Starting /dee2/code/volunteer_pipeline.sh SRR4094486 current disk space = 1543267147776 free memory = 1597853636 SRR4094486 SRAfilesize cdbb788baa685d36516f52a499d932ad SRR4094486.sra SRR4094486.sra file validated SRR4094486 is paired end SRR4094486 is conventional basespace SRR4094486 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4094486_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.60725 34.0 31.0 34.0 31.0 34.0 2 32.40075 34.0 31.0 34.0 31.0 34.0 3 33.0485 34.0 33.0 34.0 31.0 34.0 4 36.454 37.0 37.0 37.0 35.0 37.0 5 36.3685 37.0 37.0 37.0 35.0 37.0 6 36.43525 37.0 37.0 37.0 35.0 37.0 7 36.449 37.0 37.0 37.0 35.0 37.0 8 36.46575 37.0 37.0 37.0 35.0 37.0 9 38.32525 39.0 39.0 39.0 37.0 39.0 10-14 38.3822 39.4 38.8 39.4 36.6 39.4 15-19 39.7284 41.0 40.0 41.0 37.2 41.0 20-24 39.51565 41.0 39.4 41.0 36.8 41.0 25-29 39.27755 40.8 39.0 41.0 36.0 41.0 30-34 38.976299999999995 40.2 38.4 41.0 35.0 41.0 35-39 38.6988 40.0 38.0 41.0 34.6 41.0 40-44 38.2281 40.0 37.2 41.0 33.8 41.0 45-49 38.01835 40.0 36.4 41.0 33.4 41.0 50-54 37.908950000000004 39.8 35.4 41.0 33.4 41.0 55-59 37.10745 38.6 35.0 41.0 32.8 41.0 60-64 36.6633 37.4 35.0 40.4 32.8 41.0 65-69 35.91375 36.2 35.0 39.4 32.2 41.0 70-74 34.919200000000004 35.0 34.2 37.8 30.6 39.8 75-79 34.23315 35.0 33.8 36.2 30.6 38.6 80-84 33.88325 35.0 34.0 35.4 30.8 36.8 85-89 33.308749999999996 35.0 34.0 35.0 29.6 36.0 90-94 32.92345 35.0 33.6 35.0 29.6 35.2 95-99 32.54825 35.0 33.0 35.0 27.6 35.0 100-104 32.134699999999995 35.0 32.8 35.0 26.6 35.0 105-109 31.912149999999997 35.0 32.6 35.0 25.6 35.0 110-114 31.819100000000002 35.0 32.4 35.0 24.8 35.0 115-119 31.529149999999998 34.6 31.8 35.0 24.6 35.0 120-124 31.32605 34.4 32.0 35.0 24.0 35.0 125-129 30.842950000000002 34.0 31.0 35.0 22.6 35.0 130-134 30.318550000000005 34.0 30.8 35.0 19.4 35.0 135-139 29.442700000000002 34.0 29.4 35.0 13.0 35.0 140-144 28.626099999999997 33.6 28.2 35.0 3.6 35.0 145-149 27.317500000000003 33.2 26.6 35.0 2.0 35.0 150 23.842 30.0 18.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 3.0 7 3.0 8 1.0 9 4.0 10 2.0 11 5.0 12 4.0 13 4.0 14 7.0 15 12.0 16 12.0 17 9.0 18 10.0 19 12.0 20 11.0 21 9.0 22 15.0 23 18.0 24 25.0 25 29.0 26 40.0 27 45.0 28 83.0 29 76.0 30 93.0 31 130.0 32 174.0 33 253.0 34 352.0 35 540.0 36 1019.0 37 982.0 38 18.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.626146188105842 8.697930311763164 10.138852501964895 50.5370709981661 2 23.35 13.5 34.825 28.325 3 22.6 16.525000000000002 20.775 40.1 4 29.008016032064127 24.248496993987974 19.163326653306616 27.580160320641284 5 27.056764191047762 30.532633158289574 21.05526381595399 21.355338834708675 6 23.025000000000002 32.05 23.425 21.5 7 19.15 21.5 38.725 20.625 8 22.3 21.75 30.099999999999998 25.85 9 20.95 20.3 33.125 25.624999999999996 10-14 23.435 25.64 24.759999999999998 26.165 15-19 23.995 24.735 24.535 26.735 20-24 24.215 24.51 25.130000000000003 26.145000000000003 25-29 24.240000000000002 24.505 24.37 26.884999999999998 30-34 23.990000000000002 24.725 25.130000000000003 26.155 35-39 23.73 24.735 24.485 27.05 40-44 24.8 24.695 24.265 26.240000000000002 45-49 24.11 24.515 24.54 26.834999999999997 50-54 24.285 24.69 23.845 27.18 55-59 24.755 23.95 24.46 26.834999999999997 60-64 25.04250425042504 23.862386238623863 24.327432743274326 26.767676767676768 65-69 24.845 23.865 24.415 26.875 70-74 25.074999999999996 24.365000000000002 24.51 26.05 75-79 25.05 24.115000000000002 24.175 26.66 80-84 25.221261063053152 23.92119605980299 24.286214310715536 26.57132856642832 85-89 25.569999999999997 23.505000000000003 23.995 26.93 90-94 25.555 23.880000000000003 23.845 26.72 95-99 25.745 23.535 23.86 26.86 100-104 25.545 23.95 23.849999999999998 26.655 105-109 25.75 23.7 24.145 26.405 110-114 25.929999999999996 23.895 23.7 26.474999999999998 115-119 25.569999999999997 23.380000000000003 23.880000000000003 27.169999999999998 120-124 25.855 23.57 23.69 26.884999999999998 125-129 25.869999999999997 23.21 23.830000000000002 27.089999999999996 130-134 25.679999999999996 23.14 24.295 26.884999999999998 135-139 26.61 23.26 23.599999999999998 26.529999999999998 140-144 26.5 23.515 23.995 25.990000000000002 145-149 25.755 23.61 23.57 27.065 150 27.091733870967744 23.4375 22.73185483870968 26.73891129032258 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 1.0 27 1.0 28 4.5 29 7.0 30 7.0 31 10.5 32 16.0 33 23.5 34 30.5 35 36.0 36 46.0 37 63.5 38 73.5 39 86.0 40 102.5 41 134.5 42 168.0 43 159.5 44 162.5 45 171.5 46 172.5 47 169.5 48 148.0 49 137.0 50 136.5 51 133.0 52 123.5 53 107.0 54 92.0 55 81.5 56 84.0 57 86.0 58 73.5 59 83.0 60 97.5 61 88.5 62 73.5 63 70.0 64 84.5 65 89.0 66 72.0 67 73.0 68 74.5 69 57.5 70 47.0 71 41.5 72 42.5 73 39.5 74 33.0 75 28.0 76 17.0 77 10.0 78 8.5 79 7.5 80 4.0 81 1.5 82 2.5 83 2.0 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.575 2 0.0 3 0.0 4 0.2 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.01 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.8 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83485309017223 97.55 2 1.038500506585613 2.0500000000000003 3 0.10131712259371835 0.3 4 0.025329280648429587 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.037500000000000006 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.1125 0.0 0.0 0.0 0.0 110-111 0.1625 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.30000000000000004 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.5125 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.6125 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.8 0.0 0.0 0.0 0.0 128-129 0.8374999999999999 0.0 0.0 0.0 0.0 130-131 0.95 0.0 0.0 0.0 0.0 132-133 1.225 0.0 0.0 0.0 0.0 134-135 1.525 0.0 0.0 0.0 0.0 136-137 1.9 0.0 0.0 0.0 0.0 138 2.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4094486 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4094486_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.584 34.0 31.0 34.0 30.0 34.0 2 32.00975 34.0 31.0 34.0 30.0 34.0 3 32.125 34.0 31.0 34.0 30.0 34.0 4 35.52475 37.0 37.0 37.0 33.0 37.0 5 35.6655 37.0 37.0 37.0 35.0 37.0 6 35.629 37.0 37.0 37.0 35.0 37.0 7 35.6475 37.0 37.0 37.0 35.0 37.0 8 35.665 37.0 37.0 37.0 35.0 37.0 9 37.38275 39.0 38.0 39.0 35.0 39.0 10-14 37.0831 39.4 37.8 39.4 33.4 39.4 15-19 38.18245 41.0 38.8 41.0 33.8 41.0 20-24 38.1973 40.8 38.6 41.0 33.4 41.0 25-29 37.6255 40.0 38.0 41.0 31.2 41.0 30-34 36.930899999999994 40.0 37.8 41.0 30.6 41.0 35-39 36.83075 40.0 37.4 41.0 30.6 41.0 40-44 36.5476 40.0 35.8 41.0 30.0 41.0 45-49 35.87585 39.0 35.0 41.0 29.8 41.0 50-54 34.533100000000005 38.2 34.0 40.4 25.0 41.0 55-59 33.8092 36.4 33.6 40.0 22.6 41.0 60-64 33.4739 35.2 33.4 39.6 23.6 41.0 65-69 32.56425 35.0 33.0 38.4 20.4 40.6 70-74 31.503149999999998 35.0 32.6 36.6 11.0 39.2 75-79 30.640749999999997 35.0 31.8 35.4 2.6 37.4 80-84 29.851049999999997 35.0 31.0 35.0 2.0 36.2 85-89 29.112599999999997 34.4 30.0 35.0 2.0 35.4 90-94 28.632399999999997 34.0 29.2 35.0 2.0 35.0 95-99 28.0238 34.0 28.2 35.0 2.0 35.0 100-104 27.372200000000003 34.0 26.6 35.0 2.0 35.0 105-109 26.5786 33.0 24.0 35.0 2.0 35.0 110-114 26.20285 33.0 23.2 35.0 2.0 35.0 115-119 25.1419 32.4 18.2 35.0 2.0 35.0 120-124 24.472700000000003 32.0 12.8 35.0 2.0 35.0 125-129 23.6589 31.4 5.6 34.4 2.0 35.0 130-134 22.5053 30.0 2.0 34.0 2.0 35.0 135-139 21.7015 29.2 2.0 34.0 2.0 35.0 140-144 20.58365 28.6 2.0 34.0 2.0 35.0 145-149 19.072599999999998 26.4 2.0 33.6 2.0 35.0 150 15.91775 18.0 2.0 31.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 51.0 3 13.0 4 9.0 5 17.0 6 23.0 7 28.0 8 22.0 9 35.0 10 32.0 11 24.0 12 37.0 13 29.0 14 36.0 15 23.0 16 24.0 17 27.0 18 41.0 19 45.0 20 52.0 21 45.0 22 60.0 23 60.0 24 63.0 25 71.0 26 73.0 27 89.0 28 107.0 29 98.0 30 118.0 31 143.0 32 173.0 33 287.0 34 362.0 35 533.0 36 729.0 37 417.0 38 4.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.268185348174995 13.668133574941754 12.322029510742945 45.741651566140305 2 27.790432801822323 20.577069096431284 30.09364717792964 21.538850923816753 3 22.742221097900327 26.00556539337212 24.032380470528715 27.219833038198836 4 27.40070387129211 29.135243841126197 17.67219708396179 25.791855203619914 5 29.40735183795949 30.107526881720432 20.205051262815704 20.280070017504375 6 24.2539200809307 35.306019221041986 19.271623672230653 21.16843702579666 7 21.95 16.925 33.85 27.275 8 22.95 21.349999999999998 24.85 30.85 9 24.975 20.65 27.1 27.275 10-14 26.894381566258946 24.397299903567983 21.367304471400296 27.341014058772778 15-19 26.214332943390467 24.312089924215453 22.6438126239764 26.829764508417682 20-24 26.298309178743963 24.169685990338163 22.589573268921097 26.942431561996777 25-29 25.8335007029524 24.638481622815828 22.89616388833099 26.631853785900784 30-34 26.57600081803773 24.06053479216729 22.54205225216013 26.821412137634848 35-39 26.776649746192895 24.197969543147206 22.664974619289342 26.360406091370557 40-44 26.490000000000002 23.724999999999998 22.68 27.105 45-49 27.015 23.68 22.875 26.43 50-54 26.74318216444061 23.97034178050886 22.53313696612666 26.753339088923873 55-59 26.97152106833932 23.213111437098487 22.570691486671052 27.244676007891144 60-64 27.231361568078405 23.471173558677936 22.636131806590328 26.66133306665333 65-69 26.856049158859673 23.77354689231389 22.91225949430845 26.458144454517978 70-74 27.438650306748468 23.512269938650306 22.20347648261759 26.84560327198364 75-79 26.717403356685647 23.577440653192884 22.77102968600373 26.934126304117733 80-84 28.146143437077132 22.868741542625166 22.33248133112815 26.652633689169548 85-89 27.3455204713703 22.96922999446039 22.687213577076093 26.998035957093215 90-94 28.15722307299643 23.5732516590097 21.602858601327206 26.666666666666668 95-99 27.376942028256824 23.475287847553926 22.670823068027556 26.4769470561617 100-104 28.052013003250813 23.270817704426104 22.520630157539383 26.156539134783696 105-109 26.949246509752534 23.542160173378356 23.169195101053376 26.339398215815734 110-114 27.375692010767434 23.56137945045457 22.520188937985676 26.54273960079232 115-119 27.43203324488059 23.17628798878486 22.47033495218545 26.9213438141491 120-124 28.235 24.185000000000002 21.775 25.805 125-129 27.505449384092866 24.053327926192527 22.35514776701982 26.086074922694785 130-134 27.770713595442754 23.798382584812572 22.14536391841717 26.285539901327503 135-139 27.091593475533248 24.4366373902133 22.33375156838143 26.13801756587202 140-144 27.9607922392886 24.317906224737268 22.190784155214228 25.530517380759903 145-149 28.554002541296057 23.923761118170265 22.205844980940277 25.316391359593393 150 28.80690737833595 22.135007849293565 20.6436420722135 28.414442700156982 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 1.5 16 2.5 17 2.0 18 2.0 19 3.0 20 3.5 21 3.5 22 3.5 23 4.0 24 3.5 25 5.5 26 4.5 27 2.0 28 4.5 29 6.0 30 8.0 31 12.5 32 13.5 33 13.0 34 12.0 35 16.0 36 35.0 37 49.5 38 60.0 39 75.0 40 84.5 41 96.5 42 108.5 43 126.5 44 147.5 45 154.0 46 142.0 47 144.5 48 142.5 49 125.5 50 119.5 51 120.5 52 116.0 53 97.0 54 107.0 55 111.5 56 94.5 57 93.5 58 94.5 59 106.5 60 114.0 61 109.0 62 107.0 63 103.0 64 95.5 65 87.0 66 89.0 67 91.5 68 83.0 69 77.0 70 71.5 71 61.0 72 55.0 73 46.0 74 31.0 75 23.5 76 17.0 77 12.0 78 12.5 79 10.0 80 6.5 81 4.0 82 2.0 83 0.0 84 1.0 85 2.0 86 1.5 87 2.0 88 1.5 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4250000000000003 2 1.225 3 1.175 4 0.5499999999999999 5 0.025 6 1.15 7 0.0 8 0.0 9 0.0 10-14 1.485 15-19 1.695 20-24 0.64 25-29 0.42 30-34 2.205 35-39 1.5 40-44 0.0 45-49 0.0 50-54 1.545 55-59 1.155 60-64 0.005 65-69 0.73 70-74 2.1999999999999997 75-79 0.795 80-84 0.23500000000000001 85-89 0.715 90-94 2.0500000000000003 95-99 0.555 100-104 0.025 105-109 0.795 110-114 1.555 115-119 0.135 120-124 0.0 125-129 1.365 130-134 1.695 135-139 0.375 140-144 1.04 145-149 1.625 150 4.45 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.28994384890251 96.275 2 1.4293006636038794 2.8000000000000003 3 0.20418580908626852 0.6 4 0.05104645227156713 0.2 5 0.025523226135783564 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.0875 0.0 0.0 0.0 0.0 110-111 0.1375 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.5375 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.7124999999999999 0.0 0.0 0.0 0.0 128-129 0.7375 0.0 0.0 0.0 0.0 130-131 0.8500000000000001 0.0 0.0 0.0 0.0 132-133 1.1 0.0 0.0 0.0 0.0 134-135 1.375 0.0 0.0 0.0 0.0 136-137 1.675 0.0 0.0 0.0 0.0 138 1.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCCAA 10 0.007055255 143.41772 5 AAATTAG 10 0.007055255 143.41772 4 GAAAATT 10 0.007055255 143.41772 2 >>END_MODULE Read 1622094 spots for SRR4094486.sra Written 1622094 spots for SRR4094486.sra Read 1622094 spots for SRR4094486.sra Written 1622094 spots for SRR4094486.sra Read 1622094 spots for SRR4094486.sra Written 1622094 spots for SRR4094486.sra Read 1622094 spots for SRR4094486.sra Written 1622094 spots for SRR4094486.sra Read 1622094 spots for SRR4094486.sra Written 1622094 spots for SRR4094486.sra Read 1622094 spots for SRR4094486.sra Written 1622094 spots for SRR4094486.sra Read 1622094 spots for SRR4094486.sra Written 1622094 spots for SRR4094486.sra Read 1622094 spots for SRR4094486.sra Written 1622094 spots for SRR4094486.sra Read 1622094 spots for SRR4094486.sra Written 1622094 spots for SRR4094486.sra Read 1622094 spots for SRR4094486.sra Written 1622094 spots for SRR4094486.sra Read 1622094 spots for SRR4094486.sra Written 1622094 spots for SRR4094486.sra Read 1622094 spots for SRR4094486.sra Written 1622094 spots for SRR4094486.sra Read 1622094 spots for SRR4094486.sra Written 1622094 spots for SRR4094486.sra Read 1622094 spots for SRR4094486.sra Written 1622094 spots for SRR4094486.sra Read 1622094 spots for SRR4094486.sra Written 1622094 spots for SRR4094486.sra Read 1622099 spots for SRR4094486.sra Written 1622099 spots for SRR4094486.sra Read 1622094 spots for SRR4094486.sra Written 1622094 spots for SRR4094486.sra Read 1622094 spots for SRR4094486.sra Written 1622094 spots for SRR4094486.sra Read 1622094 spots for SRR4094486.sra Written 1622094 spots for SRR4094486.sra Read 1622094 spots for SRR4094486.sra Written 1622094 spots for SRR4094486.sra SRR ids: ['SRR4094486.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gyi79rix SRR4094486.sra spots: 32441885 blocks: [[1, 1622094], [1622095, 3244188], [3244189, 4866282], [4866283, 6488376], [6488377, 8110470], [8110471, 9732564], [9732565, 11354658], [11354659, 12976752], [12976753, 14598846], [14598847, 16220940], [16220941, 17843034], [17843035, 19465128], [19465129, 21087222], [21087223, 22709316], [22709317, 24331410], [24331411, 25953504], [25953505, 27575598], [27575599, 29197692], [29197693, 30819786], [30819787, 32441885]] SRR4094486 file size 10908426 SRR4094486 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4094486 SRR4094486_1.fastq SRR4094486_2.fastq Input file: SRR4094486_1.fastq Paired file: SRR4094486_2.fastq trimmed: SRR4094486-trimmed-pair1.fastq, SRR4094486-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:13:05 2024 >> started Sat Dec 7 11:13:55 2024 >> done (50.551s) 32441885 read pairs processed; of these: 240656 ( 0.74%) short read pairs filtered out after trimming by size control 180477 ( 0.56%) empty read pairs filtered out after trimming by size control 32020752 (98.70%) read pairs available; of these: 14568899 (45.50%) trimmed read pairs available after processing 17451853 (54.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 22 0.00% 19 26 0.00% 20 49 0.00% 21 136 0.00% 22 200 0.00% 23 246 0.00% 24 363 0.00% 25 444 0.00% 26 543 0.00% 27 656 0.00% 28 793 0.00% 29 897 0.00% 30 1027 0.00% 31 1220 0.00% 32 1385 0.00% 33 1483 0.00% 34 1676 0.01% 35 1845 0.01% 36 1889 0.01% 37 2147 0.01% 38 2312 0.01% 39 2482 0.01% 40 2604 0.01% 41 2684 0.01% 42 2859 0.01% 43 3055 0.01% 44 3220 0.01% 45 3412 0.01% 46 3630 0.01% 47 3724 0.01% 48 3880 0.01% 49 3988 0.01% 50 4168 0.01% 51 4217 0.01% 52 4461 0.01% 53 4676 0.01% 54 4788 0.01% 55 5007 0.02% 56 5196 0.02% 57 5354 0.02% 58 5582 0.02% 59 5839 0.02% 60 6025 0.02% 61 6294 0.02% 62 6777 0.02% 63 6928 0.02% 64 7159 0.02% 65 7417 0.02% 66 7837 0.02% 67 8122 0.03% 68 8566 0.03% 69 8960 0.03% 70 9701 0.03% 71 10091 0.03% 72 10541 0.03% 73 11220 0.04% 74 11914 0.04% 75 12671 0.04% 76 13504 0.04% 77 14808 0.05% 78 15701 0.05% 79 16879 0.05% 80 18467 0.06% 81 20179 0.06% 82 21855 0.07% 83 24528 0.08% 84 48029 0.15% 85 49086 0.15% 86 50897 0.16% 87 55835 0.17% 88 55953 0.17% 89 59702 0.19% 90 58753 0.18% 91 57353 0.18% 92 61384 0.19% 93 63949 0.20% 94 65982 0.21% 95 68335 0.21% 96 69102 0.22% 97 69989 0.22% 98 71442 0.22% 99 75157 0.23% 100 72160 0.23% 101 71930 0.22% 102 74790 0.23% 103 83047 0.26% 104 78844 0.25% 105 80800 0.25% 106 81812 0.26% 107 87202 0.27% 108 86711 0.27% 109 89107 0.28% 110 94331 0.29% 111 101301 0.32% 112 95563 0.30% 113 95638 0.30% 114 105739 0.33% 115 121255 0.38% 116 101973 0.32% 117 99792 0.31% 118 102614 0.32% 119 107606 0.34% 120 112046 0.35% 121 114396 0.36% 122 132425 0.41% 123 123609 0.39% 124 128404 0.40% 125 138299 0.43% 126 143615 0.45% 127 148067 0.46% 128 152572 0.48% 129 175684 0.55% 130 181074 0.57% 131 188893 0.59% 132 208793 0.65% 133 222163 0.69% 134 231970 0.72% 135 243030 0.76% 136 261619 0.82% 137 282804 0.88% 138 297522 0.93% 139 317273 0.99% 140 339283 1.06% 141 368554 1.15% 142 398795 1.25% 143 444442 1.39% 144 508903 1.59% 145 603193 1.88% 146 749965 2.34% 147 1019332 3.18% 148 1309868 4.09% 149 1818814 5.68% 150 17451853 54.50% 32020752 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=13 prefix-density=0.98 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=91.17 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=11.7 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=16 prefix-density=0.77 prefix-fanout=2.5 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCAGGCAGCCCGTG criterion=fanout-score sequence-density=0.30 sequence-density-rank=21 fanout-score=19.40 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=8.0 sequence=CAAGAAGAAGGT SRR4094486 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:14:32 Started mapping on | Dec 07 11:14:33 Finished on | Dec 07 11:17:11 Mapping speed, Million of reads per hour | 729.59 Number of input reads | 32020752 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 31082616 Uniquely mapped reads % | 97.07% Average mapped length | 283.64 Number of splices: Total | 31204496 Number of splices: Annotated (sjdb) | 29440339 Number of splices: GT/AG | 30792680 Number of splices: GC/AG | 365594 Number of splices: AT/AC | 11842 Number of splices: Non-canonical | 34380 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.55 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 384167 % of reads mapped to multiple loci | 1.20% Number of reads mapped to too many loci | 72313 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.20% % of reads unmapped: other | 1.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 573336 573336 573336 N_multimapping 384167 384167 384167 N_noFeature 1011104 30125555 1273268 N_ambiguous 833276 4043 140953 UnstrandedReadsAssigned:29238236 PositiveStrandReadsAssigned:953018 NegativeStrandReadsAssigned:29668395 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=148 echo kmer=143 SRR4094486 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR4094486-trimmed-pair1.fastq SRR4094486-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,020,752 reads, 29,705,059 reads pseudoaligned [quant] estimated average fragment length: 270.05 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52973 SRR4094486.ke.tsv 35125 SRR4094486.se.tsv 88098 total ==> SRR4094486.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 667.369 0 0 PNS24247 1044 774.95 63.1898 3.50999 PNS24249 1928 1658.95 151.11 3.92095 PNS24246 1044 774.95 63.1898 3.50999 PNS24248 1044 774.95 63.1898 3.50999 PNS24244 1471 1201.95 69.3208 2.48262 PNS24243 293 83.9331 1 0.512861 KQK14069 1603 1333.95 14349.6 463.056 KQK14071 474 222.805 209.276 40.4322 ==> SRR4094486.se.tsv <== BRADI_1g14170v3 15625 BRADI_1g53295v3 113 BRADI_1g59795v3 946 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 279 BRADI_1g74790v3 292 BRADI_1g09890v3 0 BRADI_1g77505v3 452 BRADI_1g48960v3 1 SRR4094486 completed mapping pipeline successfully