.0 38.0 34.0 38.0 114-115 36.45375 38.0 38.0 38.0 34.0 38.0 116-117 36.332499999999996 38.0 38.0 38.0 34.0 38.0 118-119 36.3455 38.0 38.0 38.0 34.0 38.0 120-121 36.293375 38.0 38.0 38.0 34.0 38.0 122-123 36.329 38.0 38.0 38.0 34.0 38.0 124-125 36.2355 38.0 38.0 38.0 33.5 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 2.0 23 8.0 24 3.0 25 8.0 26 13.0 27 23.0 28 19.0 29 23.0 30 42.0 31 47.0 32 50.0 33 58.0 34 110.0 35 148.0 36 353.0 37 3090.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 54.25803161652218 8.61805201427843 6.4507904130545635 30.673125956144826 2 25.275 11.05 33.2 30.475 3 23.225 18.475 23.474999999999998 34.825 4 29.125 24.05 22.7 24.125 5 26.35 29.349999999999998 22.925 21.375 6 21.875 30.599999999999998 24.625 22.900000000000002 7 17.275 24.075 42.3 16.35 8 19.025 24.25 31.05 25.674999999999997 9 20.25 21.95 33.875 23.925 10-11 23.625 30.6375 24.5 21.2375 12-13 23.474999999999998 24.425 27.975 24.125 14-15 22.8625 26.075 27.1375 23.925 16-17 22.4875 26.674999999999997 25.1 25.7375 18-19 23.2875 25.8625 25.7375 25.112499999999997 20-21 24.762500000000003 26.950000000000003 24.925 23.3625 22-23 22.375 26.237500000000004 26.424999999999997 24.962500000000002 24-25 23.7 25.7 25.887500000000003 24.712500000000002 26-27 23.5125 25.424999999999997 25.412499999999998 25.650000000000002 28-29 23.5 25.337500000000002 25.7625 25.4 30-31 23.375 26.150000000000002 24.85 25.624999999999996 32-33 23.400000000000002 26.275 25.387500000000003 24.9375 34-35 22.9875 25.25 25.5625 26.200000000000003 36-37 23.7875 25.912499999999998 25.8 24.5 38-39 23.2375 25.900000000000002 25.587500000000002 25.275 40-41 23.125 26.1 25.174999999999997 25.6 42-43 23.6875 25.45 25.174999999999997 25.687500000000004 44-45 22.25 25.2875 26.387500000000003 26.075 46-47 22.662499999999998 26.4625 25.662499999999998 25.2125 48-49 23.3 25.912499999999998 25.624999999999996 25.162499999999998 50-51 22.275 26.025 26.125 25.575 52-53 23.75 26.224999999999998 25.2875 24.7375 54-55 24.15 25.2625 25.174999999999997 25.412499999999998 56-57 22.537499999999998 25.5625 26.387500000000003 25.5125 58-59 23.9875 25.6125 24.7375 25.662499999999998 60-61 25.3125 25.7625 24.75 24.175 62-63 23.75 25.4625 25.2125 25.575 64-65 23.0125 26.2875 25.825 24.875 66-67 24.025 25.85 24.462500000000002 25.662499999999998 68-69 23.3625 25.324999999999996 25.8125 25.5 70-71 23.5875 26.35 25.35 24.712500000000002 72-73 23.5125 25.6 25.3 25.587500000000002 74-75 23.799999999999997 25.662499999999998 25.275 25.2625 76-77 24.525 25.7375 25.45 24.2875 78-79 23.6375 26.1 24.275 25.9875 80-81 23.674999999999997 26.487500000000004 24.637500000000003 25.2 82-83 24.212500000000002 25.7125 24.85 25.224999999999998 84-85 23.2375 25.0 26.1125 25.650000000000002 86-87 24.375 26.1 25.424999999999997 24.099999999999998 88-89 24.1125 26.200000000000003 24.9125 24.775 90-91 24.837500000000002 25.924999999999997 24.325 24.9125 92-93 24.275 25.674999999999997 24.837500000000002 25.2125 94-95 23.875 25.75 25.387500000000003 24.9875 96-97 23.7625 25.587500000000002 24.075 26.575 98-99 24.462500000000002 26.437500000000004 24.462500000000002 24.637500000000003 100-101 24.725 26.174999999999997 24.637500000000003 24.462500000000002 102-103 25.1875 25.5 24.0625 25.25 104-105 24.2875 26.275 24.3875 25.05 106-107 25.137500000000003 26.3 23.6625 24.9 108-109 24.375 26.6625 23.5125 25.45 110-111 25.362499999999997 26.075 23.974999999999998 24.587500000000002 112-113 25.162499999999998 27.737499999999997 23.0125 24.087500000000002 114-115 24.875 27.9375 22.6875 24.5 116-117 24.0625 27.237499999999997 23.0875 25.6125 118-119 25.074999999999996 27.187499999999996 22.400000000000002 25.337500000000002 120-121 25.362499999999997 27.725 22.400000000000002 24.5125 122-123 25.4 27.0875 22.1875 25.324999999999996 124-125 24.7875 28.1 21.712500000000002 25.4 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.5 25 2.5 26 1.5 27 2.5 28 4.5 29 5.0 30 9.5 31 17.5 32 23.5 33 28.0 34 27.5 35 47.0 36 72.0 37 79.5 38 86.5 39 108.0 40 133.5 41 163.5 42 177.0 43 174.0 44 182.0 45 200.0 46 201.0 47 186.0 48 184.5 49 170.0 50 141.5 51 122.0 52 117.5 53 114.5 54 112.0 55 112.5 56 99.0 57 89.0 58 77.0 59 67.5 60 69.5 61 64.0 62 58.5 63 53.5 64 51.5 65 44.0 66 42.0 67 48.0 68 45.5 69 41.0 70 33.5 71 23.0 72 19.0 73 15.0 74 12.0 75 11.5 76 8.5 77 5.5 78 3.5 79 2.0 80 1.5 81 1.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16771752837327 98.3 2 0.7818411097099622 1.55 3 0.05044136191677175 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.07500000000000001 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.4 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.65 0.0 0.0 0.0 0.0 80-81 0.8999999999999999 0.0 0.0 0.0 0.0 82-83 1.15 0.0 0.0 0.0 0.0 84-85 1.3625 0.0 0.0 0.0 0.0 86-87 1.7 0.0 0.0 0.0 0.0 88-89 2.025 0.0 0.0 0.0 0.0 90-91 2.6125 0.0 0.0 0.0 0.0 92-93 3.2625 0.0 0.0 0.0 0.0 94-95 3.8625 0.0 0.0 0.0 0.0 96-97 4.525 0.0 0.0 0.0 0.0 98-99 5.3875 0.0 0.0 0.0 0.0 100-101 6.35 0.0 0.0 0.0 0.0 102-103 7.4875 0.0 0.0 0.0 0.0 104-105 8.7375 0.0 0.0 0.0 0.0 106-107 10.2 0.0 0.0 0.0 0.0 108-109 11.7375 0.0 0.0 0.0 0.0 110-111 13.4375 0.0 0.0 0.0 0.0 112-113 15.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3691980 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691980_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71975 33.0 33.0 34.0 32.0 34.0 2 32.76625 34.0 33.0 34.0 32.0 34.0 3 32.77425 34.0 33.0 34.0 32.0 34.0 4 32.6125 34.0 33.0 34.0 32.0 34.0 5 32.63775 34.0 33.0 34.0 32.0 34.0 6 36.76 38.0 38.0 38.0 36.0 38.0 7 36.79775 38.0 38.0 38.0 36.0 38.0 8 36.882 38.0 38.0 38.0 36.0 38.0 9 36.93975 38.0 38.0 38.0 36.0 38.0 10-11 36.832 38.0 38.0 38.0 36.0 38.0 12-13 36.744625 38.0 38.0 38.0 36.0 38.0 14-15 36.786375 38.0 38.0 38.0 36.0 38.0 16-17 36.753 38.0 38.0 38.0 36.0 38.0 18-19 36.749125 38.0 38.0 38.0 35.5 38.0 20-21 36.863125 38.0 38.0 38.0 36.0 38.0 22-23 36.703374999999994 38.0 38.0 38.0 35.5 38.0 24-25 36.756125 38.0 38.0 38.0 35.5 38.0 26-27 36.787625 38.0 38.0 38.0 35.5 38.0 28-29 36.82525 38.0 38.0 38.0 36.0 38.0 30-31 36.85575 38.0 38.0 38.0 36.0 38.0 32-33 36.783625 38.0 38.0 38.0 36.0 38.0 34-35 36.816625 38.0 38.0 38.0 36.0 38.0 36-37 36.786 38.0 38.0 38.0 35.5 38.0 38-39 36.817875 38.0 38.0 38.0 36.0 38.0 40-41 36.819625 38.0 38.0 38.0 36.0 38.0 42-43 36.801249999999996 38.0 38.0 38.0 36.0 38.0 44-45 36.82625 38.0 38.0 38.0 36.0 38.0 46-47 36.777625 38.0 38.0 38.0 36.0 38.0 48-49 36.7975 38.0 38.0 38.0 36.0 38.0 50-51 36.7715 38.0 38.0 38.0 36.0 38.0 52-53 36.7225 38.0 38.0 38.0 36.0 38.0 54-55 36.649875 38.0 38.0 38.0 35.0 38.0 56-57 36.6865 38.0 38.0 38.0 35.0 38.0 58-59 36.687749999999994 38.0 38.0 38.0 35.5 38.0 60-61 36.707499999999996 38.0 38.0 38.0 35.5 38.0 62-63 36.743875 38.0 38.0 38.0 35.5 38.0 64-65 36.719125000000005 38.0 38.0 38.0 35.0 38.0 66-67 36.65175 38.0 38.0 38.0 35.0 38.0 68-69 36.5385 38.0 38.0 38.0 35.0 38.0 70-71 36.535124999999994 38.0 38.0 38.0 34.5 38.0 72-73 36.635875 38.0 38.0 38.0 35.0 38.0 74-75 36.4925 38.0 38.0 38.0 34.5 38.0 76-77 36.50575 38.0 38.0 38.0 35.0 38.0 78-79 36.522999999999996 38.0 38.0 38.0 35.0 38.0 80-81 36.526875 38.0 38.0 38.0 35.0 38.0 82-83 36.522000000000006 38.0 38.0 38.0 34.5 38.0 84-85 36.365625 38.0 38.0 38.0 34.0 38.0 86-87 36.41125 38.0 38.0 38.0 34.0 38.0 88-89 36.434 38.0 38.0 38.0 34.0 38.0 90-91 36.408500000000004 38.0 38.0 38.0 34.0 38.0 92-93 36.301375 38.0 38.0 38.0 34.0 38.0 94-95 36.213 38.0 38.0 38.0 34.0 38.0 96-97 36.3035 38.0 38.0 38.0 34.0 38.0 98-99 36.154125 38.0 38.0 38.0 33.5 38.0 100-101 36.179375 38.0 38.0 38.0 34.0 38.0 102-103 36.153375 38.0 38.0 38.0 34.0 38.0 104-105 36.15425 38.0 38.0 38.0 33.5 38.0 106-107 36.137 38.0 38.0 38.0 33.5 38.0 108-109 35.88525 38.0 38.0 38.0 32.0 38.0 110-111 35.82175 38.0 37.5 38.0 31.5 38.0 112-113 35.7955 38.0 38.0 38.0 31.0 38.0 114-115 35.682375 38.0 37.5 38.0 31.0 38.0 116-117 35.5505 38.0 37.5 38.0 30.0 38.0 118-119 35.181 38.0 36.5 38.0 28.0 38.0 120-121 35.064750000000004 38.0 36.0 38.0 27.0 38.0 122-123 35.051874999999995 38.0 36.0 38.0 28.0 38.0 124-125 34.882000000000005 38.0 36.0 38.0 25.5 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 12.0 17 20.0 18 21.0 19 15.0 20 11.0 21 11.0 22 8.0 23 5.0 24 15.0 25 14.0 26 23.0 27 17.0 28 23.0 29 36.0 30 39.0 31 42.0 32 61.0 33 67.0 34 103.0 35 179.0 36 359.0 37 2917.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.900878293601004 19.623588456712675 8.707653701380176 24.767879548306148 2 26.82011508631474 22.54190642982237 31.49862396797598 19.139354515886914 3 23.942957217913435 25.068801601200903 28.246184638478862 22.742056542406804 4 26.581645411352838 30.23255813953488 20.10502625656414 23.080770192548137 5 27.070302727045288 33.17488116087065 20.365273955466602 19.389542156617463 6 22.80570142535634 33.65841460365091 20.78019504876219 22.755688922230558 7 22.075 19.375 33.975 24.575 8 22.400000000000002 22.025 26.35 29.225 9 23.875 21.825 27.975 26.325 10-11 27.04426106526632 27.781945486371594 21.75543885971493 23.418354588647162 12-13 26.87593796898449 23.08654327163582 24.69984992496248 25.337668834417208 14-15 24.48392343300388 24.88427373952208 25.797572876266734 24.834229951207305 16-17 26.635806330539225 24.859251845364692 24.82171900412861 23.683222819967472 18-19 25.109416031011627 25.034387895460796 25.70964111541828 24.14655495810929 20-21 25.84396099024756 25.03125781445361 24.90622655663916 24.218554638659665 22-23 25.874999999999996 25.5625 24.087500000000002 24.474999999999998 24-25 25.525 24.775 24.8125 24.887500000000003 26-27 25.5625 25.624999999999996 24.837500000000002 23.974999999999998 28-29 26.437500000000004 24.55 25.0 24.0125 30-31 25.30316289536192 25.565695711963997 25.95324415551944 23.177897237154642 32-33 24.69058632329041 25.440680085010626 26.053256657082137 23.81547693461683 34-35 25.825 24.5625 25.087500000000002 24.525 36-37 24.8 25.587500000000002 24.85 24.762500000000003 38-39 25.2 24.4875 26.025 24.2875 40-41 25.690711338917367 25.51568946118265 24.603075384423054 24.190523815476936 42-43 25.0125 24.975 25.9875 24.025 44-45 25.353169146143266 24.765595699462434 25.51568946118265 24.36554569321165 46-47 25.30316289536192 25.403175396924617 25.103137892236532 24.190523815476936 48-49 24.60615153788447 26.431607901975497 25.431357839459867 23.53088272068017 50-51 25.062531265632813 26.050525262631314 24.712356178089045 24.174587293646823 52-53 25.950475237618807 24.987493746873437 25.587793896948476 23.47423711855928 54-55 25.550275137568786 25.625312656328163 25.6128064032016 23.21160580290145 56-57 24.884331624359135 25.409528573214956 26.409903713892707 23.296236088533202 58-59 26.253281660207527 24.765595699462434 25.315664458057256 23.665458182272783 60-61 25.70642660665166 25.29382345586397 25.318829707426854 23.680920230057513 62-63 24.568642160540136 25.593898474618655 25.456364091022753 24.381095273818453 64-65 24.95 25.2375 25.474999999999998 24.337500000000002 66-67 25.5375 24.5125 26.0125 23.9375 68-69 24.6875 25.2625 25.4625 24.587500000000002 70-71 25.650000000000002 25.724999999999998 25.2375 23.3875 72-73 25.2 25.5125 26.0 23.2875 74-75 25.45 25.3125 25.387500000000003 23.849999999999998 76-77 25.45 24.7 26.075 23.775 78-79 25.074999999999996 25.337500000000002 25.8625 23.724999999999998 80-81 24.49056132016502 26.60332541567696 25.640705088136016 23.265408176022003 82-83 25.65032516258129 25.387693846923458 25.950475237618807 23.011505752876438 84-85 25.912956478239117 24.949974987493746 25.962981490745374 23.17408704352176 86-87 25.068801601200903 25.719289467100324 25.74430823117338 23.46760070052539 88-89 25.522332040535467 25.797572876266734 25.697485299637187 22.982609783560616 90-91 25.94445834375782 26.057042782086565 25.006254691018263 22.992244183137352 92-93 25.534575465799676 25.94723021132925 25.38451919469801 23.133675128173063 94-95 24.83741870935468 25.56278139069535 25.50025012506253 24.099549774887443 96-97 25.237737737737735 26.001001001001 25.563063063063062 23.1981981981982 98-99 25.957926371149508 25.519659403956922 25.219133483596295 23.303280741297268 100-101 25.425638457686528 25.776164246369554 25.17526289434151 23.622934401602404 102-103 26.464697045568354 25.901352028042062 24.661992989484226 22.97195793690536 104-105 26.2012012012012 26.33883883883884 24.86236236236236 22.597597597597595 106-107 26.725862931465734 26.475737868934466 24.099549774887443 22.698849424712357 108-109 27.90843132349262 25.856892669502123 24.380785589191895 21.85389041781336 110-111 26.886025272113102 27.524083573126486 24.146127861879144 21.443763292881272 112-113 27.606056813915654 27.380803403829308 22.75059441872106 22.262545363533974 114-115 27.963449743397174 27.925898109901116 23.056702966579046 21.053949180122668 116-117 28.812711122231953 26.17290128862755 23.87088702614788 21.143500562992617 118-119 28.481490808360615 27.146814404432135 22.966507177033492 21.40518761017376 120-121 29.72428553443283 27.080448193377816 22.875487850937933 20.319778421251417 122-123 28.83937562940584 27.50503524672709 22.658610271903324 20.996978851963746 124-125 29.573209114943978 27.76029208107768 22.799949641193503 19.866549162784843 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.5 16 1.0 17 1.0 18 0.5 19 1.0 20 2.0 21 1.0 22 0.0 23 2.0 24 2.0 25 2.5 26 5.0 27 5.5 28 7.5 29 7.0 30 6.5 31 11.0 32 14.5 33 20.0 34 32.0 35 46.5 36 60.5 37 73.0 38 82.5 39 101.0 40 124.0 41 148.5 42 169.0 43 173.5 44 177.0 45 198.0 46 216.5 47 190.5 48 156.5 49 150.0 50 153.5 51 138.5 52 125.5 53 130.5 54 118.5 55 97.5 56 79.0 57 78.0 58 83.0 59 80.0 60 76.0 61 69.0 62 62.5 63 59.5 64 56.5 65 50.0 66 51.0 67 47.0 68 40.5 69 43.5 70 39.0 71 28.5 72 20.5 73 14.5 74 15.5 75 16.5 76 11.0 77 6.0 78 4.0 79 3.0 80 1.5 81 1.0 82 1.0 83 0.0 84 1.0 85 1.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.075 3 0.075 4 0.025 5 0.075 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.025 12-13 0.05 14-15 0.08750000000000001 16-17 0.08750000000000001 18-19 0.0375 20-21 0.025 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0125 32-33 0.0125 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.0 44-45 0.0125 46-47 0.0125 48-49 0.025 50-51 0.05 52-53 0.05 54-55 0.05 56-57 0.0375 58-59 0.0125 60-61 0.025 62-63 0.025 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0125 82-83 0.05 84-85 0.05 86-87 0.075 88-89 0.08750000000000001 90-91 0.075 92-93 0.0375 94-95 0.05 96-97 0.1 98-99 0.17500000000000002 100-101 0.15 102-103 0.15 104-105 0.1 106-107 0.05 108-109 0.075 110-111 0.08750000000000001 112-113 0.11249999999999999 114-115 0.13749999999999998 116-117 0.08750000000000001 118-119 0.7250000000000001 120-121 0.7125 122-123 0.7000000000000001 124-125 0.7125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.42500000000000004 0.0 0.0 0.0 0.0 76-77 0.5125 0.0 0.0 0.0 0.0 78-79 0.6 0.0 0.0 0.0 0.0 80-81 0.8500000000000001 0.0 0.0 0.0 0.0 82-83 1.075 0.0 0.0 0.0 0.0 84-85 1.3 0.0 0.0 0.0 0.0 86-87 1.625 0.0 0.0 0.0 0.0 88-89 1.975 0.0 0.0 0.0 0.0 90-91 2.5625 0.0 0.0 0.0 0.0 92-93 3.1875 0.0 0.0 0.0 0.0 94-95 3.8125 0.0 0.0 0.0 0.0 96-97 4.525 0.0 0.0 0.0 0.0 98-99 5.3625 0.0 0.0 0.0 0.0 100-101 6.325 0.0 0.0 0.0 0.0 102-103 7.475 0.0 0.0 0.0 0.0 104-105 8.6875 0.0 0.0 0.0 0.0 106-107 10.1375 0.0 0.0 0.0 0.0 108-109 11.675 0.0 0.0 0.0 0.0 110-111 13.4 0.0 0.0 0.0 0.0 112-113 15.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 35 0.0026274757 34.0 104-105 >>END_MODULE Read 1165746 spots for SRR3691980.sra Written 1165746 spots for SRR3691980.sra Read 1165746 spots for SRR3691980.sra Written 1165746 spots for SRR3691980.sra Read 1165746 spots for SRR3691980.sra Written 1165746 spots for SRR3691980.sra Read 1165746 spots for SRR3691980.sra Written 1165746 spots for SRR3691980.sra Read 1165746 spots for SRR3691980.sra Written 1165746 spots for SRR3691980.sra Read 1165746 spots for SRR3691980.sra Written 1165746 spots for SRR3691980.sra Read 1165746 spots for SRR3691980.sra Written 1165746 spots for SRR3691980.sra Read 1165746 spots for SRR3691980.sra Written 1165746 spots for SRR3691980.sra Read 1165746 spots for SRR3691980.sra Written 1165746 spots for SRR3691980.sra Read 1165746 spots for SRR3691980.sra Written 1165746 spots for SRR3691980.sra Read 1165746 spots for SRR3691980.sra Written 1165746 spots for SRR3691980.sra Read 1165746 spots for SRR3691980.sra Written 1165746 spots for SRR3691980.sra Read 1165746 spots for SRR3691980.sra Written 1165746 spots for SRR3691980.sra Read 1165748 spots for SRR3691980.sra Written 1165748 spots for SRR3691980.sra Read 1165746 spots for SRR3691980.sra Written 1165746 spots for SRR3691980.sra Read 1165746 spots for SRR3691980.sra Written 1165746 spots for SRR3691980.sra Read 1165746 spots for SRR3691980.sra Written 1165746 spots for SRR3691980.sra Read 1165746 spots for SRR3691980.sra Written 1165746 spots for SRR3691980.sra Read 1165746 spots for SRR3691980.sra Written 1165746 spots for SRR3691980.sra Read 1165746 spots for SRR3691980.sra Written 1165746 spots for SRR3691980.sra SRR ids: ['SRR3691980.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_67uabmcm SRR3691980.sra spots: 23314922 blocks: [[1, 1165746], [1165747, 2331492], [2331493, 3497238], [3497239, 4662984], [4662985, 5828730], [5828731, 6994476], [6994477, 8160222], [8160223, 9325968], [9325969, 10491714], [10491715, 11657460], [11657461, 12823206], [12823207, 13988952], [13988953, 15154698], [15154699, 16320444], [16320445, 17486190], [17486191, 18651936], [18651937, 19817682], [19817683, 20983428], [20983429, 22149174], [22149175, 23314922]] SRR3691980 file size 7422721 SRR3691980 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3691980 SRR3691980_1.fastq SRR3691980_2.fastq Input file: SRR3691980_1.fastq Paired file: SRR3691980_2.fastq trimmed: SRR3691980-trimmed-pair1.fastq, SRR3691980-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:15:14 2024 >> started Tue Dec 10 00:15:39 2024 >> done (24.806s) 23314922 read pairs processed; of these: 213 ( 0.00%) short read pairs filtered out after trimming by size control 5533 ( 0.02%) empty read pairs filtered out after trimming by size control 23309176 (99.98%) read pairs available; of these: 6878762 (29.51%) trimmed read pairs available after processing 16430414 (70.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 9 0.00% 20 2 0.00% 21 8 0.00% 22 10 0.00% 23 2 0.00% 24 9 0.00% 25 6 0.00% 26 11 0.00% 27 12 0.00% 28 15 0.00% 29 24 0.00% 30 26 0.00% 31 28 0.00% 32 50 0.00% 33 44 0.00% 34 51 0.00% 35 62 0.00% 36 82 0.00% 37 89 0.00% 38 121 0.00% 39 154 0.00% 40 168 0.00% 41 190 0.00% 42 205 0.00% 43 230 0.00% 44 238 0.00% 45 290 0.00% 46 326 0.00% 47 409 0.00% 48 482 0.00% 49 582 0.00% 50 640 0.00% 51 774 0.00% 52 805 0.00% 53 903 0.00% 54 1025 0.00% 55 1115 0.00% 56 1196 0.01% 57 1378 0.01% 58 1600 0.01% 59 1880 0.01% 60 2139 0.01% 61 2481 0.01% 62 2916 0.01% 63 3101 0.01% 64 3440 0.01% 65 3767 0.02% 66 4177 0.02% 67 4567 0.02% 68 5256 0.02% 69 5832 0.03% 70 6991 0.03% 71 7912 0.03% 72 9232 0.04% 73 10725 0.05% 74 11784 0.05% 75 13029 0.06% 76 14361 0.06% 77 15469 0.07% 78 17179 0.07% 79 19633 0.08% 80 22107 0.09% 81 24947 0.11% 82 28734 0.12% 83 31987 0.14% 84 36321 0.16% 85 40467 0.17% 86 43816 0.19% 87 48051 0.21% 88 51904 0.22% 89 56015 0.24% 90 61637 0.26% 91 68286 0.29% 92 74985 0.32% 93 82513 0.35% 94 91091 0.39% 95 98281 0.42% 96 106037 0.45% 97 112620 0.48% 98 117834 0.51% 99 123653 0.53% 100 132494 0.57% 101 138446 0.59% 102 149096 0.64% 103 159435 0.68% 104 167062 0.72% 105 179171 0.77% 106 185681 0.80% 107 189606 0.81% 108 197303 0.85% 109 201707 0.87% 110 207133 0.89% 111 212217 0.91% 112 219623 0.94% 113 225732 0.97% 114 235586 1.01% 115 243202 1.04% 116 249500 1.07% 117 252361 1.08% 118 251846 1.08% 119 251131 1.08% 120 254753 1.09% 121 285947 1.23% 122 257035 1.10% 123 262857 1.13% 124 269308 1.16% 125 16430414 70.49% 23309176 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=34 prefix-density=0.22 prefix-fanout=1.9 sequence=ACCCGAACATGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=190.14 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=21.1 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=30 prefix-density=0.25 prefix-fanout=2.4 sequence=CCATGTTCGGGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=135.75 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=18.1 sequence=GAAGAAGAAGAAACAACTCCGGCCATGGCGGGCATCATCCACAAGATCGAGGAGAAGCTCCACATGGGCGGTGGCAGCGACCACAAGGACGAGCACAAGAA SRR3691980 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:16:25 Started mapping on | Dec 10 00:16:27 Finished on | Dec 10 00:18:10 Mapping speed, Million of reads per hour | 814.69 Number of input reads | 23309176 Average input read length | 240 UNIQUE READS: Uniquely mapped reads number | 21601641 Uniquely mapped reads % | 92.67% Average mapped length | 239.40 Number of splices: Total | 15409843 Number of splices: Annotated (sjdb) | 14459627 Number of splices: GT/AG | 15183453 Number of splices: GC/AG | 188371 Number of splices: AT/AC | 7966 Number of splices: Non-canonical | 30053 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.08 Insertion rate per base | 0.01% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 493549 % of reads mapped to multiple loci | 2.12% Number of reads mapped to too many loci | 70140 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.53% % of reads unmapped: other | 1.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1214254 1214254 1214254 N_multimapping 493549 493549 493549 N_noFeature 999222 20856064 1295575 N_ambiguous 510982 2406 62273 UnstrandedReadsAssigned:20091437 PositiveStrandReadsAssigned:743171 NegativeStrandReadsAssigned:20243793 Dataset is classified negative stranded MeadianReadLen=125 20thPercentileLength=116 echo kmer=111 SRR3691980 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3691980-trimmed-pair1.fastq SRR3691980-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,309,176 reads, 20,592,877 reads pseudoaligned [quant] estimated average fragment length: 149.602 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52973 SRR3691980.ke.tsv 35125 SRR3691980.se.tsv 88098 total ==> SRR3691980.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 787.494 0 0 PNS24247 1044 895.398 82.6694 6.70752 PNS24249 1928 1779.4 234.173 9.56087 PNS24246 1044 895.398 82.6694 6.70752 PNS24248 1044 895.398 82.6694 6.70752 PNS24244 1471 1322.4 175.819 9.65909 PNS24243 293 147.193 0 0 KQK14069 1603 1454.4 42893.7 2142.61 KQK14071 474 326.687 2989.11 664.727 ==> SRR3691980.se.tsv <== BRADI_1g14170v3 51533 BRADI_1g53295v3 25 BRADI_1g59795v3 1808 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 181 BRADI_1g74790v3 167 BRADI_1g09890v3 0 BRADI_1g77505v3 289 BRADI_1g48960v3 0 SRR3691980 completed mapping pipeline successfully