Starting /dee2/code/volunteer_pipeline.sh SRR4094489 current disk space = 1543237459968 free memory = 1603768404 SRR4094489 SRAfilesize d6be50bf3ddcfc90de2c68a5074f8c9e SRR4094489.sra SRR4094489.sra file validated SRR4094489 is paired end SRR4094489 is conventional basespace SRR4094489 read1 length is 157 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4094489_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 157 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.927 34.0 31.0 34.0 31.0 34.0 2 32.6325 34.0 31.0 34.0 31.0 34.0 3 32.88225 34.0 31.0 34.0 31.0 34.0 4 36.41325 37.0 37.0 37.0 35.0 37.0 5 36.3115 37.0 37.0 37.0 35.0 37.0 6 36.3665 37.0 37.0 37.0 35.0 37.0 7 36.3645 37.0 37.0 37.0 35.0 37.0 8 36.33075 37.0 37.0 37.0 35.0 37.0 9 38.182 39.0 39.0 39.0 37.0 39.0 10-14 38.45595 39.4 39.0 39.4 36.6 39.4 15-19 39.62735 41.0 40.0 41.0 37.2 41.0 20-24 39.44324999999999 41.0 39.0 41.0 36.4 41.0 25-29 39.3019 41.0 39.0 41.0 36.2 41.0 30-34 39.03679999999999 40.2 38.4 41.0 35.4 41.0 35-39 38.48655 40.0 38.0 41.0 34.2 41.0 40-44 38.057550000000006 40.0 37.2 41.0 33.2 41.0 45-49 37.6287 39.8 36.0 41.0 33.0 41.0 50-54 37.46510000000001 39.6 35.2 41.0 32.8 41.0 55-59 36.8044 38.6 35.0 40.8 32.0 41.0 60-64 36.1317 36.8 35.0 40.0 31.2 41.0 65-69 35.438100000000006 35.6 34.6 39.2 31.0 41.0 70-74 34.772400000000005 35.0 34.0 37.6 30.6 39.8 75-79 33.85515 35.0 33.6 36.2 29.6 38.2 80-84 33.54485 35.0 34.0 35.2 30.0 36.8 85-89 33.03665000000001 35.0 33.8 35.0 29.2 36.0 90-94 32.7403 35.0 33.0 35.0 29.0 35.2 95-99 32.3875 35.0 33.0 35.0 27.4 35.0 100-104 32.193799999999996 35.0 33.0 35.0 27.0 35.0 105-109 31.867849999999997 35.0 32.8 35.0 25.6 35.0 110-114 31.464049999999997 35.0 32.0 35.0 24.4 35.0 115-119 31.08575 34.4 31.4 35.0 23.4 35.0 120-124 30.57895 34.0 31.0 35.0 19.6 35.0 125-129 30.347 34.0 31.0 35.0 18.8 35.0 130-134 29.83925 34.0 30.2 35.0 16.2 35.0 135-139 29.34545 34.0 29.6 35.0 9.0 35.0 140-144 28.927699999999998 34.0 29.0 35.0 3.6 35.0 145-149 28.186949999999996 33.6 28.2 35.0 2.0 35.0 150-154 27.20695 33.0 26.2 35.0 2.0 35.0 155-157 25.580583333333333 32.333333333333336 22.333333333333332 34.666666666666664 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 10.0 8 3.0 9 4.0 10 4.0 11 4.0 12 6.0 13 7.0 14 7.0 15 5.0 16 21.0 17 15.0 18 15.0 19 21.0 20 22.0 21 16.0 22 25.0 23 22.0 24 29.0 25 39.0 26 51.0 27 77.0 28 55.0 29 85.0 30 111.0 31 114.0 32 165.0 33 272.0 34 372.0 35 614.0 36 1034.0 37 770.0 38 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.835208802200555 10.827706926731683 8.32708177044261 40.010002500625156 2 29.1751012145749 9.7165991902834 29.782388663967613 31.32591093117409 3 25.025 11.425 23.175 40.375 4 29.075 16.625 20.1 34.2 5 29.975 21.55 22.625 25.85 6 27.900000000000002 26.400000000000002 21.275 24.425 7 20.075000000000003 24.625 34.849999999999994 20.45 8 22.2 24.75 27.800000000000004 25.25 9 22.0 21.075 33.324999999999996 23.599999999999998 10-14 23.7 26.27 25.805 24.224999999999998 15-19 24.45 24.465 25.224999999999998 25.86 20-24 24.58 25.115 24.66 25.645 25-29 24.62 24.65 24.86 25.869999999999997 30-34 25.119999999999997 23.77 24.965 26.145000000000003 35-39 24.735 24.585 24.57 26.11 40-44 24.87 24.075 24.825 26.229999999999997 45-49 24.585 24.365000000000002 24.495 26.555 50-54 24.87 24.205 24.169999999999998 26.755000000000003 55-59 24.915000000000003 23.815 24.725 26.545 60-64 25.115 23.885 24.455 26.545 65-69 25.025 24.04 24.169999999999998 26.765 70-74 25.545 23.57 24.25 26.634999999999998 75-79 26.0 23.919999999999998 24.15 25.929999999999996 80-84 25.61 23.61 24.2 26.58 85-89 25.705 23.65 23.86 26.784999999999997 90-94 25.595000000000002 23.565 24.275 26.565 95-99 25.545 23.77 24.325 26.36 100-104 25.735000000000003 23.35 24.474999999999998 26.44 105-109 25.985000000000003 23.494999999999997 24.560000000000002 25.96 110-114 26.284999999999997 23.415 23.830000000000002 26.47 115-119 25.985000000000003 23.895 23.905 26.215 120-124 25.97 24.385 23.255 26.39 125-129 26.169999999999998 23.43 23.575 26.825 130-134 26.240000000000002 23.810000000000002 23.724999999999998 26.224999999999998 135-139 26.1 23.04 23.98 26.88 140-144 26.115 23.36 23.655 26.87 145-149 26.265 23.380000000000003 24.095 26.26 150-154 26.400000000000002 23.46 23.169999999999998 26.97 155-157 26.625 23.866666666666667 23.175 26.333333333333332 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 1.0 25 1.0 26 2.5 27 2.5 28 2.0 29 5.0 30 8.5 31 8.0 32 10.0 33 17.5 34 23.0 35 26.5 36 37.5 37 47.5 38 62.5 39 86.0 40 99.0 41 124.0 42 154.5 43 167.5 44 163.5 45 153.5 46 169.5 47 165.0 48 151.0 49 159.0 50 149.5 51 133.5 52 137.5 53 128.5 54 95.0 55 83.0 56 85.0 57 90.5 58 84.0 59 75.0 60 91.0 61 102.5 62 89.5 63 91.5 64 93.0 65 83.5 66 82.5 67 76.0 68 65.5 69 58.5 70 58.0 71 45.5 72 30.0 73 27.0 74 25.5 75 20.0 76 13.5 77 11.0 78 9.5 79 6.0 80 2.5 81 1.0 82 1.0 83 1.0 84 0.5 85 0.5 86 1.0 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 1.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-157 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 157 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0911386013633 98.125 2 0.8583690987124464 1.7000000000000002 3 0.025246149962130777 0.075 4 0.025246149962130777 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.02 0.0 0.0 0.0 0.0 80-84 0.05 0.0 0.0 0.0 0.0 85-89 0.06000000000000001 0.0 0.0 0.0 0.0 90-94 0.1 0.0 0.0 0.0 0.0 95-99 0.16999999999999998 0.0 0.0 0.0 0.0 100-104 0.225 0.0 0.0 0.0 0.0 105-109 0.42000000000000004 0.0 0.0 0.0 0.0 110-114 0.655 0.0 0.0 0.0 0.0 115-119 1.1099999999999999 0.0 0.0 0.0 0.0 120-124 1.6949999999999998 0.0 0.0 0.0 0.0 125-129 2.37 0.0 0.0 0.0 0.0 130-134 2.9 0.0 0.0 0.0 0.0 135-139 3.72 0.0 0.0 0.0 0.0 140-144 5.18 0.0 0.0 0.0 0.0 145 6.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4094489 read2 length is 157 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4094489_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 157 %GC 53 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.72275 33.0 30.0 34.0 2.0 34.0 2 27.2365 34.0 31.0 34.0 2.0 34.0 3 27.725 34.0 31.0 34.0 2.0 34.0 4 31.149 37.0 35.0 37.0 2.0 37.0 5 31.49275 37.0 35.0 37.0 2.0 37.0 6 32.299 37.0 35.0 37.0 17.0 37.0 7 32.70275 37.0 35.0 37.0 17.0 37.0 8 33.1925 37.0 35.0 37.0 26.0 37.0 9 35.16375 39.0 35.0 39.0 28.0 39.0 10-14 35.9316 39.2 35.2 39.4 30.0 39.4 15-19 37.3498 40.0 35.8 41.0 30.0 41.0 20-24 37.3452 40.0 35.8 41.0 30.0 41.0 25-29 37.08905 40.0 35.2 41.0 30.0 41.0 30-34 36.487649999999995 39.8 33.8 41.0 30.0 41.0 35-39 36.010949999999994 39.0 33.0 41.0 30.0 41.0 40-44 35.4516 38.8 33.0 41.0 29.6 41.0 45-49 34.651900000000005 37.8 31.2 40.2 28.0 41.0 50-54 33.6463 36.2 30.2 39.8 26.6 40.6 55-59 32.7993 35.0 30.2 39.6 22.8 41.0 60-64 31.43995 35.0 30.4 38.6 11.2 40.6 65-69 29.68305 34.0 29.0 36.8 2.0 39.6 70-74 29.7281 34.8 30.0 36.0 2.0 39.0 75-79 29.30585 35.0 30.0 35.2 2.0 37.4 80-84 28.606150000000003 34.2 29.2 35.0 2.0 36.0 85-89 27.949900000000003 34.0 27.6 35.0 2.0 35.4 90-94 27.50215 34.0 27.0 35.0 2.0 35.0 95-99 27.1532 33.8 26.6 35.0 2.0 35.0 100-104 26.59015 33.2 24.6 35.0 2.0 35.0 105-109 26.0265 32.8 23.2 35.0 2.0 35.0 110-114 25.75865 32.6 23.2 35.0 2.0 35.0 115-119 25.49325 32.6 21.6 35.0 2.0 35.0 120-124 25.058899999999998 32.0 18.8 35.0 2.0 35.0 125-129 24.203200000000002 31.0 15.2 34.0 2.0 35.0 130-134 23.9491 30.8 10.0 34.0 2.0 35.0 135-139 22.946849999999998 29.8 3.2 34.0 2.0 35.0 140-144 22.80285 29.8 2.0 34.0 2.0 35.0 145-149 22.0395 29.4 2.0 34.0 2.0 35.0 150-154 20.9369 28.8 2.0 34.0 2.0 35.0 155-157 19.2045 26.0 2.0 33.333333333333336 2.0 34.666666666666664 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 36.0 3 6.0 4 3.0 5 18.0 6 31.0 7 47.0 8 41.0 9 60.0 10 119.0 11 77.0 12 59.0 13 47.0 14 44.0 15 22.0 16 27.0 17 27.0 18 26.0 19 16.0 20 19.0 21 30.0 22 40.0 23 38.0 24 46.0 25 39.0 26 67.0 27 157.0 28 121.0 29 106.0 30 128.0 31 165.0 32 217.0 33 248.0 34 355.0 35 533.0 36 729.0 37 256.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.41478313989004 16.737935247403787 10.568112400733048 39.27916921197312 2 27.16159809183065 21.854502087060226 26.028622540250446 24.955277280858677 3 21.770894213909994 24.488603156049095 28.988895382817066 24.751607247223845 4 25.538548752834465 27.06916099773243 20.918367346938776 26.47392290249433 5 27.737430167597765 29.720670391061454 20.670391061452513 21.87150837988827 6 24.12493268712978 33.629509962304795 20.086160473882604 22.15939687668282 7 24.26412092283214 19.888623707239457 30.89366215857863 24.953593211349776 8 23.008618438234528 21.781143901802036 23.5309480282058 31.67928963175764 9 24.148606811145513 20.794633642930858 27.476780185758514 27.57997936016512 10-14 26.073059360730593 24.743784880771184 21.988838153221714 27.19431760527651 15-19 25.64192402022123 24.480704739976975 22.58371289854347 27.293658341258322 20-24 25.91 24.15 23.565 26.375 25-29 26.41 24.2 22.405 26.985 30-34 25.75 24.125 23.255 26.87 35-39 26.790000000000003 24.62 22.485 26.105 40-44 26.47 23.89 22.825 26.815 45-49 26.950000000000003 24.36 22.545 26.145000000000003 50-54 26.8 24.404999999999998 22.400000000000002 26.395000000000003 55-59 26.355542216886757 23.97959183673469 22.824129651860744 26.840736294517807 60-64 26.554384549442794 23.967525591246027 23.140537542231858 26.33755231707932 65-69 27.318579516212044 24.076170869788985 22.738033968090583 25.867215645908388 70-74 27.760236037061958 23.59852994461411 22.718567213623896 25.922666804700036 75-79 27.163386441736957 23.477038425492033 22.690825783609288 26.66874934916172 80-84 27.001545595054093 24.14734672849047 22.67903142709943 26.172076249356003 85-89 27.75087574696064 23.547290335874717 22.434576550587266 26.267257366577372 90-94 26.927772126144454 23.901322482197354 23.09257375381485 26.078331637843338 95-99 26.865363791058627 23.884906925179187 23.018614964162325 26.231114319599858 100-104 27.3470024979184 23.6781848459617 22.517693588676103 26.457119067443795 105-109 26.632752684856893 24.438620831406404 22.542520939314524 26.38610554442218 110-114 27.08872317759854 24.21244863795465 22.513062446101557 26.185765738345257 115-119 27.537501933089338 23.42388782926955 22.67127171503686 26.367338522604257 120-124 27.069188909043795 24.41046903342835 22.63280642653537 25.887535630992488 125-129 27.59621258399511 24.185501934432907 22.495418448381184 25.722867033190795 130-134 28.27 23.875 22.24 25.615 135-139 27.89296292513533 24.389745684812585 22.280665917679503 25.436625472372587 140-144 27.621237234668232 25.225899588301342 22.43490349141849 24.717959685611934 145-149 28.127485814286473 25.21610012197062 21.604709126584293 25.051704937158615 150-154 28.409795412275262 25.356478611283322 21.585038231039473 24.648687745401944 155-157 29.975 25.183333333333337 20.458333333333336 24.383333333333333 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.0 19 1.0 20 2.5 21 3.5 22 3.5 23 5.5 24 6.5 25 5.5 26 8.5 27 10.5 28 8.5 29 10.5 30 15.0 31 15.0 32 16.0 33 21.0 34 25.0 35 26.0 36 31.5 37 46.0 38 60.0 39 88.0 40 111.0 41 120.5 42 124.0 43 121.5 44 139.5 45 153.0 46 146.0 47 141.0 48 135.5 49 138.5 50 148.0 51 123.5 52 103.0 53 103.5 54 97.0 55 93.5 56 98.5 57 92.0 58 99.5 59 114.0 60 116.0 61 112.0 62 98.0 63 86.0 64 77.0 65 86.5 66 94.0 67 94.0 68 92.5 69 70.5 70 53.0 71 52.5 72 40.5 73 26.0 74 21.5 75 22.0 76 14.5 77 7.5 78 4.5 79 2.0 80 2.5 81 3.0 82 2.0 83 0.5 84 1.5 85 1.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 18.15 2 16.150000000000002 3 14.45 4 11.799999999999999 5 10.5 6 7.1499999999999995 7 5.7250000000000005 8 4.275 9 3.1 10-14 1.4500000000000002 15-19 0.105 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.04 60-64 0.845 65-69 2.85 70-74 3.405 75-79 3.9699999999999998 80-84 2.9499999999999997 85-89 2.94 90-94 1.7000000000000002 95-99 3.0349999999999997 100-104 3.92 105-109 2.6950000000000003 110-114 1.435 115-119 3.005 120-124 3.5249999999999995 125-129 1.78 130-134 0.0 135-139 2.09 140-144 6.485 145-149 5.715 150-154 3.2199999999999998 155-157 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 157 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78172588832487 97.3 2 0.9898477157360406 1.95 3 0.20304568527918782 0.6 4 0.0 0.0 5 0.0 0.0 6 0.025380710659898477 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.02 0.0 0.0 0.0 0.0 80-84 0.05 0.0 0.0 0.0 0.0 85-89 0.06000000000000001 0.0 0.0 0.0 0.0 90-94 0.1 0.0 0.0 0.0 0.0 95-99 0.16999999999999998 0.0 0.0 0.0 0.0 100-104 0.26 0.0 0.0 0.0 0.0 105-109 0.43499999999999994 0.0 0.0 0.0 0.0 110-114 0.645 0.0 0.0 0.0 0.0 115-119 1.08 0.0 0.0 0.0 0.0 120-124 1.6649999999999998 0.0 0.0 0.0 0.0 125-129 2.35 0.0 0.0 0.0 0.0 130-134 2.83 0.0 0.0 0.0 0.0 135-139 3.55 0.0 0.0 0.0 0.0 140-144 4.895 0.0 0.0 0.0 0.0 145 5.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATTGA 10 0.004443749 167.11429 4 >>END_MODULE Read 2063245 spots for SRR4094489.sra Written 2063245 spots for SRR4094489.sra Read 2063245 spots for SRR4094489.sra Written 2063245 spots for SRR4094489.sra Read 2063245 spots for SRR4094489.sra Written 2063245 spots for SRR4094489.sra Read 2063245 spots for SRR4094489.sra Written 2063245 spots for SRR4094489.sra Read 2063245 spots for SRR4094489.sra Written 2063245 spots for SRR4094489.sra Read 2063245 spots for SRR4094489.sra Written 2063245 spots for SRR4094489.sra Read 2063247 spots for SRR4094489.sra Written 2063247 spots for SRR4094489.sra Read 2063245 spots for SRR4094489.sra Written 2063245 spots for SRR4094489.sra Read 2063245 spots for SRR4094489.sra Written 2063245 spots for SRR4094489.sra Read 2063245 spots for SRR4094489.sra Written 2063245 spots for SRR4094489.sra Read 2063245 spots for SRR4094489.sra Written 2063245 spots for SRR4094489.sra Read 2063245 spots for SRR4094489.sra Written 2063245 spots for SRR4094489.sra Read 2063245 spots for SRR4094489.sra Written 2063245 spots for SRR4094489.sra Read 2063245 spots for SRR4094489.sra Written 2063245 spots for SRR4094489.sra Read 2063245 spots for SRR4094489.sra Written 2063245 spots for SRR4094489.sra Read 2063245 spots for SRR4094489.sra Written 2063245 spots for SRR4094489.sra Read 2063245 spots for SRR4094489.sra Written 2063245 spots for SRR4094489.sra Read 2063245 spots for SRR4094489.sra Written 2063245 spots for SRR4094489.sra Read 2063245 spots for SRR4094489.sra Written 2063245 spots for SRR4094489.sra Read 2063245 spots for SRR4094489.sra Written 2063245 spots for SRR4094489.sra SRR ids: ['SRR4094489.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8amk1cqk SRR4094489.sra spots: 41264902 blocks: [[1, 2063245], [2063246, 4126490], [4126491, 6189735], [6189736, 8252980], [8252981, 10316225], [10316226, 12379470], [12379471, 14442715], [14442716, 16505960], [16505961, 18569205], [18569206, 20632450], [20632451, 22695695], [22695696, 24758940], [24758941, 26822185], [26822186, 28885430], [28885431, 30948675], [30948676, 33011920], [33011921, 35075165], [35075166, 37138410], [37138411, 39201655], [39201656, 41264902]] SRR4094489 file size 14445193 SRR4094489 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4094489 SRR4094489_1.fastq SRR4094489_2.fastq Input file: SRR4094489_1.fastq Paired file: SRR4094489_2.fastq trimmed: SRR4094489-trimmed-pair1.fastq, SRR4094489-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:17:37 2024 >> started Sat Dec 7 11:18:34 2024 >> done (57.942s) 41264902 read pairs processed; of these: 152525 ( 0.37%) short read pairs filtered out after trimming by size control 264423 ( 0.64%) empty read pairs filtered out after trimming by size control 40847954 (98.99%) read pairs available; of these: 14175806 (34.70%) trimmed read pairs available after processing 26672148 (65.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 26 0.00% 20 48 0.00% 21 104 0.00% 22 189 0.00% 23 241 0.00% 24 290 0.00% 25 412 0.00% 26 501 0.00% 27 642 0.00% 28 775 0.00% 29 918 0.00% 30 1082 0.00% 31 1245 0.00% 32 1378 0.00% 33 1490 0.00% 34 1680 0.00% 35 1834 0.00% 36 1962 0.00% 37 2279 0.01% 38 2321 0.01% 39 2555 0.01% 40 2582 0.01% 41 2745 0.01% 42 2831 0.01% 43 3031 0.01% 44 3099 0.01% 45 3138 0.01% 46 3385 0.01% 47 3424 0.01% 48 3557 0.01% 49 3562 0.01% 50 3806 0.01% 51 3706 0.01% 52 3853 0.01% 53 4025 0.01% 54 4091 0.01% 55 4279 0.01% 56 4320 0.01% 57 4733 0.01% 58 4626 0.01% 59 4685 0.01% 60 5069 0.01% 61 5290 0.01% 62 5465 0.01% 63 5467 0.01% 64 5800 0.01% 65 6076 0.01% 66 6324 0.02% 67 6656 0.02% 68 6943 0.02% 69 7226 0.02% 70 7719 0.02% 71 7849 0.02% 72 8404 0.02% 73 8976 0.02% 74 9270 0.02% 75 10088 0.02% 76 10541 0.03% 77 11068 0.03% 78 11891 0.03% 79 12837 0.03% 80 13562 0.03% 81 14280 0.03% 82 15297 0.04% 83 16151 0.04% 84 17377 0.04% 85 18259 0.04% 86 19589 0.05% 87 24744 0.06% 88 30357 0.07% 89 32089 0.08% 90 34003 0.08% 91 36033 0.09% 92 36695 0.09% 93 39591 0.10% 94 45004 0.11% 95 49191 0.12% 96 44498 0.11% 97 45440 0.11% 98 46386 0.11% 99 49139 0.12% 100 55197 0.14% 101 51748 0.13% 102 52297 0.13% 103 51600 0.13% 104 48009 0.12% 105 53134 0.13% 106 58539 0.14% 107 71138 0.17% 108 57462 0.14% 109 65625 0.16% 110 77781 0.19% 111 62583 0.15% 112 73883 0.18% 113 78908 0.19% 114 92580 0.23% 115 68074 0.17% 116 75991 0.19% 117 87163 0.21% 118 86220 0.21% 119 67634 0.17% 120 72031 0.18% 121 114604 0.28% 122 139062 0.34% 123 83356 0.20% 124 72047 0.18% 125 73499 0.18% 126 113547 0.28% 127 153983 0.38% 128 112068 0.27% 129 103277 0.25% 130 102058 0.25% 131 139597 0.34% 132 156823 0.38% 133 175991 0.43% 134 114315 0.28% 135 125424 0.31% 136 166951 0.41% 137 170516 0.42% 138 196699 0.48% 139 240790 0.59% 140 254034 0.62% 141 257706 0.63% 142 239313 0.59% 143 296293 0.73% 144 310493 0.76% 145 326102 0.80% 146 345420 0.85% 147 370896 0.91% 148 400039 0.98% 149 430054 1.05% 150 471283 1.15% 151 527810 1.29% 152 607343 1.49% 153 735552 1.80% 154 923485 2.26% 155 1226019 3.00% 156 1609652 3.94% 157 26672148 65.30% 40847954 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=31 prefix-density=0.87 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=43.60 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=1.1 sequence=GGTACACACGATTCACGATTCTTCCGTCATTCATTCACTCGTGCACCTCATGCTTAATTACATTGCGCGGGGTTCACTCCACCATGGTACAAATCAACACATAACTAGACAAAGGTACAAGTTGATCTACGGCGTACAAGTACACATGCATGCATATATCGATCGTCCGATGGATGGACCGATATATACTACAGCTAGCTGCTAATTCTCATTTAGCTCCCGGGGGCGAAGTTGGTAGCAAAGGCCCATGCATTGTTGTTGACTGGGTCGGCGACGTGGTCGAAGAGGTTCTC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=25 prefix-density=0.72 prefix-fanout=2.7 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCAGGCAGCCCGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=79.13 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=2.5 sequence=CAACAACCACAAAGCAATTAAGCAAAAGCAATGGCCTCCCAGCTCTCCGCCATGGCCTCCGTGCCGCAGTTCCACGGCCTCCGGAGCTACTCGGCGCCGAGGTCATCCATGGCGATGCTGCCAACGCTTAGAGCGTCCAGGAAGAGGTCCCAGGGCATCCGGTGCGACTTCATCGGCTCCTCCACCAACCTCATCATGGTGACGACGACGA SRR4094489 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:19:14 Started mapping on | Dec 07 11:19:14 Finished on | Dec 07 11:21:59 Mapping speed, Million of reads per hour | 891.23 Number of input reads | 40847954 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 40307107 Uniquely mapped reads % | 98.68% Average mapped length | 301.40 Number of splices: Total | 43447820 Number of splices: Annotated (sjdb) | 40868251 Number of splices: GT/AG | 42912074 Number of splices: GC/AG | 498352 Number of splices: AT/AC | 15556 Number of splices: Non-canonical | 21838 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.45 Insertion rate per base | 0.00% Insertion average length | 1.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 321591 % of reads mapped to multiple loci | 0.79% Number of reads mapped to too many loci | 22825 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.08% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 240574 240574 240574 N_multimapping 321591 321591 321591 N_noFeature 1269619 39216701 1525032 N_ambiguous 1003615 5452 172739 UnstrandedReadsAssigned:38033873 PositiveStrandReadsAssigned:1084954 NegativeStrandReadsAssigned:38609336 Dataset is classified negative stranded MeadianReadLen=157 20thPercentileLength=150 echo kmer=145 SRR4094489 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR4094489-trimmed-pair1.fastq SRR4094489-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,847,954 reads, 38,606,613 reads pseudoaligned [quant] estimated average fragment length: 255.463 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52973 SRR4094489.ke.tsv 35125 SRR4094489.se.tsv 88098 total ==> SRR4094489.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 681.941 0 0 PNS24247 1044 789.537 67.3441 3.04469 PNS24249 1928 1673.54 106.371 2.26885 PNS24246 1044 789.537 67.3441 3.04469 PNS24248 1044 789.537 67.3441 3.04469 PNS24244 1471 1216.54 108.596 3.18644 PNS24243 293 90.489 0 0 KQK14069 1603 1348.54 16441.1 435.195 KQK14071 474 233.765 394.555 60.2482 ==> SRR4094489.se.tsv <== BRADI_1g14170v3 18461 BRADI_1g53295v3 126 BRADI_1g59795v3 1154 BRADI_1g07683v3 0 BRADI_1g00485v3 17 BRADI_1g20270v3 361 BRADI_1g74790v3 211 BRADI_1g09890v3 0 BRADI_1g77505v3 516 BRADI_1g48960v3 0 SRR4094489 completed mapping pipeline successfully