Starting /dee2/code/volunteer_pipeline.sh SRR3692159 current disk space = 1523514413056 free memory = 1598381624 SRR3692159 SRAfilesize 431e271e85de0717571f3f0409ee1578 SRR3692159.sra SRR3692159.sra file validated SRR3692159 is paired end SRR3692159 is conventional basespace SRR3692159 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3692159_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5535 34.0 33.0 34.0 32.0 34.0 2 33.162 34.0 33.0 34.0 32.0 34.0 3 33.23625 34.0 33.0 34.0 32.0 34.0 4 33.29975 34.0 33.0 34.0 33.0 34.0 5 33.2885 34.0 33.0 34.0 33.0 34.0 6 36.7945 38.0 37.0 38.0 34.0 38.0 7 37.18225 38.0 38.0 38.0 36.0 38.0 8 37.38375 38.0 38.0 38.0 37.0 38.0 9 37.5055 38.0 38.0 38.0 37.0 38.0 10-11 37.439499999999995 38.0 38.0 38.0 37.0 38.0 12-13 37.346374999999995 38.0 38.0 38.0 37.0 38.0 14-15 37.41875 38.0 38.0 38.0 37.5 38.0 16-17 37.45425 38.0 38.0 38.0 37.5 38.0 18-19 37.4495 38.0 38.0 38.0 37.0 38.0 20-21 37.4405 38.0 38.0 38.0 37.0 38.0 22-23 37.504125 38.0 38.0 38.0 38.0 38.0 24-25 37.478375 38.0 38.0 38.0 38.0 38.0 26-27 37.45475 38.0 38.0 38.0 37.0 38.0 28-29 37.398624999999996 38.0 38.0 38.0 37.5 38.0 30-31 37.405375 38.0 38.0 38.0 37.0 38.0 32-33 37.377375 38.0 38.0 38.0 37.0 38.0 34-35 37.407 38.0 38.0 38.0 37.5 38.0 36-37 37.430499999999995 38.0 38.0 38.0 37.0 38.0 38-39 37.421499999999995 38.0 38.0 38.0 37.0 38.0 40-41 37.327 38.0 38.0 38.0 37.0 38.0 42-43 37.31375 38.0 38.0 38.0 37.0 38.0 44-45 37.358999999999995 38.0 38.0 38.0 37.0 38.0 46-47 37.284875 38.0 38.0 38.0 37.0 38.0 48-49 37.29375 38.0 38.0 38.0 37.0 38.0 50-51 37.300124999999994 38.0 38.0 38.0 37.0 38.0 52-53 37.307125 38.0 38.0 38.0 37.0 38.0 54-55 37.279 38.0 38.0 38.0 37.0 38.0 56-57 37.248125 38.0 38.0 38.0 37.0 38.0 58-59 37.29975 38.0 38.0 38.0 37.0 38.0 60-61 37.201125000000005 38.0 38.0 38.0 36.5 38.0 62-63 37.216125000000005 38.0 38.0 38.0 37.0 38.0 64-65 37.266375 38.0 38.0 38.0 37.0 38.0 66-67 37.220749999999995 38.0 38.0 38.0 37.0 38.0 68-69 37.18375 38.0 38.0 38.0 36.5 38.0 70-71 37.198875 38.0 38.0 38.0 36.0 38.0 72-73 37.20125 38.0 38.0 38.0 36.5 38.0 74-75 37.16225 38.0 38.0 38.0 36.0 38.0 76-77 37.142125 38.0 38.0 38.0 36.0 38.0 78-79 37.208375000000004 38.0 38.0 38.0 36.0 38.0 80-81 37.170375 38.0 38.0 38.0 36.0 38.0 82-83 37.032375 38.0 38.0 38.0 36.0 38.0 84-85 37.006375 38.0 38.0 38.0 36.0 38.0 86-87 37.071 38.0 38.0 38.0 36.0 38.0 88-89 37.124625 38.0 38.0 38.0 36.0 38.0 90-91 37.113625 38.0 38.0 38.0 36.0 38.0 92-93 36.922875 38.0 38.0 38.0 35.5 38.0 94-95 37.040875 38.0 38.0 38.0 36.0 38.0 96-97 36.874875 38.0 38.0 38.0 35.5 38.0 98-99 36.877625 38.0 38.0 38.0 35.0 38.0 100-101 36.922 38.0 38.0 38.0 35.0 38.0 102-103 36.956375 38.0 38.0 38.0 35.0 38.0 104-105 36.908249999999995 38.0 38.0 38.0 35.0 38.0 106-107 36.884249999999994 38.0 38.0 38.0 35.0 38.0 108-109 36.861374999999995 38.0 38.0 38.0 35.0 38.0 110-111 36.765625 38.0 38.0 38.0 35.0 38.0 112-113 36.761625 38.0 38.0 38.0 34.5 38.0 114-115 36.79675 38.0 38.0 38.0 35.0 38.0 116-117 36.697125 38.0 38.0 38.0 34.0 38.0 118-119 36.535875000000004 38.0 38.0 38.0 34.0 38.0 120-121 36.47225 38.0 38.0 38.0 34.0 38.0 122-123 36.513374999999996 38.0 38.0 38.0 34.0 38.0 124-125 36.443125 38.0 38.0 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10-11 0.0 2309 12-13 0.0 2309 14-15 0.0 2309 16-17 0.0 2309 18-19 0.0 2309 20-21 0.0 2309 22-23 0.0 2309 24-25 0.0 2309 26-27 0.0 2309 28-29 0.0 2309 30-31 0.0 2309 32-33 0.0 2309 34-35 0.0 2309 36-37 0.0 2309 38-39 0.0 2309 40-41 0.0 2309 42-43 0.0 2309 44-45 0.0 2309 46-47 0.0 2309 48-49 0.0 2309 50-51 0.0 2309 52-53 0.0 2309 54-55 0.0 2309 56-57 0.0 2309 58-59 0.0 2309 60-61 0.0 2309 62-63 0.0 2309 64-65 0.0 2309 66-67 0.0 2309 68-69 0.0 2309 70-71 0.0 2309 72-73 0.0 2309 74-75 0.0 2309 76-77 0.0 2309 78-79 0.0 2309 80-81 0.0 2309 82-83 0.0 2309 84-85 0.0 2309 86-87 0.0 2309 88-89 0.0 2309 90-91 0.0 2309 92-93 0.0 2309 94-95 0.0 2309 96-97 0.0 2309 98-99 0.0 2309 100-101 0.0 2309 102-103 0.0 2309 104-105 0.0 2309 106-107 0.0 2309 108-109 0.0 2309 110-111 0.0 2309 112-113 0.0 2309 114-115 0.0 2309 116-117 0.0 2309 118-119 0.0 2309 120-121 0.0 2309 122-123 0.0 2309 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 6.0 24 2.0 25 8.0 26 11.0 27 12.0 28 19.0 29 12.0 30 26.0 31 36.0 32 49.0 33 64.0 34 102.0 35 159.0 36 311.0 37 3180.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.77561475409836 9.246926229508198 8.119877049180328 38.857581967213115 2 25.650000000000002 13.025 32.15 29.175 3 23.95 18.025 23.400000000000002 34.625 4 27.950000000000003 24.8 20.8 26.450000000000003 5 26.875 27.950000000000003 22.725 22.45 6 21.125 32.275 24.349999999999998 22.25 7 17.9 23.125 40.8 18.175 8 20.424999999999997 21.525 30.049999999999997 28.000000000000004 9 19.85 22.725 31.95 25.474999999999998 10-11 23.8375 29.5875 23.7 22.875 12-13 23.025000000000002 23.35 27.474999999999998 26.150000000000002 14-15 23.799999999999997 25.5625 26.35 24.2875 16-17 23.3 25.112499999999997 26.0375 25.55 18-19 23.7 26.0125 24.762500000000003 25.525 20-21 22.45 26.0125 25.674999999999997 25.8625 22-23 23.3125 26.9625 25.2625 24.462500000000002 24-25 22.8625 26.0625 25.224999999999998 25.85 26-27 23.549999999999997 25.474999999999998 25.637500000000003 25.337500000000002 28-29 23.8125 25.4625 25.337500000000002 25.387500000000003 30-31 23.177897237154642 25.55319414926866 25.728216027003377 25.54069258657332 32-33 23.45 26.0 25.424999999999997 25.124999999999996 34-35 23.125 25.5625 26.05 25.2625 36-37 23.225 24.962500000000002 26.3125 25.5 38-39 22.615326915864483 26.26578322290286 24.678084760595073 26.440805100637583 40-41 23.377922240280036 25.9407425928241 25.340667583447928 25.340667583447928 42-43 24.131032758189548 25.506376594148538 25.30632658164541 25.056264066016503 44-45 24.462500000000002 25.5375 25.275 24.725 46-47 23.0375 26.087500000000002 25.2375 25.637500000000003 48-49 22.6875 25.412499999999998 26.0125 25.887500000000003 50-51 24.3625 25.124999999999996 24.6625 25.85 52-53 24.4 24.337500000000002 25.7 25.5625 54-55 23.8875 26.1125 25.2125 24.7875 56-57 23.75 25.937500000000004 24.6875 25.624999999999996 58-59 23.35 25.025 25.6125 26.0125 60-61 23.2625 26.125 24.9375 25.674999999999997 62-63 23.8875 24.725 25.6 25.7875 64-65 24.45 24.9125 24.837500000000002 25.8 66-67 23.071151681880707 25.17193947730399 25.647117669125922 26.109791171689384 68-69 23.468367091772944 24.88122030507627 25.36884221055264 26.281570392598148 70-71 23.8404800600075 25.2281535191899 25.378172271533945 25.55319414926866 72-73 23.7125 25.35 25.05 25.887500000000003 74-75 23.875 24.75 26.387500000000003 24.9875 76-77 23.7375 25.25 24.9375 26.075 78-79 24.1875 25.474999999999998 24.125 26.2125 80-81 23.5 25.650000000000002 25.5625 25.2875 82-83 24.5375 26.05 23.3 26.1125 84-85 24.762500000000003 25.5 24.4125 25.324999999999996 86-87 24.0125 25.412499999999998 24.7875 25.7875 88-89 24.587500000000002 25.825 24.875 24.712500000000002 90-91 24.2625 24.962500000000002 25.137500000000003 25.637500000000003 92-93 24.837500000000002 25.8625 24.5 24.8 94-95 23.974999999999998 25.5 24.2875 26.237500000000004 96-97 23.8375 25.9875 24.65 25.525 98-99 24.4375 25.650000000000002 24.5 25.412499999999998 100-101 24.712500000000002 25.674999999999997 24.099999999999998 25.5125 102-103 25.2 26.85 23.95 24.0 104-105 25.2375 26.125 23.825 24.8125 106-107 25.2125 25.7875 23.400000000000002 25.6 108-109 24.7 26.724999999999998 22.787499999999998 25.7875 110-111 24.25 27.1625 22.7125 25.874999999999996 112-113 25.5 26.887499999999996 22.8375 24.775 114-115 24.8125 26.150000000000002 23.549999999999997 25.4875 116-117 24.7375 26.875 22.375 26.0125 118-119 25.025 27.5875 22.225 25.162499999999998 120-121 23.962500000000002 27.275 22.85 25.912499999999998 122-123 24.725 27.0625 22.325 25.887500000000003 124-125 24.125 26.924999999999997 22.3625 26.5875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 2.0 27 2.5 28 2.5 29 4.5 30 5.5 31 13.0 32 19.0 33 22.0 34 32.0 35 42.5 36 51.0 37 70.0 38 88.5 39 98.0 40 117.0 41 149.0 42 170.0 43 189.0 44 198.5 45 186.0 46 192.0 47 192.5 48 179.5 49 172.5 50 157.0 51 132.0 52 122.0 53 120.5 54 116.5 55 103.0 56 96.0 57 101.0 58 81.0 59 71.5 60 68.0 61 55.0 62 56.0 63 63.0 64 64.5 65 55.5 66 50.5 67 48.0 68 46.0 69 42.0 70 35.0 71 29.5 72 26.0 73 21.0 74 11.0 75 7.0 76 7.5 77 4.5 78 3.0 79 3.5 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0125 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0125 40-41 0.0125 42-43 0.025 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0375 68-69 0.025 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26915322580645 98.475 2 0.655241935483871 1.3 3 0.07560483870967742 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.21250000000000002 0.0 0.0 0.0 0.0 68-69 0.2625 0.0 0.0 0.0 0.0 70-71 0.375 0.0 0.0 0.0 0.0 72-73 0.4375 0.0 0.0 0.0 0.0 74-75 0.5875 0.0 0.0 0.0 0.0 76-77 0.8 0.0 0.0 0.0 0.0 78-79 0.975 0.0 0.0 0.0 0.0 80-81 1.1 0.0 0.0 0.0 0.0 82-83 1.4 0.0 0.0 0.0 0.0 84-85 1.625 0.0 0.0 0.0 0.0 86-87 2.05 0.0 0.0 0.0 0.0 88-89 2.525 0.0 0.0 0.0 0.0 90-91 3.15 0.0 0.0 0.0 0.0 92-93 3.9625 0.0 0.0 0.0 0.0 94-95 5.25 0.0 0.0 0.0 0.0 96-97 6.4375 0.0 0.0 0.0 0.0 98-99 7.4875 0.0 0.0 0.0 0.0 100-101 8.55 0.0 0.0 0.0 0.0 102-103 10.024999999999999 0.0 0.0 0.0 0.0 104-105 11.6125 0.0 0.0 0.0 0.0 106-107 13.475 0.0 0.0 0.0 0.0 108-109 15.3375 0.0 0.0 0.0 0.0 110-111 17.575 0.0 0.0 0.0 0.0 112-113 19.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3692159 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3692159_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95175 33.0 33.0 34.0 32.0 34.0 2 33.0295 34.0 33.0 34.0 32.0 34.0 3 33.00975 34.0 33.0 34.0 32.0 34.0 4 32.9955 34.0 33.0 34.0 32.0 34.0 5 33.10075 34.0 33.0 34.0 32.0 34.0 6 37.111 38.0 38.0 38.0 36.0 38.0 7 37.14825 38.0 38.0 38.0 36.0 38.0 8 37.1665 38.0 38.0 38.0 37.0 38.0 9 37.0225 38.0 38.0 38.0 36.0 38.0 10-11 37.12925 38.0 38.0 38.0 36.5 38.0 12-13 37.082875 38.0 38.0 38.0 36.0 38.0 14-15 37.077 38.0 38.0 38.0 36.0 38.0 16-17 37.155875 38.0 38.0 38.0 37.0 38.0 18-19 37.08175 38.0 38.0 38.0 36.5 38.0 20-21 37.159875 38.0 38.0 38.0 36.5 38.0 22-23 37.133250000000004 38.0 38.0 38.0 37.0 38.0 24-25 37.149249999999995 38.0 38.0 38.0 37.0 38.0 26-27 37.122875 38.0 38.0 38.0 37.0 38.0 28-29 37.109875 38.0 38.0 38.0 37.0 38.0 30-31 37.19175 38.0 38.0 38.0 37.0 38.0 32-33 37.19625 38.0 38.0 38.0 37.0 38.0 34-35 37.165 38.0 38.0 38.0 37.0 38.0 36-37 37.173 38.0 38.0 38.0 37.0 38.0 38-39 37.207375 38.0 38.0 38.0 37.0 38.0 40-41 37.183375 38.0 38.0 38.0 37.0 38.0 42-43 37.21875 38.0 38.0 38.0 37.0 38.0 44-45 37.1515 38.0 38.0 38.0 37.0 38.0 46-47 37.09075 38.0 38.0 38.0 36.5 38.0 48-49 37.10325 38.0 38.0 38.0 36.5 38.0 50-51 37.107749999999996 38.0 38.0 38.0 36.5 38.0 52-53 37.14925 38.0 38.0 38.0 37.0 38.0 54-55 37.127125 38.0 38.0 38.0 37.0 38.0 56-57 37.088750000000005 38.0 38.0 38.0 36.5 38.0 58-59 37.051625 38.0 38.0 38.0 36.5 38.0 60-61 37.066374999999994 38.0 38.0 38.0 36.0 38.0 62-63 37.112375 38.0 38.0 38.0 36.5 38.0 64-65 37.177375 38.0 38.0 38.0 37.0 38.0 66-67 37.094625 38.0 38.0 38.0 36.0 38.0 68-69 37.06075 38.0 38.0 38.0 36.0 38.0 70-71 37.028999999999996 38.0 38.0 38.0 36.0 38.0 72-73 37.015375 38.0 38.0 38.0 36.0 38.0 74-75 37.0165 38.0 38.0 38.0 36.0 38.0 76-77 37.013125 38.0 38.0 38.0 36.0 38.0 78-79 37.045 38.0 38.0 38.0 36.0 38.0 80-81 36.971125 38.0 38.0 38.0 36.0 38.0 82-83 36.999625 38.0 38.0 38.0 36.0 38.0 84-85 36.980875 38.0 38.0 38.0 36.0 38.0 86-87 36.97175 38.0 38.0 38.0 35.5 38.0 88-89 36.86625 38.0 38.0 38.0 35.5 38.0 90-91 36.92725 38.0 38.0 38.0 35.5 38.0 92-93 36.90275 38.0 38.0 38.0 35.5 38.0 94-95 36.820750000000004 38.0 38.0 38.0 35.0 38.0 96-97 36.837500000000006 38.0 38.0 38.0 35.0 38.0 98-99 36.931 38.0 38.0 38.0 36.0 38.0 100-101 36.823375 38.0 38.0 38.0 35.0 38.0 102-103 36.792875 38.0 38.0 38.0 35.0 38.0 104-105 36.596875 38.0 38.0 38.0 34.5 38.0 106-107 36.5255 38.0 38.0 38.0 34.0 38.0 108-109 36.607875 38.0 38.0 38.0 34.0 38.0 110-111 36.443375 38.0 38.0 38.0 34.0 38.0 112-113 36.289125 38.0 38.0 38.0 34.0 38.0 114-115 36.3135 38.0 38.0 38.0 33.0 38.0 116-117 36.326750000000004 38.0 38.0 38.0 33.0 38.0 118-119 36.08825 38.0 38.0 38.0 32.5 38.0 120-121 36.155375 38.0 38.0 38.0 32.0 38.0 122-123 36.012875 38.0 38.0 38.0 32.5 38.0 124-125 35.881125 38.0 38.0 38.0 31.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10-11 0.0 2309 12-13 0.0 2309 14-15 0.0 2309 16-17 0.0 2309 18-19 0.0 2309 20-21 0.0 2309 22-23 0.0 2309 24-25 0.0 2309 26-27 0.0 2309 28-29 0.0 2309 30-31 0.0 2309 32-33 0.0 2309 34-35 0.0 2309 36-37 0.0 2309 38-39 0.0 2309 40-41 0.0 2309 42-43 0.0 2309 44-45 0.0 2309 46-47 0.0 2309 48-49 0.0 2309 50-51 0.0 2309 52-53 0.0 2309 54-55 0.0 2309 56-57 0.0 2309 58-59 0.0 2309 60-61 0.0 2309 62-63 0.0 2309 64-65 0.0 2309 66-67 0.0 2309 68-69 0.0 2309 70-71 0.0 2309 72-73 0.0 2309 74-75 0.0 2309 76-77 0.0 2309 78-79 0.0 2309 80-81 0.0 2309 82-83 0.0 2309 84-85 0.0 2309 86-87 0.0 2309 88-89 0.0 2309 90-91 0.0 2309 92-93 0.0 2309 94-95 0.0 2309 96-97 0.0 2309 98-99 0.0 2309 100-101 0.0 2309 102-103 0.0 2309 104-105 0.0 2309 106-107 0.0 2309 108-109 0.0 2309 110-111 0.0 2309 112-113 0.0 2309 114-115 0.0 2309 116-117 0.0 2309 118-119 0.0 2309 120-121 0.0 2309 122-123 0.0 2309 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 3.0 18 2.0 19 1.0 20 4.0 21 5.0 22 3.0 23 9.0 24 8.0 25 10.0 26 14.0 27 21.0 28 25.0 29 27.0 30 35.0 31 45.0 32 50.0 33 86.0 34 101.0 35 123.0 36 313.0 37 3113.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.324999999999996 19.625 10.6 30.45 2 29.675 22.7 28.125 19.5 3 23.425 25.374999999999996 27.275 23.925 4 28.050000000000004 29.875 20.474999999999998 21.6 5 29.375 30.825000000000003 18.6 21.2 6 23.400000000000002 35.55 20.150000000000002 20.9 7 23.0 18.0 34.5 24.5 8 23.325000000000003 22.575 23.95 30.15 9 24.125 22.05 27.900000000000002 25.924999999999997 10-11 26.937499999999996 27.675 21.212500000000002 24.175 12-13 26.3 23.1375 24.587500000000002 25.974999999999998 14-15 24.762500000000003 25.7625 25.412499999999998 24.0625 16-17 26.424999999999997 24.9125 24.2 24.462500000000002 18-19 25.25 25.424999999999997 24.6 24.725 20-21 25.9875 25.3125 24.462500000000002 24.2375 22-23 25.4625 25.387500000000003 24.4 24.75 24-25 25.587500000000002 25.124999999999996 24.5375 24.75 26-27 26.525 25.0 24.224999999999998 24.25 28-29 26.224999999999998 24.6125 24.7 24.462500000000002 30-31 26.1625 24.6875 25.374999999999996 23.775 32-33 25.2125 25.374999999999996 24.675 24.7375 34-35 26.337500000000002 24.875 24.962500000000002 23.825 36-37 26.6 24.4 24.625 24.375 38-39 25.974999999999998 25.275 25.25 23.5 40-41 25.900000000000002 25.4375 24.474999999999998 24.1875 42-43 25.5625 25.0375 25.45 23.95 44-45 25.7375 25.6 24.8625 23.799999999999997 46-47 26.6625 24.625 24.7875 23.925 48-49 26.575 24.712500000000002 24.575 24.1375 50-51 25.575 26.1125 24.8125 23.5 52-53 26.387500000000003 25.162499999999998 24.5 23.95 54-55 26.424999999999997 23.525 25.874999999999996 24.175 56-57 25.2375 25.224999999999998 25.6125 23.925 58-59 25.924999999999997 25.974999999999998 24.837500000000002 23.2625 60-61 25.8 25.1 25.575 23.525 62-63 25.95 24.975 24.975 24.099999999999998 64-65 26.3 25.162499999999998 24.887500000000003 23.65 66-67 25.5 25.137500000000003 25.95 23.4125 68-69 25.124999999999996 26.0 24.575 24.3 70-71 25.95 24.575 25.8625 23.6125 72-73 25.074999999999996 25.337500000000002 25.912499999999998 23.674999999999997 74-75 25.587500000000002 24.675 25.15 24.587500000000002 76-77 26.3625 24.7375 24.95 23.95 78-79 25.937500000000004 25.087500000000002 25.2625 23.7125 80-81 25.4875 25.924999999999997 25.2125 23.375 82-83 26.187500000000004 25.8625 25.5375 22.412499999999998 84-85 24.575 25.687500000000004 25.362499999999997 24.375 86-87 25.575 25.8 24.6 24.025 88-89 26.0375 25.1 24.675 24.1875 90-91 26.1 26.1 24.7875 23.0125 92-93 25.05 26.1625 25.074999999999996 23.7125 94-95 26.737499999999997 25.825 24.825 22.6125 96-97 27.0625 25.5375 24.349999999999998 23.05 98-99 26.924999999999997 26.05 24.275 22.75 100-101 27.875 25.837500000000002 23.4875 22.8 102-103 27.3 27.0625 23.625 22.0125 104-105 27.5625 26.1125 24.45 21.875 106-107 27.35 26.85 23.5 22.3 108-109 27.6375 26.775 24.025 21.5625 110-111 27.700000000000003 27.55 23.5125 21.2375 112-113 28.4 25.8625 24.2875 21.45 114-115 28.712500000000002 26.5375 23.65 21.099999999999998 116-117 29.6875 26.8375 22.55 20.925 118-119 28.9 27.725 22.662499999999998 20.7125 120-121 29.8375 27.6125 22.6875 19.8625 122-123 29.9375 27.975 22.412499999999998 19.675 124-125 30.875000000000004 26.875 22.787499999999998 19.4625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.0 26 1.5 27 2.0 28 4.5 29 5.0 30 7.5 31 11.5 32 15.0 33 16.5 34 26.5 35 40.0 36 50.5 37 57.0 38 70.5 39 94.5 40 113.0 41 147.0 42 171.5 43 176.5 44 190.5 45 193.0 46 181.0 47 169.0 48 173.5 49 175.5 50 168.0 51 148.5 52 116.5 53 112.5 54 113.5 55 112.5 56 107.0 57 93.5 58 83.0 59 85.0 60 83.0 61 71.5 62 64.5 63 60.0 64 59.5 65 55.5 66 50.0 67 53.5 68 50.5 69 46.0 70 42.5 71 27.5 72 22.5 73 22.5 74 18.0 75 12.0 76 10.0 77 6.5 78 4.0 79 2.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.21250000000000002 0.0 0.0 0.0 0.0 66-67 0.2375 0.0 0.0 0.0 0.0 68-69 0.30000000000000004 0.0 0.0 0.0 0.0 70-71 0.42500000000000004 0.0 0.0 0.0 0.0 72-73 0.48750000000000004 0.0 0.0 0.0 0.0 74-75 0.6375 0.0 0.0 0.0 0.0 76-77 0.8500000000000001 0.0 0.0 0.0 0.0 78-79 1.0 0.0 0.0 0.0 0.0 80-81 1.1 0.0 0.0 0.0 0.0 82-83 1.4 0.0 0.0 0.0 0.0 84-85 1.625 0.0 0.0 0.0 0.0 86-87 2.05 0.0 0.0 0.0 0.0 88-89 2.55 0.0 0.0 0.0 0.0 90-91 3.2 0.0 0.0 0.0 0.0 92-93 4.0375 0.0 0.0 0.0 0.0 94-95 5.275 0.0 0.0 0.0 0.0 96-97 6.4 0.0 0.0 0.0 0.0 98-99 7.4125 0.0 0.0 0.0 0.0 100-101 8.5125 0.0 0.0 0.0 0.0 102-103 10.0125 0.0 0.0 0.0 0.0 104-105 11.537500000000001 0.0 0.0 0.0 0.0 106-107 13.3 0.0 0.0 0.0 0.0 108-109 15.149999999999999 0.0 0.0 0.0 0.0 110-111 17.325 0.0 0.0 0.0 0.0 112-113 19.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1117925 spots for SRR3692159.sra Written 1117925 spots for SRR3692159.sra Read 1117925 spots for SRR3692159.sra Written 1117925 spots for SRR3692159.sra Read 1117925 spots for SRR3692159.sra Written 1117925 spots for SRR3692159.sra Read 1117925 spots for SRR3692159.sra Written 1117925 spots for SRR3692159.sra Read 1117925 spots for SRR3692159.sra Written 1117925 spots for SRR3692159.sra Read 1117925 spots for SRR3692159.sra Written 1117925 spots for SRR3692159.sra Read 1117925 spots for SRR3692159.sra Written 1117925 spots for SRR3692159.sra Read 1117925 spots for SRR3692159.sra Written 1117925 spots for SRR3692159.sra Read 1117925 spots for SRR3692159.sra Written 1117925 spots for SRR3692159.sra Read 1117925 spots for SRR3692159.sra Written 1117925 spots for SRR3692159.sra Read 1117925 spots for SRR3692159.sra Written 1117925 spots for SRR3692159.sra Read 1117925 spots for SRR3692159.sra Written 1117925 spots for SRR3692159.sra Read 1117925 spots for SRR3692159.sra Written 1117925 spots for SRR3692159.sra Read 1117925 spots for SRR3692159.sra Written 1117925 spots for SRR3692159.sra Read 1117925 spots for SRR3692159.sra Written 1117925 spots for SRR3692159.sra Read 1117937 spots for SRR3692159.sra Written 1117937 spots for SRR3692159.sra Read 1117925 spots for SRR3692159.sra Written 1117925 spots for SRR3692159.sra Read 1117925 spots for SRR3692159.sra Written 1117925 spots for SRR3692159.sra Read 1117925 spots for SRR3692159.sra Written 1117925 spots for SRR3692159.sra Read 1117925 spots for SRR3692159.sra Written 1117925 spots for SRR3692159.sra SRR ids: ['SRR3692159.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3zzn6zza SRR3692159.sra spots: 22358512 blocks: [[1, 1117925], [1117926, 2235850], [2235851, 3353775], [3353776, 4471700], [4471701, 5589625], [5589626, 6707550], [6707551, 7825475], [7825476, 8943400], [8943401, 10061325], [10061326, 11179250], [11179251, 12297175], [12297176, 13415100], [13415101, 14533025], [14533026, 15650950], [15650951, 16768875], [16768876, 17886800], [17886801, 19004725], [19004726, 20122650], [20122651, 21240575], [21240576, 22358512]] SRR3692159 file size 7117781 SRR3692159 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3692159 SRR3692159_1.fastq SRR3692159_2.fastq Input file: SRR3692159_1.fastq Paired file: SRR3692159_2.fastq trimmed: SRR3692159-trimmed-pair1.fastq, SRR3692159-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:13:22 2024 >> started Tue Dec 10 00:13:46 2024 >> done (23.658s) 22358512 read pairs processed; of these: 269 ( 0.00%) short read pairs filtered out after trimming by size control 6371 ( 0.03%) empty read pairs filtered out after trimming by size control 22351872 (99.97%) read pairs available; of these: 7923794 (35.45%) trimmed read pairs available after processing 14428078 (64.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 3 0.00% 21 6 0.00% 22 7 0.00% 23 3 0.00% 24 6 0.00% 25 7 0.00% 26 8 0.00% 27 18 0.00% 28 20 0.00% 29 20 0.00% 30 29 0.00% 31 45 0.00% 32 50 0.00% 33 72 0.00% 34 62 0.00% 35 69 0.00% 36 110 0.00% 37 99 0.00% 38 144 0.00% 39 159 0.00% 40 174 0.00% 41 239 0.00% 42 296 0.00% 43 304 0.00% 44 315 0.00% 45 389 0.00% 46 434 0.00% 47 524 0.00% 48 637 0.00% 49 789 0.00% 50 886 0.00% 51 981 0.00% 52 1096 0.00% 53 1207 0.01% 54 1324 0.01% 55 1388 0.01% 56 1526 0.01% 57 1735 0.01% 58 2028 0.01% 59 2467 0.01% 60 2831 0.01% 61 3387 0.02% 62 3783 0.02% 63 4223 0.02% 64 4658 0.02% 65 4979 0.02% 66 5494 0.02% 67 6342 0.03% 68 6839 0.03% 69 7848 0.04% 70 9033 0.04% 71 10643 0.05% 72 12097 0.05% 73 14093 0.06% 74 15802 0.07% 75 17113 0.08% 76 18995 0.08% 77 20436 0.09% 78 22397 0.10% 79 25121 0.11% 80 28427 0.13% 81 32098 0.14% 82 36667 0.16% 83 41637 0.19% 84 47160 0.21% 85 51968 0.23% 86 56065 0.25% 87 60836 0.27% 88 65873 0.29% 89 70326 0.31% 90 76917 0.34% 91 84612 0.38% 92 92640 0.41% 93 102449 0.46% 94 112750 0.50% 95 121461 0.54% 96 128799 0.58% 97 136251 0.61% 98 141646 0.63% 99 148072 0.66% 100 158029 0.71% 101 165493 0.74% 102 175835 0.79% 103 189020 0.85% 104 198194 0.89% 105 209491 0.94% 106 216450 0.97% 107 220474 0.99% 108 225596 1.01% 109 231809 1.04% 110 236770 1.06% 111 240952 1.08% 112 249726 1.12% 113 256036 1.15% 114 264615 1.18% 115 274459 1.23% 116 278493 1.25% 117 279104 1.25% 118 278160 1.24% 119 275259 1.23% 120 276834 1.24% 121 303572 1.36% 122 277025 1.24% 123 281661 1.26% 124 288286 1.29% 125 14428078 64.55% 22351872 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=31 prefix-density=0.23 prefix-fanout=1.9 sequence=ACCCGAACATGGGAAGCTTCCACATTGTCCAGTACCTGCCGTCGTAGTACCCGGGAGAGTTGCCGTGCTCACGGAAGACGAAACCGACCTTGCTGAACTCGAGGCAAGGAACCCACTTGGAGCGGATGAGATACTCGATCTGCTTCAAGAGGGACTCCACGGTGAGAGGCGGCAGGTAGGAAAGGGTTTCGAACTTCTTGATGCCCTCAATTGGCCACACCTGCATGCACCTGATCCTTCCACCGTTGGAGACGCTGCCGAGACCAGCGCTGGCTGAGCGGCGGCCGATGGGGAGCCCGGCGGTGGACTTGAGGCCCTGGAAAGGAGCAACGGCAGTAGCCGCTGACGACATCACTGTGGGAGCCATCGTACACGTACGTAGATAGCTAACAAGAGGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=299.80 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=17.0 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=32 prefix-density=0.28 prefix-fanout=2.3 sequence=CCATGTTCGGGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=143.41 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=18.3 sequence=GAAGAAGAAGAAACAACTCCGGCCATGGCGGGCATCATCCACAAGATCGAGGAGAAGCTCCACATGGGCGGTGGCAGCGACCACAAGGACGAGCACAAGAA SRR3692159 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:14:31 Started mapping on | Dec 10 00:14:31 Finished on | Dec 10 00:16:18 Mapping speed, Million of reads per hour | 752.03 Number of input reads | 22351872 Average input read length | 237 UNIQUE READS: Uniquely mapped reads number | 20943121 Uniquely mapped reads % | 93.70% Average mapped length | 237.16 Number of splices: Total | 15465560 Number of splices: Annotated (sjdb) | 14522736 Number of splices: GT/AG | 15251900 Number of splices: GC/AG | 181643 Number of splices: AT/AC | 7879 Number of splices: Non-canonical | 24138 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.02 Insertion rate per base | 0.01% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 473467 % of reads mapped to multiple loci | 2.12% Number of reads mapped to too many loci | 82660 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.51% % of reads unmapped: other | 1.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 935606 935606 935606 N_multimapping 473467 473467 473467 N_noFeature 944850 20334091 1147670 N_ambiguous 460818 2042 54671 UnstrandedReadsAssigned:19537453 PositiveStrandReadsAssigned:606988 NegativeStrandReadsAssigned:19740780 Dataset is classified negative stranded MeadianReadLen=125 20thPercentileLength=112 echo kmer=107 SRR3692159 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR3692159-trimmed-pair1.fastq SRR3692159-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,351,872 reads, 19,986,269 reads pseudoaligned [quant] estimated average fragment length: 142.184 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52973 SRR3692159.ke.tsv 35125 SRR3692159.se.tsv 88098 total ==> SRR3692159.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 794.879 0 0 PNS24247 1044 902.816 58.8364 4.94949 PNS24249 1928 1786.82 176.33 7.49479 PNS24246 1044 902.816 58.8364 4.94949 PNS24248 1044 902.816 58.8364 4.94949 PNS24244 1471 1329.82 132.161 7.54789 PNS24243 293 153.679 0 0 KQK14069 1603 1461.82 37429.8 1944.64 KQK14071 474 333.698 2764.77 629.243 ==> SRR3692159.se.tsv <== BRADI_1g14170v3 45004 BRADI_1g53295v3 29 BRADI_1g59795v3 1494 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 180 BRADI_1g74790v3 204 BRADI_1g09890v3 0 BRADI_1g77505v3 365 BRADI_1g48960v3 0 SRR3692159 completed mapping pipeline successfully