Starting /dee2/code/volunteer_pipeline.sh SRR4094488 current disk space = 1543293112320 free memory = 1481492676 SRR4094488 SRAfilesize 547cf6c7ecbc30ee619a0e0e3a26c97c SRR4094488.sra SRR4094488.sra file validated SRR4094488 is paired end SRR4094488 is conventional basespace SRR4094488 read1 length is 157 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4094488_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 157 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9765 34.0 31.0 34.0 31.0 34.0 2 32.59175 34.0 31.0 34.0 31.0 34.0 3 32.8645 34.0 33.0 34.0 31.0 34.0 4 36.40775 37.0 37.0 37.0 35.0 37.0 5 36.344 37.0 37.0 37.0 35.0 37.0 6 36.319 37.0 37.0 37.0 35.0 37.0 7 36.364 37.0 37.0 37.0 35.0 37.0 8 36.41 37.0 37.0 37.0 35.0 37.0 9 38.1945 39.0 39.0 39.0 37.0 39.0 10-14 38.47255 39.4 39.0 39.4 36.2 39.4 15-19 39.67165 41.0 40.0 41.0 37.0 41.0 20-24 39.49575 41.0 39.4 41.0 36.4 41.0 25-29 39.36879999999999 41.0 39.0 41.0 36.2 41.0 30-34 39.04885 40.4 38.4 41.0 35.2 41.0 35-39 38.56535 40.0 38.0 41.0 34.6 41.0 40-44 38.08025 40.0 37.2 41.0 33.2 41.0 45-49 37.6958 40.0 36.0 41.0 33.0 41.0 50-54 37.5372 39.6 35.2 41.0 33.0 41.0 55-59 36.9315 38.6 35.0 40.8 32.4 41.0 60-64 36.341750000000005 37.4 35.0 40.0 31.6 41.0 65-69 35.74505 36.2 35.0 39.4 31.0 41.0 70-74 35.051300000000005 35.0 34.6 38.0 31.0 40.2 75-79 34.0641 35.0 33.8 36.2 30.0 38.6 80-84 33.66485 35.0 34.0 35.4 30.0 36.8 85-89 33.23755 35.0 34.0 35.0 30.0 36.0 90-94 32.94325 35.0 33.8 35.0 29.2 35.2 95-99 32.653949999999995 35.0 33.0 35.0 29.0 35.0 100-104 32.4182 35.0 33.0 35.0 27.8 35.0 105-109 32.14705 35.0 33.0 35.0 26.6 35.0 110-114 31.789299999999997 35.0 32.4 35.0 25.0 35.0 115-119 31.46105 34.8 32.0 35.0 24.2 35.0 120-124 30.998450000000002 34.0 31.4 35.0 22.8 35.0 125-129 30.6633 34.0 31.0 35.0 20.0 35.0 130-134 30.30715 34.0 30.4 35.0 19.4 35.0 135-139 29.877950000000006 34.0 30.0 35.0 17.6 35.0 140-144 29.43915 34.0 29.4 35.0 12.6 35.0 145-149 28.717949999999995 34.0 29.0 35.0 3.6 35.0 150-154 27.75335 33.4 27.4 35.0 2.0 35.0 155-157 26.08825 32.333333333333336 23.333333333333332 34.666666666666664 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 5.0 7 4.0 8 5.0 9 7.0 10 3.0 11 9.0 12 2.0 13 5.0 14 4.0 15 8.0 16 10.0 17 8.0 18 10.0 19 11.0 20 16.0 21 21.0 22 21.0 23 30.0 24 21.0 25 29.0 26 41.0 27 56.0 28 68.0 29 69.0 30 103.0 31 124.0 32 205.0 33 266.0 34 377.0 35 601.0 36 1038.0 37 818.0 38 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.79639819909955 9.554777388694347 8.95447723861931 38.6943471735868 2 28.62944162436548 9.16243654822335 30.406091370558375 31.80203045685279 3 24.0 11.425 22.85 41.725 4 29.599999999999998 15.5 20.150000000000002 34.75 5 31.175000000000004 20.25 22.8 25.775 6 27.150000000000002 25.05 22.3 25.5 7 20.7 25.4 34.150000000000006 19.75 8 21.3 24.65 30.85 23.200000000000003 9 21.375 21.425 33.525 23.674999999999997 10-14 23.235 25.955000000000002 26.529999999999998 24.279999999999998 15-19 23.86 24.46 25.545 26.135 20-24 24.044999999999998 24.47 25.245 26.240000000000002 25-29 24.4 24.855 24.665 26.08 30-34 23.78 24.6 25.230000000000004 26.39 35-39 23.53 24.455 25.56 26.455000000000002 40-44 24.455 24.474999999999998 24.615000000000002 26.455000000000002 45-49 24.82 23.57 25.650000000000002 25.96 50-54 24.315 24.51 25.39 25.785000000000004 55-59 24.485 24.125 25.374999999999996 26.015 60-64 24.54 23.94 24.73 26.790000000000003 65-69 24.055 24.08 25.180000000000003 26.685 70-74 24.605 23.605 25.19 26.6 75-79 24.635 24.02 25.11 26.235000000000003 80-84 24.685000000000002 23.73 25.22 26.365 85-89 25.085 24.01 24.165 26.740000000000002 90-94 24.97 23.995 24.525 26.51 95-99 25.365 23.65 24.94 26.045 100-104 25.069999999999997 23.75 24.235 26.945000000000004 105-109 25.564999999999998 23.52 24.575 26.340000000000003 110-114 25.005 24.08 24.18 26.735 115-119 25.135 23.905 23.925 27.034999999999997 120-124 25.69 23.919999999999998 24.055 26.334999999999997 125-129 25.255 23.080000000000002 24.355 27.310000000000002 130-134 25.885 23.494999999999997 24.560000000000002 26.06 135-139 26.02 24.01 23.810000000000002 26.16 140-144 25.740000000000002 23.055 24.615000000000002 26.590000000000003 145-149 25.86 23.175 24.685000000000002 26.279999999999998 150-154 25.705 24.37 23.630000000000003 26.295 155-157 26.108333333333334 24.3 23.058333333333334 26.53333333333333 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.5 26 2.0 27 3.0 28 3.0 29 2.0 30 4.0 31 7.0 32 11.5 33 13.5 34 17.0 35 31.5 36 42.0 37 50.0 38 68.5 39 85.0 40 94.0 41 121.5 42 157.0 43 176.0 44 182.0 45 184.0 46 188.5 47 169.5 48 158.0 49 174.0 50 165.0 51 145.0 52 129.0 53 122.0 54 110.5 55 82.0 56 84.5 57 94.5 58 82.0 59 71.5 60 77.5 61 86.5 62 81.0 63 78.0 64 85.5 65 83.0 66 71.5 67 71.0 68 67.5 69 57.0 70 46.5 71 35.0 72 31.0 73 29.5 74 22.0 75 14.0 76 9.5 77 4.5 78 3.5 79 4.0 80 3.0 81 2.0 82 1.5 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 1.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-157 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 157 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8607594936709 97.625 2 1.0379746835443038 2.0500000000000003 3 0.0759493670886076 0.22499999999999998 4 0.025316455696202535 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.015000000000000003 0.0 0.0 0.0 0.0 50-54 0.025 0.0 0.0 0.0 0.0 55-59 0.025 0.0 0.0 0.0 0.0 60-64 0.025 0.0 0.0 0.0 0.0 65-69 0.025 0.0 0.0 0.0 0.0 70-74 0.025 0.0 0.0 0.0 0.0 75-79 0.025 0.0 0.0 0.0 0.0 80-84 0.030000000000000006 0.0 0.0 0.0 0.0 85-89 0.05 0.0 0.0 0.0 0.0 90-94 0.05 0.0 0.0 0.0 0.0 95-99 0.06000000000000001 0.0 0.0 0.0 0.0 100-104 0.08 0.0 0.0 0.0 0.0 105-109 0.125 0.0 0.0 0.0 0.0 110-114 0.29000000000000004 0.0 0.0 0.0 0.0 115-119 0.575 0.0 0.0 0.0 0.0 120-124 1.015 0.0 0.0 0.0 0.0 125-129 1.4849999999999999 0.0 0.0 0.0 0.0 130-134 2.09 0.0 0.0 0.0 0.0 135-139 2.71 0.0 0.0 0.0 0.0 140-144 3.8299999999999996 0.0 0.0 0.0 0.0 145 4.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCGTCG 10 0.0060508754 151.0 3 TGGCGTC 10 0.0060508754 151.0 2 GTGGCGT 10 0.0060508754 151.0 1 CCCTCAT 10 0.0060508754 151.0 1 >>END_MODULE SRR4094488 read2 length is 157 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4094488_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 157 %GC 52 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.943 33.0 31.0 34.0 2.0 34.0 2 27.457 34.0 31.0 34.0 2.0 34.0 3 27.84275 34.0 31.0 34.0 2.0 34.0 4 31.32825 37.0 35.0 37.0 2.0 37.0 5 31.7135 37.0 35.0 37.0 2.0 37.0 6 32.44625 37.0 35.0 37.0 17.0 37.0 7 32.85725 37.0 35.0 37.0 17.0 37.0 8 33.156 37.0 35.0 37.0 25.0 37.0 9 35.15925 39.0 35.0 39.0 29.0 39.0 10-14 35.9439 39.2 35.8 39.4 30.0 39.4 15-19 37.398250000000004 40.0 36.0 41.0 30.0 41.0 20-24 37.3481 40.0 36.0 41.0 30.0 41.0 25-29 37.15765 40.0 35.4 41.0 30.0 41.0 30-34 36.61135 39.8 34.4 41.0 30.0 41.0 35-39 36.15345 39.6 33.8 41.0 30.0 41.0 40-44 35.7001 39.0 33.0 41.0 30.0 41.0 45-49 34.9422 37.8 32.0 40.2 28.4 41.0 50-54 33.972449999999995 36.6 30.8 39.8 27.2 40.6 55-59 33.32320000000001 35.4 30.4 39.8 25.6 41.0 60-64 31.910900000000005 35.0 30.6 38.6 15.0 40.6 65-69 30.08545 34.0 29.2 36.8 2.0 39.6 70-74 30.1527 35.0 30.0 36.0 2.0 39.0 75-79 29.543650000000003 35.0 30.0 35.0 2.0 37.2 80-84 28.774849999999997 34.4 29.4 35.0 2.0 36.2 85-89 28.0616 34.0 28.2 35.0 2.0 35.2 90-94 27.7486 34.0 27.4 35.0 2.0 35.0 95-99 27.4729 34.0 27.0 35.0 2.0 35.0 100-104 26.92625 33.6 26.0 35.0 2.0 35.0 105-109 26.452749999999998 33.0 24.6 35.0 2.0 35.0 110-114 26.02645 33.0 23.6 35.0 2.0 35.0 115-119 25.78725 32.8 23.0 35.0 2.0 35.0 120-124 25.403100000000002 32.0 20.4 35.0 2.0 35.0 125-129 24.63775 31.0 17.8 34.2 2.0 35.0 130-134 24.422900000000002 31.0 16.6 34.2 2.0 35.0 135-139 23.51075 30.2 8.2 34.0 2.0 35.0 140-144 23.32835 30.0 3.2 34.0 2.0 35.0 145-149 22.69605 29.4 2.0 34.0 2.0 35.0 150-154 21.64865 29.0 2.0 34.0 2.0 35.0 155-157 19.92425 27.0 2.0 33.666666666666664 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 38.0 3 10.0 4 4.0 5 13.0 6 32.0 7 40.0 8 32.0 9 55.0 10 91.0 11 87.0 12 57.0 13 46.0 14 33.0 15 44.0 16 35.0 17 18.0 18 27.0 19 21.0 20 21.0 21 31.0 22 25.0 23 31.0 24 36.0 25 50.0 26 61.0 27 124.0 28 138.0 29 84.0 30 133.0 31 145.0 32 210.0 33 283.0 34 404.0 35 527.0 36 757.0 37 257.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.16019417475729 17.53640776699029 11.862864077669903 38.44053398058252 2 27.25925925925926 21.185185185185183 27.37777777777778 24.177777777777777 3 22.11230724469014 25.19639220250218 27.960430608088448 24.730869944719235 4 26.619718309859152 27.436619718309856 20.422535211267608 25.52112676056338 5 29.02689215414472 28.084280565566957 19.683947879123924 23.2048794011644 6 23.37278106508876 34.53469607315761 18.53146853146853 23.5610543302851 7 23.097321665340758 20.65765049058605 32.16653407584195 24.078493768231237 8 23.99790411317789 22.740372019910925 24.259889965941838 29.00183390096935 9 24.89658738366081 22.931747673216133 26.08583247156153 26.08583247156153 10-14 25.896980461811726 25.2473991372748 22.506977924384675 26.3486424765288 15-19 25.842471583796506 24.825997696660156 22.853137048720644 26.47839367082269 20-24 25.91 24.240000000000002 23.435 26.415 25-29 26.435 24.415 22.59 26.56 30-34 25.480000000000004 24.43 23.595 26.495 35-39 25.945 24.915000000000003 22.785 26.355 40-44 26.150000000000002 24.615000000000002 22.59 26.645000000000003 45-49 26.529999999999998 24.625 22.82 26.025 50-54 26.400000000000002 24.38 22.96 26.26 55-59 26.50060024009604 24.52480992396959 23.294317727090835 25.68027210884354 60-64 27.524093042030373 23.896261163529946 22.392653514304456 26.186992280135225 65-69 27.03539366422454 24.321535445258487 22.727272727272727 25.915798163244247 70-74 26.402862773571208 23.939425370812156 23.560833938388136 26.096877917228507 75-79 26.916053633849845 24.563051077372567 23.138728022121356 25.382167266656232 80-84 27.48001031725561 23.64199123033273 22.96105236007222 25.916946092339437 85-89 26.951269874045014 24.277307454057404 22.764815197191822 26.006607474705763 90-94 26.5566085804545 24.151635585447874 23.46377254662183 25.827983287475796 95-99 27.189583010385988 24.311476256911075 23.081692760812277 25.41724797189066 100-104 27.871929916045264 23.955780361891847 22.829431089325755 25.34285863273713 105-109 27.401915353722583 24.621563175780043 22.701060652867884 25.27546081762949 110-114 26.810783316378433 24.237029501525942 23.19938962360122 25.752797558494407 115-119 27.6026051897033 24.05148351080327 22.63000103380544 25.715910265687995 120-124 26.98857736240914 24.314641744548286 23.431983385254412 25.26479750778816 125-129 27.15961244263131 24.66598674145844 22.865884752677207 25.308516063233043 130-134 27.474999999999998 24.265 23.13 25.130000000000003 135-139 27.848230722029044 24.68807527101657 22.806299856821436 24.65739415013295 140-144 27.650016044496738 24.836880949834207 22.83666702321104 24.676435982458017 145-149 27.406424210246882 25.53225378285108 22.442261746748077 24.61906026015397 150-154 28.346701164294956 25.29366106080207 22.043984476067273 24.315653298835706 155-157 29.03333333333333 24.85833333333333 21.366666666666667 24.741666666666667 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 1.5 19 3.5 20 6.0 21 5.5 22 3.5 23 3.5 24 5.0 25 7.0 26 8.0 27 9.0 28 9.5 29 7.5 30 9.5 31 13.5 32 12.5 33 20.5 34 27.0 35 35.5 36 46.5 37 53.0 38 63.5 39 73.0 40 102.5 41 127.0 42 139.5 43 146.0 44 135.5 45 138.5 46 157.5 47 167.0 48 145.5 49 135.5 50 139.0 51 126.5 52 112.5 53 99.5 54 107.0 55 114.0 56 96.5 57 92.0 58 95.5 59 95.0 60 101.5 61 106.5 62 108.5 63 96.0 64 77.0 65 76.0 66 78.0 67 74.0 68 72.5 69 67.0 70 63.5 71 53.5 72 38.5 73 30.0 74 20.5 75 13.5 76 8.0 77 4.0 78 4.5 79 3.5 80 1.5 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 17.599999999999998 2 15.625 3 14.075 4 11.25 5 9.825000000000001 6 7.049999999999999 7 5.7250000000000005 8 4.575 9 3.3000000000000003 10-14 1.4749999999999999 15-19 0.145 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.04 60-64 0.905 65-69 3.09 70-74 3.5900000000000003 75-79 4.165 80-84 3.075 85-89 3.1399999999999997 90-94 1.87 95-99 3.235 100-104 4.115 105-109 2.8899999999999997 110-114 1.7000000000000002 115-119 3.27 120-124 3.6999999999999997 125-129 1.95 130-134 0.0 135-139 2.22 140-144 6.510000000000001 145-149 5.825 150-154 3.375 155-157 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 157 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98785425101214 97.8 2 0.8603238866396761 1.7000000000000002 3 0.10121457489878542 0.3 4 0.05060728744939271 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.015000000000000003 0.0 0.0 0.0 0.0 50-54 0.025 0.0 0.0 0.0 0.0 55-59 0.025 0.0 0.0 0.0 0.0 60-64 0.025 0.0 0.0 0.0 0.0 65-69 0.025 0.0 0.0 0.0 0.0 70-74 0.025 0.0 0.0 0.0 0.0 75-79 0.025 0.0 0.0 0.0 0.0 80-84 0.030000000000000006 0.0 0.0 0.0 0.0 85-89 0.05 0.0 0.0 0.0 0.0 90-94 0.05500000000000001 0.0 0.0 0.0 0.0 95-99 0.08499999999999999 0.0 0.0 0.0 0.0 100-104 0.10500000000000001 0.0 0.0 0.0 0.0 105-109 0.15 0.0 0.0 0.0 0.0 110-114 0.27 0.0 0.0 0.0 0.0 115-119 0.52 0.0 0.0 0.0 0.0 120-124 0.9400000000000001 0.0 0.0 0.0 0.0 125-129 1.3750000000000002 0.0 0.0 0.0 0.0 130-134 1.9149999999999998 0.0 0.0 0.0 0.0 135-139 2.4000000000000004 0.0 0.0 0.0 0.0 140-144 3.335 0.0 0.0 0.0 0.0 145 4.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1858656 spots for SRR4094488.sra Written 1858656 spots for SRR4094488.sra Read 1858656 spots for SRR4094488.sra Written 1858656 spots for SRR4094488.sra Read 1858656 spots for SRR4094488.sra Written 1858656 spots for SRR4094488.sra Read 1858656 spots for SRR4094488.sra Written 1858656 spots for SRR4094488.sra Read 1858656 spots for SRR4094488.sra Written 1858656 spots for SRR4094488.sra Read 1858656 spots for SRR4094488.sra Written 1858656 spots for SRR4094488.sra Read 1858656 spots for SRR4094488.sra Written 1858656 spots for SRR4094488.sra Read 1858656 spots for SRR4094488.sra Written 1858656 spots for SRR4094488.sra Read 1858656 spots for SRR4094488.sra Written 1858656 spots for SRR4094488.sra Read 1858656 spots for SRR4094488.sra Written 1858656 spots for SRR4094488.sra Read 1858656 spots for SRR4094488.sra Written 1858656 spots for SRR4094488.sra Read 1858656 spots for SRR4094488.sra Written 1858656 spots for SRR4094488.sra Read 1858656 spots for SRR4094488.sra Written 1858656 spots for SRR4094488.sra Read 1858656 spots for SRR4094488.sra Written 1858656 spots for SRR4094488.sra Read 1858656 spots for SRR4094488.sra Written 1858656 spots for SRR4094488.sra Read 1858659 spots for SRR4094488.sra Written 1858659 spots for SRR4094488.sra Read 1858656 spots for SRR4094488.sra Written 1858656 spots for SRR4094488.sra Read 1858656 spots for SRR4094488.sra Written 1858656 spots for SRR4094488.sra Read 1858656 spots for SRR4094488.sra Written 1858656 spots for SRR4094488.sra Read 1858656 spots for SRR4094488.sra Written 1858656 spots for SRR4094488.sra SRR ids: ['SRR4094488.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1eh353jk SRR4094488.sra spots: 37173123 blocks: [[1, 1858656], [1858657, 3717312], [3717313, 5575968], [5575969, 7434624], [7434625, 9293280], [9293281, 11151936], [11151937, 13010592], [13010593, 14869248], [14869249, 16727904], [16727905, 18586560], [18586561, 20445216], [20445217, 22303872], [22303873, 24162528], [24162529, 26021184], [26021185, 27879840], [27879841, 29738496], [29738497, 31597152], [31597153, 33455808], [33455809, 35314464], [35314465, 37173123]] SRR4094488 file size 13010673 SRR4094488 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4094488 SRR4094488_1.fastq SRR4094488_2.fastq Input file: SRR4094488_1.fastq Paired file: SRR4094488_2.fastq trimmed: SRR4094488-trimmed-pair1.fastq, SRR4094488-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:24:09 2024 >> started Sat Dec 7 11:29:26 2024 >> done (317.054s) 37173123 read pairs processed; of these: 137845 ( 0.37%) short read pairs filtered out after trimming by size control 240293 ( 0.65%) empty read pairs filtered out after trimming by size control 36794985 (98.98%) read pairs available; of these: 11981666 (32.56%) trimmed read pairs available after processing 24813319 (67.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 24 0.00% 20 41 0.00% 21 94 0.00% 22 124 0.00% 23 184 0.00% 24 262 0.00% 25 370 0.00% 26 425 0.00% 27 554 0.00% 28 670 0.00% 29 749 0.00% 30 891 0.00% 31 1032 0.00% 32 1210 0.00% 33 1356 0.00% 34 1472 0.00% 35 1603 0.00% 36 1696 0.00% 37 1873 0.01% 38 1937 0.01% 39 2090 0.01% 40 2112 0.01% 41 2340 0.01% 42 2491 0.01% 43 2548 0.01% 44 2672 0.01% 45 2834 0.01% 46 2889 0.01% 47 2975 0.01% 48 3101 0.01% 49 3142 0.01% 50 3209 0.01% 51 3262 0.01% 52 3439 0.01% 53 3564 0.01% 54 3550 0.01% 55 3725 0.01% 56 3888 0.01% 57 3874 0.01% 58 4109 0.01% 59 4124 0.01% 60 4318 0.01% 61 4577 0.01% 62 4824 0.01% 63 4694 0.01% 64 4901 0.01% 65 5262 0.01% 66 5676 0.02% 67 5576 0.02% 68 5902 0.02% 69 6169 0.02% 70 6519 0.02% 71 6772 0.02% 72 7201 0.02% 73 7383 0.02% 74 8115 0.02% 75 8512 0.02% 76 8948 0.02% 77 9348 0.03% 78 10063 0.03% 79 10860 0.03% 80 11372 0.03% 81 12291 0.03% 82 13104 0.04% 83 13781 0.04% 84 14850 0.04% 85 15611 0.04% 86 16831 0.05% 87 21447 0.06% 88 26545 0.07% 89 28110 0.08% 90 29203 0.08% 91 31490 0.09% 92 32714 0.09% 93 33847 0.09% 94 37247 0.10% 95 36723 0.10% 96 38137 0.10% 97 39699 0.11% 98 40565 0.11% 99 40546 0.11% 100 41895 0.11% 101 41641 0.11% 102 42766 0.12% 103 45322 0.12% 104 42085 0.11% 105 43470 0.12% 106 43868 0.12% 107 46811 0.13% 108 47541 0.13% 109 51298 0.14% 110 79594 0.22% 111 51159 0.14% 112 51637 0.14% 113 50668 0.14% 114 66211 0.18% 115 52840 0.14% 116 57026 0.15% 117 71072 0.19% 118 89260 0.24% 119 71536 0.19% 120 61867 0.17% 121 72294 0.20% 122 111971 0.30% 123 72172 0.20% 124 65551 0.18% 125 61663 0.17% 126 80629 0.22% 127 73202 0.20% 128 77652 0.21% 129 102677 0.28% 130 96271 0.26% 131 99307 0.27% 132 102496 0.28% 133 118903 0.32% 134 102758 0.28% 135 110526 0.30% 136 147082 0.40% 137 144325 0.39% 138 166323 0.45% 139 183079 0.50% 140 191417 0.52% 141 212879 0.58% 142 207033 0.56% 143 246248 0.67% 144 258912 0.70% 145 277198 0.75% 146 291779 0.79% 147 312856 0.85% 148 339940 0.92% 149 366843 1.00% 150 402612 1.09% 151 454407 1.23% 152 527571 1.43% 153 646411 1.76% 154 815959 2.22% 155 1092852 2.97% 156 1446054 3.93% 157 24813319 67.44% 36794985 reads passed initial QC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=28 prefix-density=0.81 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=28.12 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=24 prefix-density=0.64 prefix-fanout=2.5 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCAGGCAGCCCGTGGTACGGCTCCGACCGCGTGTTGTACCTCGGCCCGCTCTCCGGCGAACCCCCGAGCTACCTGACCGGTGAGTTCCCCGGCGATTACGGGTGGGACACCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=77.27 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=3.8 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR4094488 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:33:46 Started mapping on | Dec 07 11:33:47 Finished on | Dec 07 11:57:06 Mapping speed, Million of reads per hour | 94.68 Number of input reads | 36794985 Average input read length | 302 UNIQUE READS: Uniquely mapped reads number | 36321102 Uniquely mapped reads % | 98.71% Average mapped length | 302.51 Number of splices: Total | 40377402 Number of splices: Annotated (sjdb) | 38018653 Number of splices: GT/AG | 39880650 Number of splices: GC/AG | 461438 Number of splices: AT/AC | 15225 Number of splices: Non-canonical | 20089 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.45 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299424 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 17183 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.09% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 195192 195192 195192 N_multimapping 299424 299424 299424 N_noFeature 1110726 35351190 1327105 N_ambiguous 901661 4871 151663 UnstrandedReadsAssigned:34308715 PositiveStrandReadsAssigned:965041 NegativeStrandReadsAssigned:34842334 Dataset is classified negative stranded MeadianReadLen=157 20thPercentileLength=152 echo kmer=147 SRR4094488 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR4094488-trimmed-pair1.fastq SRR4094488-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,794,985 reads, 34,866,076 reads pseudoaligned [quant] estimated average fragment length: 262.497 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52973 SRR4094488.ke.tsv 35125 SRR4094488.se.tsv 88098 total ==> SRR4094488.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 675.029 0 0 PNS24247 1044 782.503 74.4988 3.79569 PNS24249 1928 1666.5 145.029 3.46957 PNS24246 1044 782.503 74.4988 3.79569 PNS24248 1044 782.503 74.4988 3.79569 PNS24244 1471 1209.5 56.4751 1.86156 PNS24243 293 86.3897 0 0 KQK14069 1603 1341.5 9416.95 279.864 KQK14071 474 227.73 464.338 81.291 ==> SRR4094488.se.tsv <== BRADI_1g14170v3 12088 BRADI_1g53295v3 121 BRADI_1g59795v3 982 BRADI_1g07683v3 0 BRADI_1g00485v3 18 BRADI_1g20270v3 385 BRADI_1g74790v3 214 BRADI_1g09890v3 0 BRADI_1g77505v3 437 BRADI_1g48960v3 1 SRR4094488 completed mapping pipeline successfully