Starting /dee2/code/volunteer_pipeline.sh SRR4094487 current disk space = 1543264169984 free memory = 1602322136 SRR4094487 SRAfilesize fc6008e8f8c60d81c665262bf8e3e8d2 SRR4094487.sra SRR4094487.sra file validated SRR4094487 is paired end SRR4094487 is conventional basespace SRR4094487 read1 length is 157 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4094487_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 157 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00625 34.0 31.0 34.0 31.0 34.0 2 32.65725 34.0 33.0 34.0 31.0 34.0 3 32.88125 34.0 33.0 34.0 31.0 34.0 4 36.4575 37.0 37.0 37.0 35.0 37.0 5 36.37975 37.0 37.0 37.0 35.0 37.0 6 36.42275 37.0 37.0 37.0 35.0 37.0 7 36.4505 37.0 37.0 37.0 35.0 37.0 8 36.42 37.0 37.0 37.0 35.0 37.0 9 38.22175 39.0 39.0 39.0 37.0 39.0 10-14 38.527300000000004 39.4 39.0 39.4 36.6 39.4 15-19 39.74925 41.0 40.0 41.0 37.4 41.0 20-24 39.53255 41.0 39.4 41.0 36.6 41.0 25-29 39.416399999999996 41.0 39.2 41.0 36.6 41.0 30-34 39.1288 40.2 39.0 41.0 35.8 41.0 35-39 38.608999999999995 40.0 38.0 41.0 34.8 41.0 40-44 38.1909 40.0 37.6 41.0 33.4 41.0 45-49 37.78825 40.0 36.2 41.0 33.0 41.0 50-54 37.64945 39.6 35.4 41.0 33.0 41.0 55-59 37.015600000000006 38.6 35.0 40.8 32.6 41.0 60-64 36.253750000000004 37.0 35.0 40.0 31.4 41.0 65-69 35.62785 36.0 35.0 39.2 31.0 41.0 70-74 34.9569 35.0 34.4 37.8 31.2 39.8 75-79 34.01559999999999 35.0 33.6 36.2 30.2 38.4 80-84 33.68625 35.0 34.0 35.4 30.2 36.8 85-89 33.30535 35.0 34.0 35.0 30.0 36.0 90-94 33.03845 35.0 34.0 35.0 29.4 35.2 95-99 32.715199999999996 35.0 33.0 35.0 29.0 35.0 100-104 32.381699999999995 35.0 33.0 35.0 27.6 35.0 105-109 32.1004 35.0 33.0 35.0 26.6 35.0 110-114 31.72475 35.0 32.6 35.0 25.0 35.0 115-119 31.38775 34.8 32.0 35.0 24.0 35.0 120-124 31.02435 34.0 31.6 35.0 23.0 35.0 125-129 30.7712 34.0 31.0 35.0 22.2 35.0 130-134 30.403000000000002 34.0 30.6 35.0 20.2 35.0 135-139 29.87835 34.0 30.0 35.0 17.4 35.0 140-144 29.35375 34.0 29.2 35.0 10.8 35.0 145-149 28.64965 34.0 29.0 35.0 2.0 35.0 150-154 27.55545 33.2 26.6 35.0 2.0 35.0 155-157 26.085666666666665 32.333333333333336 23.333333333333332 34.666666666666664 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 3.0 7 4.0 8 4.0 9 3.0 10 3.0 11 8.0 12 5.0 13 5.0 14 9.0 15 10.0 16 5.0 17 13.0 18 8.0 19 14.0 20 24.0 21 27.0 22 20.0 23 17.0 24 38.0 25 26.0 26 34.0 27 37.0 28 58.0 29 74.0 30 110.0 31 144.0 32 171.0 33 251.0 34 398.0 35 612.0 36 1089.0 37 776.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.26913456728364 10.655327663831917 9.204602301150576 41.870935467733865 2 26.26236995686374 10.149708195889367 32.47906622684597 31.108855620400917 3 23.724999999999998 12.85 22.025 41.4 4 28.849999999999998 17.224999999999998 19.950000000000003 33.975 5 29.375 22.625 22.775000000000002 25.224999999999998 6 26.25 29.45 20.974999999999998 23.325000000000003 7 19.225 25.900000000000002 34.925 19.950000000000003 8 20.125 24.775 28.575 26.525 9 21.6 21.6 32.675 24.125 10-14 24.075 25.795 24.985 25.145 15-19 24.2 24.805 24.785 26.21 20-24 24.43 24.63 24.925 26.015 25-29 24.474999999999998 24.08 25.205 26.240000000000002 30-34 24.415 24.575 24.785 26.224999999999998 35-39 24.665 24.21 24.605 26.52 40-44 24.605 24.08 24.935 26.38 45-49 25.080000000000002 24.175 24.6 26.145000000000003 50-54 24.75 23.925 24.709999999999997 26.615 55-59 24.7 23.755000000000003 24.89 26.655 60-64 24.735 24.545 24.585 26.135 65-69 24.575 24.490000000000002 24.224999999999998 26.71 70-74 25.155 24.04 24.305 26.5 75-79 25.424999999999997 23.985 24.16 26.43 80-84 24.990000000000002 23.95 24.01 27.05 85-89 25.295 23.325000000000003 24.55 26.83 90-94 25.945 23.775 23.925 26.355 95-99 25.245 23.385 24.555 26.815 100-104 25.590000000000003 23.53 23.835 27.045 105-109 25.705 23.285 24.72 26.290000000000003 110-114 25.419999999999998 23.494999999999997 24.325 26.76 115-119 26.135 23.745 23.56 26.56 120-124 26.16 24.025 23.345 26.47 125-129 26.340000000000003 22.73 24.154999999999998 26.775 130-134 26.215 23.57 23.655 26.56 135-139 26.58 23.755000000000003 22.62 27.045 140-144 26.040000000000003 23.29 24.03 26.640000000000004 145-149 26.615 23.605 23.549999999999997 26.229999999999997 150-154 26.995 23.25 23.31 26.445 155-157 26.525 23.658333333333335 23.083333333333332 26.73333333333333 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 1.0 28 2.0 29 4.0 30 7.5 31 7.0 32 9.0 33 15.5 34 20.0 35 25.5 36 37.0 37 46.5 38 58.5 39 87.5 40 106.0 41 121.5 42 145.5 43 141.0 44 136.5 45 166.0 46 187.0 47 188.0 48 186.0 49 176.5 50 149.5 51 132.5 52 124.0 53 108.5 54 102.0 55 96.5 56 107.5 57 110.5 58 94.5 59 92.5 60 95.5 61 94.5 62 85.5 63 81.0 64 83.5 65 80.0 66 72.0 67 70.0 68 66.0 69 55.5 70 47.5 71 42.5 72 34.5 73 23.0 74 21.5 75 20.5 76 13.5 77 6.5 78 4.5 79 3.0 80 1.5 81 1.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 1.4749999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-157 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 157 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98938858009096 97.95 2 0.9600808489135927 1.9 3 0.05053057099545225 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.02 0.0 0.0 0.0 0.0 85-89 0.025 0.0 0.0 0.0 0.0 90-94 0.025 0.0 0.0 0.0 0.0 95-99 0.034999999999999996 0.0 0.0 0.0 0.0 100-104 0.07 0.0 0.0 0.0 0.0 105-109 0.12999999999999998 0.0 0.0 0.0 0.0 110-114 0.35500000000000004 0.0 0.0 0.0 0.0 115-119 0.63 0.0 0.0 0.0 0.0 120-124 1.1350000000000002 0.0 0.0 0.0 0.0 125-129 1.67 0.0 0.0 0.0 0.0 130-134 2.13 0.0 0.0 0.0 0.0 135-139 2.51 0.0 0.0 0.0 0.0 140-144 3.56 0.0 0.0 0.0 0.0 145 4.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4094487 read2 length is 157 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4094487_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 157 %GC 53 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.204 33.0 31.0 34.0 2.0 34.0 2 27.62625 34.0 31.0 34.0 2.0 34.0 3 28.137 34.0 31.0 34.0 2.0 34.0 4 31.56575 37.0 35.0 37.0 2.0 37.0 5 31.834 37.0 35.0 37.0 2.0 37.0 6 32.61375 37.0 35.0 37.0 17.0 37.0 7 32.9355 37.0 35.0 37.0 17.0 37.0 8 33.3505 37.0 35.0 37.0 27.0 37.0 9 35.3275 39.0 37.0 39.0 30.0 39.0 10-14 36.09955 39.2 36.2 39.4 30.0 39.4 15-19 37.4638 40.0 36.6 41.0 30.0 41.0 20-24 37.419000000000004 40.0 36.4 41.0 30.0 41.0 25-29 37.2006 40.0 35.8 41.0 30.0 41.0 30-34 36.65835 39.8 34.6 41.0 30.0 41.0 35-39 36.2149 39.6 33.8 41.0 30.0 41.0 40-44 35.688449999999996 39.0 33.0 41.0 30.0 41.0 45-49 34.7646 37.8 31.8 40.2 28.2 41.0 50-54 33.66515 36.2 30.4 39.8 26.4 40.6 55-59 32.9785 35.0 30.2 39.4 23.4 41.0 60-64 31.648649999999996 35.0 30.6 38.6 14.0 40.4 65-69 29.80525 34.0 29.0 36.6 2.0 39.4 70-74 29.987149999999996 34.8 30.0 36.0 2.0 39.0 75-79 29.43705 35.0 30.0 35.0 2.0 37.2 80-84 28.75705 34.8 29.8 35.0 2.0 36.0 85-89 28.12625 34.0 28.6 35.0 2.0 35.2 90-94 27.72275 34.0 27.6 35.0 2.0 35.0 95-99 27.34325 34.0 26.6 35.0 2.0 35.0 100-104 26.680550000000004 33.6 25.0 35.0 2.0 35.0 105-109 26.17475 32.8 23.4 35.0 2.0 35.0 110-114 25.850099999999998 33.0 23.2 35.0 2.0 35.0 115-119 25.7024 32.6 22.2 35.0 2.0 35.0 120-124 25.339000000000002 32.4 20.0 35.0 2.0 35.0 125-129 24.45045 31.0 16.8 34.0 2.0 35.0 130-134 24.319650000000003 31.0 13.6 34.4 2.0 35.0 135-139 23.3196 30.0 6.2 34.0 2.0 35.0 140-144 23.069499999999998 29.8 2.0 34.0 2.0 35.0 145-149 22.3807 29.4 2.0 34.0 2.0 35.0 150-154 21.370250000000002 29.0 2.0 34.0 2.0 35.0 155-157 19.666166666666665 26.666666666666668 2.0 33.333333333333336 2.0 34.666666666666664 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 8.0 4 12.0 5 15.0 6 22.0 7 30.0 8 50.0 9 49.0 10 102.0 11 80.0 12 64.0 13 50.0 14 38.0 15 43.0 16 32.0 17 29.0 18 21.0 19 20.0 20 16.0 21 19.0 22 31.0 23 38.0 24 34.0 25 41.0 26 66.0 27 127.0 28 126.0 29 88.0 30 136.0 31 153.0 32 210.0 33 299.0 34 427.0 35 527.0 36 705.0 37 254.0 38 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.880144187443676 15.50015019525383 12.556323220186242 41.06338239711625 2 26.97058823529412 22.558823529411764 25.794117647058822 24.676470588235293 3 23.15668202764977 23.415898617511523 26.09447004608295 27.33294930875576 4 25.947767481044647 27.57652344846953 19.460825610783488 27.014883459702332 5 29.26490984743412 27.79472954230236 19.583911234396673 23.356449375866852 6 24.91970021413276 32.57494646680942 20.396145610278374 22.109207708779444 7 24.828314844162705 17.934495509772848 32.19756999471738 25.039619651347067 8 24.083769633507853 22.74869109947644 23.403141361256544 29.76439790575916 9 24.251805985552117 21.310629514963882 26.676986584107325 27.76057791537668 10-14 26.698807409286985 23.948236488200962 22.349657447348388 27.003298655163665 15-19 26.89593031986785 24.30795414726936 22.686089002352706 26.11002653051009 20-24 26.119999999999997 24.525 22.869999999999997 26.484999999999996 25-29 26.765 23.830000000000002 22.66 26.745 30-34 26.02 24.015 23.419999999999998 26.545 35-39 26.825 23.82 23.215 26.14 40-44 26.655 23.919999999999998 22.5 26.924999999999997 45-49 27.355 24.12 22.634999999999998 25.89 50-54 26.875 23.79 22.900000000000002 26.435 55-59 27.91058211642328 23.524704940988197 22.389477895579116 26.175235047009405 60-64 27.359394703656996 23.641866330390922 22.829760403530898 26.168978562421184 65-69 26.802370523061064 23.63823756763721 23.287812419479515 26.271579489822212 70-74 26.979031840538443 23.88299249288118 22.573129691949262 26.56484597463112 75-79 26.794083949588583 23.86730548901156 23.211123841266534 26.12748672013332 80-84 27.327976926246393 23.73815409971158 22.527812113720643 26.406056860321385 85-89 26.88859115737401 23.899824796454705 22.56003297949088 26.65155106668041 90-94 26.926014562859617 23.646825194765515 23.229288660318755 26.197871582056116 95-99 26.661163846471315 23.710276516714817 22.585637639290137 27.042921997523734 100-104 27.75610009885022 23.313043025857137 22.745954945112118 26.184901930180533 105-109 26.84732863680773 23.839152568519566 23.258086080115184 26.055432714557515 110-114 26.930703136915955 24.24627586557527 22.782042808480348 26.04097818902842 115-119 27.27272727272727 24.357651429161077 22.21648952636467 26.153131771746978 120-124 26.824968892575697 24.528204064703445 22.723973454997925 25.922853587722937 125-129 27.429794607818152 23.999796136792213 22.542174201111052 26.028235054278582 130-134 27.689999999999998 24.565 22.52 25.224999999999998 135-139 27.49616760347471 24.05723045477772 22.713336739908023 25.73326520183955 140-144 28.317358892438765 24.307774227902023 22.023429179978702 25.351437699680513 145-149 28.41558991739038 24.909976699851725 21.89684388900657 24.77758949375132 150-154 27.983049971577696 25.182161128623843 21.482093948633146 25.352694951165315 155-157 28.208333333333336 24.925 21.666666666666668 25.2 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.5 20 2.5 21 3.5 22 5.5 23 7.0 24 9.5 25 6.5 26 5.0 27 9.0 28 10.0 29 10.5 30 11.0 31 15.5 32 18.0 33 18.5 34 21.0 35 30.0 36 38.0 37 49.5 38 59.0 39 70.5 40 83.5 41 104.5 42 130.0 43 130.0 44 142.5 45 145.5 46 151.5 47 157.0 48 141.0 49 138.0 50 132.5 51 119.0 52 103.0 53 99.0 54 98.0 55 98.0 56 104.5 57 104.0 58 109.5 59 111.0 60 106.0 61 100.5 62 96.0 63 92.0 64 97.5 65 106.0 66 87.5 67 80.0 68 78.5 69 68.0 70 64.5 71 55.5 72 41.5 73 29.0 74 21.5 75 17.5 76 13.0 77 10.5 78 8.0 79 7.0 80 4.0 81 0.5 82 1.5 83 1.5 84 0.5 85 1.0 86 1.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 16.775000000000002 2 15.0 3 13.200000000000001 4 10.975 5 9.875 6 6.6000000000000005 7 5.35 8 4.5 9 3.1 10-14 1.4749999999999999 15-19 0.11499999999999999 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.02 60-64 0.8750000000000001 65-69 2.9749999999999996 70-74 3.4250000000000003 75-79 3.9899999999999998 80-84 2.92 85-89 2.97 90-94 1.805 95-99 3.08 100-104 3.895 105-109 2.765 110-114 1.6549999999999998 115-119 3.09 120-124 3.56 125-129 1.8950000000000002 130-134 0.0 135-139 2.15 140-144 6.1 145-149 5.58 150-154 3.245 155-157 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 157 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98580121703854 97.6 2 0.7860040567951319 1.55 3 0.10141987829614604 0.3 4 0.07606490872210953 0.3 5 0.05070993914807302 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACCTTTCCTGCTGAGCTGAGCACACCTCTCTGTGAACTTTGGGCCTGAG 5 0.125 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.02 0.0 0.0 0.0 0.0 85-89 0.025 0.0 0.0 0.0 0.0 90-94 0.025 0.0 0.0 0.0 0.0 95-99 0.034999999999999996 0.0 0.0 0.0 0.0 100-104 0.07 0.0 0.0 0.0 0.0 105-109 0.10500000000000001 0.0 0.0 0.0 0.0 110-114 0.31500000000000006 0.0 0.0 0.0 0.0 115-119 0.5800000000000001 0.0 0.0 0.0 0.0 120-124 1.0799999999999998 0.0 0.0 0.0 0.0 125-129 1.59 0.0 0.0 0.0 0.0 130-134 2.0 0.0 0.0 0.0 0.0 135-139 2.37 0.0 0.0 0.0 0.0 140-144 3.405 0.0 0.0 0.0 0.0 145 4.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1783408 spots for SRR4094487.sra Written 1783408 spots for SRR4094487.sra Read 1783408 spots for SRR4094487.sra Written 1783408 spots for SRR4094487.sra Read 1783408 spots for SRR4094487.sra Written 1783408 spots for SRR4094487.sra Read 1783408 spots for SRR4094487.sra Written 1783408 spots for SRR4094487.sra Read 1783408 spots for SRR4094487.sra Written 1783408 spots for SRR4094487.sra Read 1783427 spots for SRR4094487.sra Written 1783427 spots for SRR4094487.sra Read 1783408 spots for SRR4094487.sra Written 1783408 spots for SRR4094487.sra Read 1783408 spots for SRR4094487.sra Written 1783408 spots for SRR4094487.sra Read 1783408 spots for SRR4094487.sra Written 1783408 spots for SRR4094487.sra Read 1783408 spots for SRR4094487.sra Written 1783408 spots for SRR4094487.sra Read 1783408 spots for SRR4094487.sra Written 1783408 spots for SRR4094487.sra Read 1783408 spots for SRR4094487.sra Written 1783408 spots for SRR4094487.sra Read 1783408 spots for SRR4094487.sra Written 1783408 spots for SRR4094487.sra Read 1783408 spots for SRR4094487.sra Written 1783408 spots for SRR4094487.sra Read 1783408 spots for SRR4094487.sra Written 1783408 spots for SRR4094487.sra Read 1783408 spots for SRR4094487.sra Written 1783408 spots for SRR4094487.sra Read 1783408 spots for SRR4094487.sra Written 1783408 spots for SRR4094487.sra Read 1783408 spots for SRR4094487.sra Written 1783408 spots for SRR4094487.sra Read 1783408 spots for SRR4094487.sra Written 1783408 spots for SRR4094487.sra Read 1783408 spots for SRR4094487.sra Written 1783408 spots for SRR4094487.sra SRR ids: ['SRR4094487.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cblk9sm5 SRR4094487.sra spots: 35668179 blocks: [[1, 1783408], [1783409, 3566816], [3566817, 5350224], [5350225, 7133632], [7133633, 8917040], [8917041, 10700448], [10700449, 12483856], [12483857, 14267264], [14267265, 16050672], [16050673, 17834080], [17834081, 19617488], [19617489, 21400896], [21400897, 23184304], [23184305, 24967712], [24967713, 26751120], [26751121, 28534528], [28534529, 30317936], [30317937, 32101344], [32101345, 33884752], [33884753, 35668179]] SRR4094487 file size 12483061 SRR4094487 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4094487 SRR4094487_1.fastq SRR4094487_2.fastq Input file: SRR4094487_1.fastq Paired file: SRR4094487_2.fastq trimmed: SRR4094487-trimmed-pair1.fastq, SRR4094487-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:15:06 2024 >> started Sat Dec 7 11:16:17 2024 >> done (71.346s) 35668179 read pairs processed; of these: 115729 ( 0.32%) short read pairs filtered out after trimming by size control 196309 ( 0.55%) empty read pairs filtered out after trimming by size control 35356141 (99.13%) read pairs available; of these: 10938278 (30.94%) trimmed read pairs available after processing 24417863 (69.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 19 0.00% 20 26 0.00% 21 60 0.00% 22 94 0.00% 23 160 0.00% 24 174 0.00% 25 277 0.00% 26 329 0.00% 27 467 0.00% 28 521 0.00% 29 635 0.00% 30 722 0.00% 31 855 0.00% 32 901 0.00% 33 1038 0.00% 34 1116 0.00% 35 1305 0.00% 36 1386 0.00% 37 1537 0.00% 38 1594 0.00% 39 1743 0.00% 40 1874 0.01% 41 1892 0.01% 42 2008 0.01% 43 2033 0.01% 44 2177 0.01% 45 2237 0.01% 46 2397 0.01% 47 2415 0.01% 48 2476 0.01% 49 2587 0.01% 50 2687 0.01% 51 2785 0.01% 52 2782 0.01% 53 2991 0.01% 54 3047 0.01% 55 3202 0.01% 56 3252 0.01% 57 3182 0.01% 58 3399 0.01% 59 3627 0.01% 60 3568 0.01% 61 3784 0.01% 62 3862 0.01% 63 3981 0.01% 64 4213 0.01% 65 4502 0.01% 66 4519 0.01% 67 4959 0.01% 68 4943 0.01% 69 5304 0.02% 70 5568 0.02% 71 5645 0.02% 72 6110 0.02% 73 6626 0.02% 74 6854 0.02% 75 7205 0.02% 76 7592 0.02% 77 8080 0.02% 78 8635 0.02% 79 9058 0.03% 80 9979 0.03% 81 10317 0.03% 82 11163 0.03% 83 11989 0.03% 84 12658 0.04% 85 13458 0.04% 86 14399 0.04% 87 18597 0.05% 88 22840 0.06% 89 24494 0.07% 90 25584 0.07% 91 27176 0.08% 92 28385 0.08% 93 30043 0.08% 94 32591 0.09% 95 32758 0.09% 96 33480 0.09% 97 34946 0.10% 98 35629 0.10% 99 36421 0.10% 100 37288 0.11% 101 37230 0.11% 102 37688 0.11% 103 40088 0.11% 104 36560 0.10% 105 38549 0.11% 106 38848 0.11% 107 39960 0.11% 108 41019 0.12% 109 45990 0.13% 110 53447 0.15% 111 44642 0.13% 112 43827 0.12% 113 42069 0.12% 114 52123 0.15% 115 44590 0.13% 116 52696 0.15% 117 59872 0.17% 118 61863 0.17% 119 61747 0.17% 120 58196 0.16% 121 70233 0.20% 122 98982 0.28% 123 69388 0.20% 124 79350 0.22% 125 62962 0.18% 126 60507 0.17% 127 66014 0.19% 128 76075 0.22% 129 74373 0.21% 130 79614 0.23% 131 71952 0.20% 132 72688 0.21% 133 81419 0.23% 134 84769 0.24% 135 92119 0.26% 136 103940 0.29% 137 120584 0.34% 138 133793 0.38% 139 159627 0.45% 140 170690 0.48% 141 183525 0.52% 142 186930 0.53% 143 201502 0.57% 144 229994 0.65% 145 255292 0.72% 146 270479 0.77% 147 295393 0.84% 148 319692 0.90% 149 347058 0.98% 150 382043 1.08% 151 431284 1.22% 152 503511 1.42% 153 620073 1.75% 154 789887 2.23% 155 1060658 3.00% 156 1413656 4.00% 157 24417863 69.06% 35356141 reads passed initial QC criterion=sequence-density sequence-density=1.01 sequence-density-rank=1 fanout-score=3.07 fanout-score-rank=22 prefix-density=1.06 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=17.89 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=22 prefix-density=0.60 prefix-fanout=2.4 sequence=CCCTCGAGAACCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=76.87 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=3.7 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR4094487 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:16:52 Started mapping on | Dec 07 11:16:52 Finished on | Dec 07 11:19:19 Mapping speed, Million of reads per hour | 865.86 Number of input reads | 35356141 Average input read length | 303 UNIQUE READS: Uniquely mapped reads number | 34888285 Uniquely mapped reads % | 98.68% Average mapped length | 303.60 Number of splices: Total | 39559253 Number of splices: Annotated (sjdb) | 37411932 Number of splices: GT/AG | 39050825 Number of splices: GC/AG | 474385 Number of splices: AT/AC | 15092 Number of splices: Non-canonical | 18951 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.48 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 272108 % of reads mapped to multiple loci | 0.77% Number of reads mapped to too many loci | 19497 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.06% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 210803 210803 210803 N_multimapping 272108 272108 272108 N_noFeature 929403 33922075 1160432 N_ambiguous 894369 4299 165458 UnstrandedReadsAssigned:33064513 PositiveStrandReadsAssigned:961911 NegativeStrandReadsAssigned:33562395 Dataset is classified negative stranded MeadianReadLen=157 20thPercentileLength=153 echo kmer=149 SRR4094487 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR4094487-trimmed-pair1.fastq SRR4094487-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,356,141 reads, 33,559,950 reads pseudoaligned [quant] estimated average fragment length: 265.003 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52973 SRR4094487.ke.tsv 35125 SRR4094487.se.tsv 88098 total ==> SRR4094487.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 672.518 0 0 PNS24247 1044 779.997 55.8186 2.85912 PNS24249 1928 1664 116.542 2.79819 PNS24246 1044 779.997 55.8186 2.85912 PNS24248 1044 779.997 55.8186 2.85912 PNS24244 1471 1207 74.0017 2.44952 PNS24243 293 83.3104 0 0 KQK14069 1603 1339 4622.66 137.93 KQK14071 474 225.298 96.8108 17.1677 ==> SRR4094487.se.tsv <== BRADI_1g14170v3 5037 BRADI_1g53295v3 463 BRADI_1g59795v3 845 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 685 BRADI_1g74790v3 297 BRADI_1g09890v3 0 BRADI_1g77505v3 380 BRADI_1g48960v3 0 SRR4094487 completed mapping pipeline successfully