Starting /dee2/code/volunteer_pipeline.sh SRR3691991 current disk space = 1523489185792 free memory = 1409327056 SRR3691991 SRAfilesize 2b1c4dedf353627e161d659e95897297 SRR3691991.sra SRR3691991.sra file validated SRR3691991 is paired end SRR3691991 is conventional basespace SRR3691991 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691991_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7345 33.0 33.0 34.0 32.0 34.0 2 32.873 33.0 33.0 34.0 32.0 34.0 3 32.87125 34.0 33.0 34.0 32.0 34.0 4 32.7855 34.0 33.0 34.0 32.0 34.0 5 32.8165 34.0 33.0 34.0 32.0 34.0 6 36.9285 38.0 38.0 38.0 36.0 38.0 7 36.92 38.0 38.0 38.0 36.0 38.0 8 36.91825 38.0 38.0 38.0 36.0 38.0 9 36.884 38.0 38.0 38.0 36.0 38.0 10-11 36.9035 38.0 38.0 38.0 36.0 38.0 12-13 36.877625 38.0 38.0 38.0 35.5 38.0 14-15 36.860625 38.0 38.0 38.0 35.5 38.0 16-17 36.920375 38.0 38.0 38.0 36.0 38.0 18-19 36.79675 38.0 38.0 38.0 36.0 38.0 20-21 36.938 38.0 38.0 38.0 36.0 38.0 22-23 36.972375 38.0 38.0 38.0 36.0 38.0 24-25 36.9435 38.0 38.0 38.0 36.0 38.0 26-27 36.943250000000006 38.0 38.0 38.0 36.0 38.0 28-29 36.93825 38.0 38.0 38.0 36.0 38.0 30-31 36.955749999999995 38.0 38.0 38.0 36.0 38.0 32-33 37.048249999999996 38.0 38.0 38.0 36.0 38.0 34-35 36.96962499999999 38.0 38.0 38.0 36.5 38.0 36-37 37.02225 38.0 38.0 38.0 36.0 38.0 38-39 37.068125 38.0 38.0 38.0 36.0 38.0 40-41 37.03775 38.0 38.0 38.0 36.0 38.0 42-43 36.950500000000005 38.0 38.0 38.0 36.0 38.0 44-45 37.002375 38.0 38.0 38.0 36.0 38.0 46-47 36.94025 38.0 38.0 38.0 36.0 38.0 48-49 36.918875 38.0 38.0 38.0 36.0 38.0 50-51 36.90025 38.0 38.0 38.0 36.0 38.0 52-53 37.005250000000004 38.0 38.0 38.0 36.0 38.0 54-55 36.91625 38.0 38.0 38.0 36.0 38.0 56-57 36.936 38.0 38.0 38.0 36.0 38.0 58-59 36.910875000000004 38.0 38.0 38.0 36.0 38.0 60-61 36.894 38.0 38.0 38.0 36.0 38.0 62-63 36.911625 38.0 38.0 38.0 36.0 38.0 64-65 36.874375 38.0 38.0 38.0 36.0 38.0 66-67 36.837 38.0 38.0 38.0 36.0 38.0 68-69 36.858000000000004 38.0 38.0 38.0 36.0 38.0 70-71 36.822500000000005 38.0 38.0 38.0 35.5 38.0 72-73 36.849000000000004 38.0 38.0 38.0 35.5 38.0 74-75 36.851875 38.0 38.0 38.0 35.5 38.0 76-77 36.878875 38.0 38.0 38.0 35.5 38.0 78-79 36.83325 38.0 38.0 38.0 35.0 38.0 80-81 36.79975 38.0 38.0 38.0 35.0 38.0 82-83 36.852374999999995 38.0 38.0 38.0 35.5 38.0 84-85 36.685375 38.0 38.0 38.0 35.0 38.0 86-87 36.632999999999996 38.0 38.0 38.0 35.0 38.0 88-89 36.64725 38.0 38.0 38.0 34.5 38.0 90-91 36.639375 38.0 38.0 38.0 35.0 38.0 92-93 36.609750000000005 38.0 38.0 38.0 34.0 38.0 94-95 36.563 38.0 38.0 38.0 34.0 38.0 96-97 36.57225 38.0 38.0 38.0 34.5 38.0 98-99 36.611999999999995 38.0 38.0 38.0 34.5 38.0 100-101 36.525875 38.0 38.0 38.0 34.0 38.0 102-103 36.495374999999996 38.0 38.0 38.0 34.0 38.0 104-105 36.35725 38.0 38.0 38.0 34.0 38.0 106-107 36.382374999999996 38.0 38.0 38.0 34.0 38.0 108-109 36.388000000000005 38.0 38.0 38.0 34.0 38.0 110-111 36.264375 38.0 38.0 38.0 34.0 38.0 112-113 36.12775 38.0 38.0 38.0 33.0 38.0 114-115 36.1105 38.0 38.0 38.0 33.0 38.0 116-117 36.141375 38.0 38.0 38.0 33.0 38.0 118-119 36.010625 38.0 38.0 38.0 32.0 38.0 120-121 35.944625 38.0 38.0 38.0 31.5 38.0 122-123 35.752625 38.0 38.0 38.0 30.5 38.0 124-125 35.611375 38.0 37.5 38.0 29.5 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10-11 0.0 2309 12-13 0.0 2309 14-15 0.0 2309 16-17 0.0 2309 18-19 0.0 2309 20-21 0.0 2309 22-23 0.0 2309 24-25 0.0 2309 26-27 0.0 2309 28-29 0.0 2309 30-31 0.0 2309 32-33 0.0 2309 34-35 0.0 2309 36-37 0.0 2309 38-39 0.0 2309 40-41 0.0 2309 42-43 0.0 2309 44-45 0.0 2309 46-47 0.0 2309 48-49 0.0 2309 50-51 0.0 2309 52-53 0.0 2309 54-55 0.0 2309 56-57 0.0 2309 58-59 0.0 2309 60-61 0.0 2309 62-63 0.0 2309 64-65 0.0 2309 66-67 0.0 2309 68-69 0.0 2309 70-71 0.0 2309 72-73 0.0 2309 74-75 0.0 2309 76-77 0.0 2309 78-79 0.0 2309 80-81 0.0 2309 82-83 0.0 2309 84-85 0.0 2309 86-87 0.0 2309 88-89 0.0 2309 90-91 0.0 2309 92-93 0.0 2309 94-95 0.0 2309 96-97 0.0 2309 98-99 0.0 2309 100-101 0.0 2309 102-103 0.0 2309 104-105 0.0 2309 106-107 0.0 2309 108-109 0.0 2309 110-111 0.0 2309 112-113 0.0 2309 114-115 0.0 2309 116-117 0.0 2309 118-119 0.0 2309 120-121 0.0 2309 122-123 0.0 2309 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 1.0 18 3.0 19 3.0 20 6.0 21 3.0 22 7.0 23 8.0 24 14.0 25 22.0 26 21.0 27 26.0 28 27.0 29 38.0 30 39.0 31 45.0 32 63.0 33 81.0 34 98.0 35 176.0 36 333.0 37 2982.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.643321660830416 17.358679339669834 11.730865432716358 34.26713356678339 2 30.723042281711283 22.91718789091819 26.745058794095574 19.614711033274958 3 24.637318659329665 24.487243621810904 26.088044022011005 24.787393696848426 4 27.788894447223612 29.064532266133064 20.01000500250125 23.13656828414207 5 28.49637227920941 32.02401801351013 18.764073054791094 20.715536652489366 6 24.718538904178132 33.32499374530899 20.590442832124094 21.36602451838879 7 23.992994746059544 18.188641481110835 34.250688016012006 23.567675756817614 8 25.519139354515886 21.866399799849887 23.91793845384038 28.696522391793845 9 25.64423317488116 21.691268451338505 25.594195646735052 27.070302727045288 10-11 27.33299974981236 27.34550913184889 21.015761821366024 24.305729296972732 12-13 26.507380535401552 22.216662496872654 24.518388791593697 26.7575681761321 14-15 25.822594770424125 24.183660703115226 24.671587639184285 25.322156887276364 16-17 26.36977733299975 24.305729296972732 23.805354015511636 25.519139354515886 18-19 26.169627220415308 24.31823867900926 24.080560420315237 25.431573680260193 20-21 25.65674255691769 24.768576432324245 23.83037277958469 25.74430823117338 22-23 26.43821910955478 23.836918459229615 24.512256128064035 25.212606303151574 24-25 26.19136960600375 23.514696685428394 24.465290806754222 25.82864290181363 26-27 26.51988991743808 25.13134851138354 24.305729296972732 24.043032274205654 28-29 26.10708031023267 24.96872654490868 23.942957217913435 24.981235926945207 30-31 26.54490868151113 24.10557918438829 23.83037277958469 25.519139354515886 32-33 26.069552164123095 24.080560420315237 24.768576432324245 25.081310983237426 34-35 27.195396547410557 24.580935701776333 23.167375531648737 25.056292219164373 36-37 26.65999749906215 23.82143303738902 24.721770663999 24.796798799549833 38-39 26.819204801200303 24.193548387096776 23.99349837459365 24.99374843710928 40-41 25.812906453226613 24.81240620310155 23.74937468734367 25.625312656328163 42-43 26.695021265949464 24.080560420315237 24.505879409557167 24.718538904178132 44-45 26.375687843921963 24.299649824912457 24.12456228114057 25.200100050025014 46-47 27.007755816862648 24.31823867900926 24.10557918438829 24.568426319739807 48-49 26.419814861145856 24.806104578433825 24.630973229922443 24.143107330497873 50-51 26.482361771328495 24.68101075806855 24.605954465849386 24.230673004753562 52-53 26.632474355766828 24.293219914936202 24.380785589191895 24.69352014010508 54-55 26.64498373780335 23.505128846634975 25.093820365273956 24.756067050287715 56-57 26.56074064806706 24.55898911547604 24.571500062554737 24.308770173902165 58-59 27.1703777833375 24.818613960470355 23.29246935201401 24.718538904178132 60-61 27.120340255191394 25.006254691018263 24.931198398799097 22.942206654991242 62-63 26.98273705278959 24.706029522141606 24.25569176882662 24.055541656242184 64-65 26.45734300725544 25.73179884913685 24.25569176882662 23.555166374781088 66-67 26.832624468351263 24.605954465849386 24.843632724543408 23.71778834125594 68-69 26.788394197098548 24.6248124062031 23.736868434217108 24.84992496248124 70-71 27.204502814258912 24.90306441525954 24.24015009380863 23.652282676672918 72-73 27.107830873154864 24.36827620715537 24.468351263447584 24.055541656242184 74-75 26.45734300725544 25.143857893420062 24.293219914936202 24.10557918438829 76-77 27.01688555347092 24.577861163227016 24.2151344590369 24.190118824265166 78-79 26.20387742338962 25.05315822388993 24.1776110068793 24.56535334584115 80-81 26.682511883912934 25.64423317488116 24.455841881411057 23.217413059794847 82-83 26.032024018013512 25.39404553415061 24.505879409557167 24.06805103827871 84-85 27.383037277958465 24.243182386790092 24.74355766825119 23.63022266700025 86-87 26.038538538538536 24.74974974974975 24.737237237237235 24.474474474474476 88-89 26.395494367959948 24.6558197747184 24.217772215269086 24.730913642052567 90-91 27.43993993993994 23.998998998999 24.486986986986985 24.074074074074073 92-93 26.144608456342254 24.68101075806855 24.455841881411057 24.718538904178132 94-95 27.471839799749688 24.39299123904881 24.4180225281602 23.717146433041304 96-97 26.87108886107635 24.46808510638298 24.6433041301627 24.017521902377972 98-99 27.934918648310386 25.344180225281605 23.479349186483102 23.241551939924907 100-101 27.759699624530665 24.680851063829788 24.44305381727159 23.11639549436796 102-103 25.69461827284105 25.869837296620773 24.4180225281602 24.017521902377972 104-105 26.46985238929197 25.881911433575183 24.055541656242184 23.592694520890667 106-107 28.73405053790343 25.331498623967974 23.567675756817614 22.366775081310983 108-109 27.708281210908183 26.51988991743808 23.792844633475106 21.978984238178633 110-111 27.157868401300977 25.781836377282964 23.655241431073303 23.405053790342755 112-113 28.19614711033275 25.268951713785338 23.90542907180385 22.629472104078058 114-115 28.32290362953692 25.39424280350438 23.74217772215269 22.540675844806007 116-117 27.221526908635795 26.758448060075096 23.241551939924907 22.778473091364205 118-119 29.29394091136705 25.826239359038556 22.633950926389584 22.245868803204807 120-121 28.48560700876095 25.1188986232791 23.67959949937422 22.715894868585732 122-123 29.39924906132666 26.408010012515643 22.65331664580726 21.53942428035044 124-125 29.849812265331664 24.39299123904881 23.617021276595747 22.14017521902378 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 0.5 27 2.0 28 2.5 29 2.0 30 5.5 31 8.5 32 11.0 33 18.5 34 25.5 35 32.0 36 42.0 37 58.0 38 77.5 39 86.5 40 99.5 41 128.5 42 143.0 43 159.0 44 168.5 45 165.5 46 171.5 47 188.0 48 187.5 49 160.5 50 141.5 51 134.5 52 129.0 53 118.0 54 117.0 55 109.5 56 100.5 57 93.0 58 85.5 59 87.0 60 76.0 61 67.0 62 70.5 63 75.0 64 69.5 65 59.5 66 60.5 67 66.0 68 58.5 69 48.0 70 54.0 71 50.5 72 40.5 73 35.0 74 27.5 75 21.0 76 15.5 77 13.0 78 11.5 79 8.0 80 3.5 81 2.5 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.075 3 0.05 4 0.05 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-11 0.075 12-13 0.075 14-15 0.08750000000000001 16-17 0.075 18-19 0.075 20-21 0.075 22-23 0.05 24-25 0.0625 26-27 0.075 28-29 0.075 30-31 0.075 32-33 0.075 34-35 0.075 36-37 0.0375 38-39 0.025 40-41 0.05 42-43 0.075 44-45 0.05 46-47 0.075 48-49 0.075 50-51 0.075 52-53 0.075 54-55 0.075 56-57 0.08750000000000001 58-59 0.075 60-61 0.075 62-63 0.075 64-65 0.075 66-67 0.075 68-69 0.05 70-71 0.0625 72-73 0.075 74-75 0.075 76-77 0.0625 78-79 0.0625 80-81 0.075 82-83 0.075 84-85 0.075 86-87 0.1 88-89 0.125 90-91 0.1 92-93 0.075 94-95 0.125 96-97 0.125 98-99 0.125 100-101 0.125 102-103 0.125 104-105 0.075 106-107 0.075 108-109 0.075 110-111 0.075 112-113 0.075 114-115 0.125 116-117 0.125 118-119 0.15 120-121 0.125 122-123 0.125 124-125 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.3125 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.4125 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.6125 0.0 0.0 0.0 0.0 80-81 0.7375 0.0 0.0 0.0 0.0 82-83 0.8999999999999999 0.0 0.0 0.0 0.0 84-85 1.125 0.0 0.0 0.0 0.0 86-87 1.4625 0.0 0.0 0.0 0.0 88-89 1.8375 0.0 0.0 0.0 0.0 90-91 2.2375 0.0 0.0 0.0 0.0 92-93 2.6625 0.0 0.0 0.0 0.0 94-95 2.9875 0.0 0.0 0.0 0.0 96-97 3.45 0.0 0.0 0.0 0.0 98-99 4.1 0.0 0.0 0.0 0.0 100-101 4.800000000000001 0.0 0.0 0.0 0.0 102-103 5.5875 0.0 0.0 0.0 0.0 104-105 6.3375 0.0 0.0 0.0 0.0 106-107 7.3 0.0 0.0 0.0 0.0 108-109 8.45 0.0 0.0 0.0 0.0 110-111 10.05 0.0 0.0 0.0 0.0 112-113 11.587499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGTGTA 30 0.0012322128 39.666668 118-119 CGTCGTG 30 0.0012322128 39.666668 116-117 AGCGTCG 35 0.0026274757 34.0 114-115 AGAGCGT 45 0.00898472 26.444443 112-113 >>END_MODULE SRR3691991 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3691991_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.582 34.0 33.0 34.0 32.0 34.0 2 33.1405 34.0 33.0 34.0 32.0 34.0 3 33.22525 34.0 33.0 34.0 32.0 34.0 4 33.16875 34.0 33.0 34.0 32.0 34.0 5 33.2125 34.0 33.0 34.0 32.0 34.0 6 36.74775 38.0 37.0 38.0 35.0 38.0 7 37.139 38.0 38.0 38.0 36.0 38.0 8 37.3885 38.0 38.0 38.0 37.0 38.0 9 37.41175 38.0 38.0 38.0 37.0 38.0 10-11 37.365375 38.0 38.0 38.0 37.0 38.0 12-13 37.323750000000004 38.0 38.0 38.0 37.0 38.0 14-15 37.37075 38.0 38.0 38.0 37.0 38.0 16-17 37.466125 38.0 38.0 38.0 37.0 38.0 18-19 37.424125000000004 38.0 38.0 38.0 37.0 38.0 20-21 37.36125 38.0 38.0 38.0 37.0 38.0 22-23 37.413624999999996 38.0 38.0 38.0 37.0 38.0 24-25 37.423 38.0 38.0 38.0 37.0 38.0 26-27 37.377375 38.0 38.0 38.0 37.0 38.0 28-29 37.348375000000004 38.0 38.0 38.0 37.0 38.0 30-31 37.383375 38.0 38.0 38.0 37.0 38.0 32-33 37.368375 38.0 38.0 38.0 37.0 38.0 34-35 37.344875 38.0 38.0 38.0 37.0 38.0 36-37 37.3495 38.0 38.0 38.0 37.0 38.0 38-39 37.323125000000005 38.0 38.0 38.0 37.0 38.0 40-41 37.268125 38.0 38.0 38.0 37.0 38.0 42-43 37.2315 38.0 38.0 38.0 36.0 38.0 44-45 37.2775 38.0 38.0 38.0 37.0 38.0 46-47 37.277249999999995 38.0 38.0 38.0 37.0 38.0 48-49 37.269625 38.0 38.0 38.0 37.0 38.0 50-51 37.298 38.0 38.0 38.0 37.0 38.0 52-53 37.242999999999995 38.0 38.0 38.0 37.0 38.0 54-55 37.2025 38.0 38.0 38.0 36.0 38.0 56-57 37.252624999999995 38.0 38.0 38.0 36.5 38.0 58-59 37.212374999999994 38.0 38.0 38.0 36.0 38.0 60-61 37.207499999999996 38.0 38.0 38.0 36.5 38.0 62-63 37.221875 38.0 38.0 38.0 36.5 38.0 64-65 37.165 38.0 38.0 38.0 36.0 38.0 66-67 37.088875 38.0 38.0 38.0 36.0 38.0 68-69 37.1165 38.0 38.0 38.0 36.0 38.0 70-71 37.0385 38.0 38.0 38.0 36.0 38.0 72-73 37.1015 38.0 38.0 38.0 36.0 38.0 74-75 37.123000000000005 38.0 38.0 38.0 36.0 38.0 76-77 37.104 38.0 38.0 38.0 36.0 38.0 78-79 37.11 38.0 38.0 38.0 36.0 38.0 80-81 37.117000000000004 38.0 38.0 38.0 36.0 38.0 82-83 37.028625 38.0 38.0 38.0 35.5 38.0 84-85 36.9355 38.0 38.0 38.0 35.0 38.0 86-87 36.90875 38.0 38.0 38.0 35.0 38.0 88-89 36.9435 38.0 38.0 38.0 35.0 38.0 90-91 36.990875 38.0 38.0 38.0 35.5 38.0 92-93 36.880375 38.0 38.0 38.0 35.0 38.0 94-95 36.904624999999996 38.0 38.0 38.0 35.0 38.0 96-97 36.788875000000004 38.0 38.0 38.0 35.0 38.0 98-99 36.81325 38.0 38.0 38.0 35.0 38.0 100-101 36.756625 38.0 38.0 38.0 34.5 38.0 102-103 36.836375000000004 38.0 38.0 38.0 35.0 38.0 104-105 36.714124999999996 38.0 38.0 38.0 34.0 38.0 106-107 36.722625 38.0 38.0 38.0 34.5 38.0 108-109 36.73375 38.0 38.0 38.0 35.0 38.0 110-111 36.70525000000001 38.0 38.0 38.0 35.0 38.0 112-113 36.673875 38.0 38.0 38.0 34.5 38.0 114-115 36.618875 38.0 38.0 38.0 34.0 38.0 116-117 36.43825 38.0 38.0 38.0 34.0 38.0 118-119 36.3425 38.0 38.0 38.0 34.0 38.0 120-121 36.206 38.0 38.0 38.0 33.5 38.0 122-123 36.326125000000005 38.0 38.0 38.0 34.0 38.0 124-125 36.32 38.0 38.0 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10-11 0.0 2309 12-13 0.0 2309 14-15 0.0 2309 16-17 0.0 2309 18-19 0.0 2309 20-21 0.0 2309 22-23 0.0 2309 24-25 0.0 2309 26-27 0.0 2309 28-29 0.0 2309 30-31 0.0 2309 32-33 0.0 2309 34-35 0.0 2309 36-37 0.0 2309 38-39 0.0 2309 40-41 0.0 2309 42-43 0.0 2309 44-45 0.0 2309 46-47 0.0 2309 48-49 0.0 2309 50-51 0.0 2309 52-53 0.0 2309 54-55 0.0 2309 56-57 0.0 2309 58-59 0.0 2309 60-61 0.0 2309 62-63 0.0 2309 64-65 0.0 2309 66-67 0.0 2309 68-69 0.0 2309 70-71 0.0 2309 72-73 0.0 2309 74-75 0.0 2309 76-77 0.0 2309 78-79 0.0 2309 80-81 0.0 2309 82-83 0.0 2309 84-85 0.0 2309 86-87 0.0 2309 88-89 0.0 2309 90-91 0.0 2309 92-93 0.0 2309 94-95 0.0 2309 96-97 0.0 2309 98-99 0.0 2309 100-101 0.0 2309 102-103 0.0 2309 104-105 0.0 2309 106-107 0.0 2309 108-109 0.0 2309 110-111 0.0 2309 112-113 0.0 2309 114-115 0.0 2309 116-117 0.0 2309 118-119 0.0 2309 120-121 0.0 2309 122-123 0.0 2309 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 0.0 24 8.0 25 8.0 26 8.0 27 11.0 28 22.0 29 26.0 30 34.0 31 54.0 32 49.0 33 77.0 34 91.0 35 154.0 36 356.0 37 3100.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.29823664707386 11.142346026066956 7.48786097623307 40.07155635062612 2 26.3 13.275 31.974999999999998 28.449999999999996 3 22.6 19.05 23.599999999999998 34.75 4 27.800000000000004 25.074999999999996 19.35 27.775 5 26.400000000000002 29.875 22.325 21.4 6 22.861430715357677 31.49074537268634 22.98649324662331 22.661330665332667 7 17.025000000000002 24.349999999999998 38.6 20.025000000000002 8 21.099999999999998 23.0 28.199999999999996 27.700000000000003 9 21.099999999999998 20.7 32.225 25.974999999999998 10-11 23.65 29.75 22.5625 24.0375 12-13 23.375 23.3875 26.4125 26.825 14-15 23.425 24.4125 27.1125 25.05 16-17 24.1375 24.425 25.0375 26.400000000000002 18-19 22.4875 25.937500000000004 25.387500000000003 26.187500000000004 20-21 23.400000000000002 24.9 25.55 26.150000000000002 22-23 22.95 26.150000000000002 24.6625 26.237500000000004 24-25 22.6375 26.0 24.65 26.7125 26-27 23.225 25.7125 24.474999999999998 26.5875 28-29 23.1875 26.05 24.75 26.0125 30-31 23.8875 25.374999999999996 24.4375 26.3 32-33 23.674999999999997 25.7 24.962500000000002 25.662499999999998 34-35 23.5875 25.05 24.8625 26.5 36-37 24.099999999999998 25.374999999999996 24.2 26.325 38-39 24.4125 24.925 24.275 26.387500000000003 40-41 23.5375 26.387500000000003 24.125 25.95 42-43 24.725 24.7 24.075 26.5 44-45 23.9375 24.9875 25.0625 26.0125 46-47 23.0875 25.324999999999996 24.525 27.0625 48-49 24.3125 25.3125 24.5625 25.8125 50-51 23.5375 25.0125 24.85 26.6 52-53 24.0 25.374999999999996 23.9375 26.687499999999996 54-55 23.4125 25.124999999999996 24.887500000000003 26.575 56-57 23.724999999999998 26.1625 24.6875 25.424999999999997 58-59 24.4875 24.9875 24.474999999999998 26.05 60-61 23.775 25.4625 25.275 25.4875 62-63 23.8375 24.587500000000002 25.974999999999998 25.6 64-65 24.275 25.362499999999997 24.45 25.912499999999998 66-67 22.650000000000002 25.124999999999996 25.124999999999996 27.1 68-69 24.224999999999998 24.9375 24.5125 26.325 70-71 24.6 24.025 24.75 26.625 72-73 23.8625 24.8125 24.25 27.075 74-75 23.925 24.7375 24.9875 26.35 76-77 24.2625 24.637500000000003 24.3625 26.737499999999997 78-79 24.925 24.5 23.775 26.8 80-81 23.95 24.3875 24.6 27.0625 82-83 23.8875 24.9125 24.6625 26.5375 84-85 24.0375 24.25 25.5125 26.200000000000003 86-87 24.075 24.85 25.0 26.075 88-89 24.837500000000002 24.712500000000002 24.575 25.874999999999996 90-91 25.5375 24.9125 23.6375 25.912499999999998 92-93 24.3 25.687500000000004 23.4375 26.575 94-95 23.974999999999998 24.725 24.224999999999998 27.075 96-97 24.75 24.2875 23.799999999999997 27.1625 98-99 24.7 24.525 24.4 26.375 100-101 24.45 25.3125 24.675 25.5625 102-103 25.15 25.8 22.825 26.224999999999998 104-105 24.4125 24.675 24.962500000000002 25.95 106-107 24.4375 25.2875 24.2875 25.9875 108-109 24.7 25.7125 23.3 26.2875 110-111 25.0 25.337500000000002 23.125 26.5375 112-113 24.9375 25.95 23.2875 25.825 114-115 25.1875 26.487500000000004 22.575 25.75 116-117 26.087500000000002 25.4875 22.25 26.174999999999997 118-119 25.7875 26.0375 22.1375 26.0375 120-121 26.137500000000003 25.374999999999996 23.05 25.4375 122-123 25.137500000000003 26.237500000000004 22.45 26.174999999999997 124-125 25.424999999999997 25.25 22.6375 26.687499999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 2.0 27 2.5 28 2.5 29 3.0 30 4.5 31 9.5 32 11.0 33 18.5 34 30.5 35 39.5 36 49.0 37 66.0 38 87.5 39 105.0 40 124.5 41 137.5 42 155.5 43 160.0 44 167.5 45 182.0 46 191.5 47 192.0 48 173.5 49 167.5 50 153.5 51 139.5 52 129.5 53 105.0 54 101.5 55 101.5 56 99.0 57 95.5 58 77.5 59 72.0 60 72.5 61 71.0 62 68.5 63 66.5 64 65.5 65 63.0 66 53.5 67 52.0 68 53.0 69 45.5 70 43.5 71 41.5 72 32.0 73 26.0 74 24.5 75 20.5 76 15.5 77 10.5 78 7.0 79 3.0 80 1.5 81 2.0 82 1.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.3125 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.4125 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.6125 0.0 0.0 0.0 0.0 80-81 0.7375 0.0 0.0 0.0 0.0 82-83 0.8999999999999999 0.0 0.0 0.0 0.0 84-85 1.15 0.0 0.0 0.0 0.0 86-87 1.5 0.0 0.0 0.0 0.0 88-89 1.9 0.0 0.0 0.0 0.0 90-91 2.3125 0.0 0.0 0.0 0.0 92-93 2.75 0.0 0.0 0.0 0.0 94-95 3.0875000000000004 0.0 0.0 0.0 0.0 96-97 3.55 0.0 0.0 0.0 0.0 98-99 4.2125 0.0 0.0 0.0 0.0 100-101 4.9125 0.0 0.0 0.0 0.0 102-103 5.737500000000001 0.0 0.0 0.0 0.0 104-105 6.5375 0.0 0.0 0.0 0.0 106-107 7.575 0.0 0.0 0.0 0.0 108-109 8.774999999999999 0.0 0.0 0.0 0.0 110-111 10.3875 0.0 0.0 0.0 0.0 112-113 11.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACGTCT 30 0.0012334867 39.658333 118-119 CACACGT 35 0.0026301844 33.99286 116-117 AGCACAC 40 0.0050590103 29.743752 114-115 AGAGCAC 45 0.008993935 26.438889 112-113 >>END_MODULE Read 1207685 spots for SRR3691991.sra Written 1207685 spots for SRR3691991.sra Read 1207685 spots for SRR3691991.sra Written 1207685 spots for SRR3691991.sra Read 1207685 spots for SRR3691991.sra Written 1207685 spots for SRR3691991.sra Read 1207685 spots for SRR3691991.sra Written 1207685 spots for SRR3691991.sra Read 1207685 spots for SRR3691991.sra Written 1207685 spots for SRR3691991.sra Read 1207685 spots for SRR3691991.sra Written 1207685 spots for SRR3691991.sra Read 1207685 spots for SRR3691991.sra Written 1207685 spots for SRR3691991.sra Read 1207685 spots for SRR3691991.sra Written 1207685 spots for SRR3691991.sra Read 1207685 spots for SRR3691991.sra Written 1207685 spots for SRR3691991.sra Read 1207704 spots for SRR3691991.sra Written 1207704 spots for SRR3691991.sra Read 1207685 spots for SRR3691991.sra Written 1207685 spots for SRR3691991.sra Read 1207685 spots for SRR3691991.sra Written 1207685 spots for SRR3691991.sra Read 1207685 spots for SRR3691991.sra Written 1207685 spots for SRR3691991.sra Read 1207685 spots for SRR3691991.sra Written 1207685 spots for SRR3691991.sra Read 1207685 spots for SRR3691991.sra Written 1207685 spots for SRR3691991.sra Read 1207685 spots for SRR3691991.sra Written 1207685 spots for SRR3691991.sra Read 1207685 spots for SRR3691991.sra Written 1207685 spots for SRR3691991.sra Read 1207685 spots for SRR3691991.sra Written 1207685 spots for SRR3691991.sra Read 1207685 spots for SRR3691991.sra Written 1207685 spots for SRR3691991.sra Read 1207685 spots for SRR3691991.sra Written 1207685 spots for SRR3691991.sra SRR ids: ['SRR3691991.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5ioc8rsg SRR3691991.sra spots: 24153719 blocks: [[1, 1207685], [1207686, 2415370], [2415371, 3623055], [3623056, 4830740], [4830741, 6038425], [6038426, 7246110], [7246111, 8453795], [8453796, 9661480], [9661481, 10869165], [10869166, 12076850], [12076851, 13284535], [13284536, 14492220], [14492221, 15699905], [15699906, 16907590], [16907591, 18115275], [18115276, 19322960], [19322961, 20530645], [20530646, 21738330], [21738331, 22946015], [22946016, 24153719]] SRR3691991 file size 7690148 SRR3691991 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3691991 SRR3691991_1.fastq SRR3691991_2.fastq Input file: SRR3691991_1.fastq Paired file: SRR3691991_2.fastq trimmed: SRR3691991-trimmed-pair1.fastq, SRR3691991-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:12:52 2024 >> started Tue Dec 10 00:13:22 2024 >> done (30.365s) 24153719 read pairs processed; of these: 3 ( 0.00%) short read pairs filtered out after trimming by size control 980 ( 0.00%) empty read pairs filtered out after trimming by size control 24152736 (100.00%) read pairs available; of these: 2686911 (11.12%) trimmed read pairs available after processing 21465825 (88.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 80 37 0.00% 81 130 0.00% 82 43 0.00% 83 5 0.00% 84 1 0.00% 85 0 0.00% 86 0 0.00% 87 0 0.00% 88 0 0.00% 89 0 0.00% 90 0 0.00% 91 0 0.00% 92 0 0.00% 93 0 0.00% 94 0 0.00% 95 1 0.00% 96 68 0.00% 97 70 0.00% 98 39 0.00% 99 494 0.00% 100 727 0.00% 101 613 0.00% 102 445 0.00% 103 1344 0.01% 104 311 0.00% 105 1911 0.01% 106 16 0.00% 107 6 0.00% 108 41 0.00% 109 658 0.00% 110 1936 0.01% 111 17747 0.07% 112 175211 0.73% 113 180947 0.75% 114 187755 0.78% 115 195824 0.81% 116 202185 0.84% 117 202433 0.84% 118 204050 0.84% 119 203517 0.84% 120 205924 0.85% 121 250272 1.04% 122 211387 0.88% 123 217194 0.90% 124 223569 0.93% 125 21465825 88.88% 24152736 reads passed initial QC criterion=sequence-density sequence-density=10.86 sequence-density-rank=1 fanout-score=35.37 fanout-score-rank=1 prefix-density=10.99 prefix-fanout=34.9 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA criterion=fanout-score sequence-density=10.86 sequence-density-rank=1 fanout-score=35.37 fanout-score-rank=1 prefix-density=10.99 prefix-fanout=34.9 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA criterion=sequence-density sequence-density=10.97 sequence-density-rank=1 fanout-score=46.29 fanout-score-rank=2 prefix-density=11.02 prefix-fanout=46.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTTCGGAATCTCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=3 fanout-score=231.63 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=17.5 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -y AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTTCGGAATCTCGTATGCCGTCTTCTGCTTGAAAAA -o SRR3691991 SRR3691991_1.fastq SRR3691991_2.fastq Input file: SRR3691991_1.fastq Paired file: SRR3691991_2.fastq trimmed: SRR3691991-trimmed-pair1.fastq, SRR3691991-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTTCGGAATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:15:31 2024 >> started Tue Dec 10 00:15:55 2024 >> done (23.783s) 19761330 read pairs processed; of these: 183 ( 0.00%) short read pairs filtered out after trimming by size control 3124 ( 0.02%) empty read pairs filtered out after trimming by size control 19758023 (99.98%) read pairs available; of these: 2269043 (11.48%) trimmed read pairs available after processing 17488980 (88.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 4 0.00% 21 6 0.00% 22 5 0.00% 23 4 0.00% 24 5 0.00% 25 1 0.00% 26 7 0.00% 27 7 0.00% 28 12 0.00% 29 8 0.00% 30 23 0.00% 31 22 0.00% 32 31 0.00% 33 33 0.00% 34 45 0.00% 35 42 0.00% 36 51 0.00% 37 80 0.00% 38 84 0.00% 39 95 0.00% 40 108 0.00% 41 150 0.00% 42 165 0.00% 43 165 0.00% 44 172 0.00% 45 198 0.00% 46 208 0.00% 47 246 0.00% 48 297 0.00% 49 386 0.00% 50 437 0.00% 51 541 0.00% 52 563 0.00% 53 591 0.00% 54 658 0.00% 55 728 0.00% 56 782 0.00% 57 886 0.00% 58 1071 0.01% 59 1229 0.01% 60 1435 0.01% 61 1717 0.01% 62 1860 0.01% 63 2031 0.01% 64 2371 0.01% 65 2473 0.01% 66 2782 0.01% 67 3050 0.02% 68 3328 0.02% 69 3787 0.02% 70 4594 0.02% 71 5103 0.03% 72 5919 0.03% 73 6816 0.03% 74 7477 0.04% 75 8301 0.04% 76 9257 0.05% 77 10190 0.05% 78 10915 0.06% 79 12413 0.06% 80 13649 0.07% 81 15658 0.08% 82 17682 0.09% 83 19894 0.10% 84 22579 0.11% 85 25287 0.13% 86 27541 0.14% 87 29741 0.15% 88 32391 0.16% 89 34912 0.18% 90 37999 0.19% 91 41968 0.21% 92 45865 0.23% 93 51032 0.26% 94 56447 0.29% 95 60983 0.31% 96 65720 0.33% 97 70267 0.36% 98 73839 0.37% 99 77061 0.39% 100 83313 0.42% 101 88168 0.45% 102 93490 0.47% 103 101360 0.51% 104 105941 0.54% 105 114278 0.58% 106 118686 0.60% 107 121500 0.61% 108 125249 0.63% 109 130649 0.66% 110 134135 0.68% 111 137134 0.69% 112 143594 0.73% 113 147849 0.75% 114 153405 0.78% 115 159985 0.81% 116 165143 0.84% 117 165495 0.84% 118 166708 0.84% 119 166581 0.84% 120 168825 0.85% 121 200226 1.01% 122 172982 0.88% 123 177906 0.90% 124 182870 0.93% 125 15296060 77.42% criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=12.02 fanout-score-rank=12 prefix-density=0.35 prefix-fanout=6.9 sequence=AAGGAGCTGGAGGAGGTGAAGAAGGAGTACCCTGACGCCTATGTCCGCATCATCGGCTTCGACAACACCAGGCAAGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGGCAAGGCCTAAGCAAGTTGATTTCTTATAATACAAGAACGGGTCACACCGATTTTATGTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATCTCTCCCAACAACCCGGATTAACTGTATTCATGAGTACTACTATTATAAGAGTACTACAACTATCGTTGGGAGAGGGGCATGTAATATAAACTCCGGTTATACATATTAAGATAAGTATATTTTGTAAAAGAATATCAAATTCGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=162.29 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=20.3 sequence=CCGCCGCCGCCA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=25 prefix-density=0.18 prefix-fanout=2.8 sequence=GGTCGGCAAGGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=12 fanout-score=201.72 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=23.4 sequence=CTTCTTCTTCTC SRR3691991 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:17:01 Started mapping on | Dec 10 00:17:01 Finished on | Dec 10 00:18:56 Mapping speed, Million of reads per hour | 755.98 Number of input reads | 24149429 Average input read length | 243 UNIQUE READS: Uniquely mapped reads number | 22222067 Uniquely mapped reads % | 92.02% Average mapped length | 242.51 Number of splices: Total | 16700060 Number of splices: Annotated (sjdb) | 15692049 Number of splices: GT/AG | 16467778 Number of splices: GC/AG | 199459 Number of splices: AT/AC | 8138 Number of splices: Non-canonical | 24685 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.04 Insertion rate per base | 0.01% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 465475 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 81987 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.25% % of reads unmapped: other | 1.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1462039 1462039 1462039 N_multimapping 465475 465475 465475 N_noFeature 901642 1112536 21571787 N_ambiguous 504893 65536 2321 UnstrandedReadsAssigned:20815532 PositiveStrandReadsAssigned:21043995 NegativeStrandReadsAssigned:647959 Dataset is classified positive stranded MeadianReadLen=125 20thPercentileLength=122 echo kmer=117 SRR3691991 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3691991-trimmed-pair1.fastq SRR3691991-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,149,429 reads, 21,509,163 reads pseudoaligned [quant] estimated average fragment length: 166.473 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52973 SRR3691991.ke.tsv 35125 SRR3691991.se.tsv 88098 total ==> SRR3691991.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 770.689 1.01071e-08 8.88711e-10 PNS24247 1044 878.527 86.3242 6.65872 PNS24249 1928 1762.53 219.994 8.4584 PNS24246 1044 878.527 86.3242 6.65872 PNS24248 1044 878.527 86.3242 6.65872 PNS24244 1471 1305.53 127.034 6.59396 PNS24243 293 135.287 0 0 KQK14069 1603 1437.53 47160.6 2223.19 KQK14071 474 310.199 3527.7 770.663 ==> SRR3691991.se.tsv <== BRADI_1g14170v3 54282 BRADI_1g53295v3 52 BRADI_1g59795v3 1392 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 188 BRADI_1g74790v3 281 BRADI_1g09890v3 0 BRADI_1g77505v3 391 BRADI_1g48960v3 0 SRR3691991 completed mapping pipeline successfully